International Journal of Current Research and Review
ISSN: 2231-2196 (Print)ISSN: 0975-5241 (Online)
logo
slider
slider
slider
slider
Bootstrap Slider

Indexed and Abstracted in: Crossref, CAS Abstracts, Publons, Google Scholar, Open J-Gate, ROAD, Indian Citation Index (ICI), ResearchGATE, Ulrich's Periodicals Directory, WorldCat (World's largest network of library content and services)

Search Articles

Track manuscript

Full Html

IJCRR - 4(8), April, 2012

Pages: 55-62

Date of Publication: 25-Apr-2012


Print Article   Download XML  Download PDF

COMPARATIVE MICROBIOLOGIC ANALYSIS OF SUBGINGIVAL PLAQUE SAMPLES IN TYPE II DIABETIC AND NON - DIABETIC PATIENTS WITH CHRONIC PERIODONTITIS BY POLYMERASE CHAIN REACTION

Author: Mythireyi D, M G Krishnababa, Kalaivani

Category: Healthcare

Abstract:Background: Although Immuno inflammatory relationship between periodontal diseases and diabetes mellitus is acknowledged, the difference in putative periodontal microorganisms between diabetic and non diabetic individuals is not well established. Aim: To compare the prevalence of two putative periodontal pathogens namely Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis in Type II Diabetic and Non Diabetic patients with chronic periodontitis by Polymerase chain reaction Materials and Method: Sixty subjects were selected from the Department of Periodontics, Tamilnadu Government Dental College and Hospital, Chennai \? 03. 30 Type II diabetic patients with chronic periodontitis were categorized as Group I and 30 Non diabetic patients with chronic periodontitis were categorized as Group II based on American Dental Association classification 1997 and American Academy of Periodontology classification 1999. Two sites- 1 healthy site and 1 diseased site were chosen in each patient, Group I H, II H \? healthy site samples and Group I D, II D- diseased sites samples. Subgingival plaque was collected, DNA isolation was done & the presence of A.actinomycetemcomitans & P.gingivalis DNA was determined by PCR. The PCR products were sequenced and confirmed. The data was statistically analysed. Results: A.actinomycetemcomitans was detected in 6.7 %, 6.7%, 13.3%, 10% in Groups I H, II H, I D, II D respectively. P.gingivalis was detected in 40%, 46.7%, 46.6%, 53.3% in Groups I H, II H, I D, II D respectively. When comparisons were made between Groups I H & II H and Groups I D & II D for the two organisms, no statistically significant difference was obtained Conclusion: The present study shows no statistically significant difference in the prevalence of A.actinomycetemcomitans and P.gingivalis in Type II Diabetic and Non Diabetic patients with chronic periodontitis.

Keywords: Aggregatibacter actinomycetemcomitans, Porphorymonas gingivalis, Diabetes, Periodontitis, Polymerase chain reaction

Full Text:

INTRODUCTION
Chronic inflammatory periodontal disease (periodontitis) is primarily an anaerobic Gram negative oral infection that leads to gingival inflammation, destruction of periodontal tissues, loss of alveolar bone and eventual exfoliation of teeth in severe cases 11. Certain organisms within the microbial flora of dental plaque are the major etiological agents of periodontitis. Traditional thinking / paradigms have maintained that periodontitis is an oral disease 

and that the tissue destructive response remains localized within the periodontium. Whereas studies by Cohen DW et al 19704 , Mattila KJ et al 19898 have indicated that periodontitis may produce a number of alterations in systemic health. Diabetes mellitus is a metabolic disorder characterized by altered glucose tolerance or impaired lipid and carbohydrate metabolism 1 . It has been suggested that a positive correlation exists between diabetes and periodontal destruction based on the fact that loss of periodontal attachment occurs more frequently and more extensively in moderately and poorly controlled diabetic patients than those under good control. Diabetes mellitus influences prevalence and severity of periodontal disease. Although host immune inflammatory response plays an important role, it is the microflora that‘s proved to be the etiological agent in periodontitis

AIM
The aim of the present study was to compare the prevalence of two putative periodontal pathogens namely Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis in Type II Diabetic and Non Diabetic patients with Chronic periodontitis by Polymerase chain reaction.

MATERIALS AND METHOD
SUBJECT SELECTION

Sixty subjects were screened and selected from the out patient Department of Periodontics, Tamilnadu Government Dental College and Hospital, Chennai – 600 003. 30 Type II diabetic patients with chronic periodontitis were categorized as Group I (Study group) and 30 Non diabetic patients with chronic periodontitis patients were categorized as Group II (Control group). Within each group sub categorization was done as follows: Group I H - 30 Healthy sites of Type II Diabetic patients with chronic periodontitis Group I D - 30 Diseased sites of Type II Diabetic patients with chronic periodontitis Group II H - 30 Healthy sites of Non Diabetic patients with chronic periodontitis Group II D - 30 Diseased sites of Non Diabetic patients with chronic periodontitis The criteria for selection of patients with Type 2 Diabetes was based on American Diabetes Association classification (1997)1 and for Chronic periodontitis and Chronic periodontitis modified by Diabetes, the American Academy of Periodontology classification (1999)2 was utilized.

INCLUSION CRITERIA
Age 30 – 60 yrs, Either sex, At least 3 sites with PPD 7 mm, CAL >1mm, At least 2 sites with PPD ≤ 3mm, Type 2 Diabetic patients (Group I), Systemically healthy individuals (Group II)

EXCLUSION CRITERIA
Patients with systemic disease other than Type 2 diabetes(Group I), Patients with systemic disease (Group II), Antibiotic therapy for the past 6 months, Smokers, Periodontal therapy for the past 1 year

Following Institutional Ethical Committee Approval, selection of subjects was done. Informed consent was obtained and a thorough medical and dental history was taken. Intra-oral examination was done using mouth mirror and William‘s periodontal probe. Periodontal evaluation was done by measuring the Plaque Index, the Gingival Bleeding Index, Probing Pocket depth( PPD) and Clinical Attachment level(CAL).

Collection of subgingival plaque sample and polymerase chain reaction
Two plaque samples were taken from the most diseased site and a healthy site from each patient with individual sterile Gracey curettes. The plaque was dislodged into a vial containing 200 l of sterile lysis solution (10mm tris, 1.0 mm EDTA , 1.0% Tris X – 100, pH 78), sealed and stored at -20oC. Subgingival plaque samples was boiled for 10min, cooled to room temperature, centrifuged at 10,000 rpm for 3 min and the supernatant was stored at -20ºC till assay. 10µl of the supernatant was directly used as template in PCR.

Primers utilized in this study
Aggregatibacter actinomycetemcomitans (Aa)
Forward primer : 5‘ CAGCAAGCTGCACAGTTGCAAA – 3‘ Reverse primer : 5‘ CATTAGTTAATGCCGGGCCG TCT – 3‘

(Kraig E et al / Infect Immun 1900, 58 : 920 – 929)
Porphyromonas gingivalis (Pg)
Forward primer : 5‘ ATAATGGAGAACGCAGG AA -3 Reverse primer : 5‘ - TCTTGCCAACCAGTTCCA TTGC – 3‘

(Dickinson et al / J Bacteriol 1998 ; 170 ; 1658 – 1665)
10 µl of the PCR master mixture was pipette into micro centrifuge tubes. 1.0 l of forward primer, 1.0 l of reverse primer, 3.0 l of template DNA and 5.0 l of nuclease free water was added and mixed thoroughly. The micro centrifuge tubes were placed in thermocycler and cycling conditions were set. PCR was performed for 35 cycles of Denaturation at 95oC for 1 min, Primer Annealing at 55oC for 30 sec, Primary extension at 72oC for 1 min, Final extension was 72oC for 10 min. The PCR product was detected by 2% Agarose gel electrophoresis. After the completion of the electrophoresis, gel was taken to the transilluminator and observed under UV-light. (Biorad gel documentation) The PCR product of 238 bp A.actinomycetemcomitans and131 bp P.gingivalis were given to MWG –

BIOTECH, GERMANY for sequencing the PCR products by automated DNA sequencer. The data was collected and statistically analyzed.

STATISTICAL ANALYSIS
Pearson‘s chi square test was used to calculate the overall p value The statistical package SPSS V18 (Statistical Package for Social Science, Version 18) was used for statistical analysis. In the present study, < 0.05 was considered as the level of significance.

RESULTS
In the present study A.actinomycetemcomintans was detected in 6.7% Type II diabetic patients with chronic periodontits -healthy sites (2 out of 30 healthy sites), 13.3% Type II diabetic patients with chronic periodontits -diseased sites(4 out of 30 diseased sites), 6.7% Non diabetic patients with chronic periodontits - healthy sites (2 out of 30 healthy sites) and10.0% Non diabetic patients with chronic periodontits -diseased sites(3 out of 30 diseased sites). In the present study P.gingivalis was detected in 40% Type II diabetic patients with chronic periodontits - healthy sites (12 out of 30 healthy sites, 46.6% Type II diabetic patients with chronic periodontits -diseased sites( 14 out of 30 diseased sites), 46.7% Non diabetic patients with chronic periodontits - healthy sites(14 out of 30 healthy sites) and 53.3% Non diabetic patients with chronic periodontits -diseased sites (16 out of 30 diseased sites DISCUSSION The clinical parameters used in this study were Gingival Bleeding Index, Plaque Index, Probing Pocket Depth and Clinical Attachment level similar to the study by Yuan K et al 200113. Earlier studies employed curettes or paper points for subgingival plaque collection. Sampling by paper point is less invasive than by curette but may result in an underestimation of tightly adherent bacteria in subgingival sites5, 12.Hence in this study curettes were used for sample collection. Although various diagnostic techniques are available to analyse the microbial population of subgingival plaque, PCR technique was opted as it can detect organisms of less than 100 cells3 . In the present study, PCR procedure followed by Yuan et al 200113 was used. Mandel et al 19907 detected 7% A.actinomycetemcomitans, 13% P. gingivalis in diseased sites of NIDDM patients by culture. Zambon et al 198813 employed culture and ELISA assays and detected P.gingivalis in 75% NIDDM subjects. In the present study, 13.3% and 46.6% diseased sites in Type II Diabetic patients with chronic periodontitis and 10.0% and 53.3% of diseased sites in Non Diabetic patients with chronic periodontitis were positive for A.actinomycetemcomitans and P.gingivalis respectively. Our microbiological data revealed higher detection rates when compared with the results of others (except Zambon et al). This may be due to the higher sensitivity of PCR, PCR is more sensitive than culture, immunofluroesence and DNA probes for which sensitivities are 2 x 102 , 2 x 105 , 2 x 104 , 2 x 103 respectively6,14. In a PCR study by Yuan et al 200113, 6.7% and 64.8% of diseased sites in Type II diabetic subjects and 5.7% and 66.7% of diseased sites in Non diabetic patients were positive for A.actinomycetemcomitans and P.gingivalis respectively. The discrepancy in results, may be because a large sample size of 150 patients was chosen by Yuan et al 200113 when compared to the small sample of 30 patients chosen in this study. Also, different authors have analyzed the microorganism distribution in different population and races. When comparing the prevalence rates of A.actinomycetemcomitans and P.gingivalis, the results in our study showed a lower detection rate for A.actinomycetemcomitans which is in concurrent to the study by Yuan K et al 200113 . This may be explained by the conclusion drawn from the studies by Rhodenburg JP et al 19909 , Slots J et al 199010 that the prevalence of A.actinomycetemcomitans was age related and decreased with increasing age. A.actinomycetemcomintans is more responsible for aggressive periodontitis whereas P.gingivalis contributes to chronic periodontitis. Since our subjects were all adults beyond 30 years of age, it is speculated that the contribution of A.actinomycetemcomitans to the periodontitis we examined was minimal. There was no statistically significant difference in the detection rates of the 2 tested microorganisms The plausible reasons are 1) There was no difference in the contribution of the microbiological pathogens in patients with Type II diabetic patients with chronic periodontitis and in Non diabetic patients with chronic periodontitis. 2) The PCR assay is limited in the ability to differentiate large or small amounts of the same pathogen. 3) Other microflora rather than our targeted microorganism such as P.intermedia, C.rectus and Capnocytophaga species (since they are also regarded as important pathogen in periodontitis of NIDDM patients13 )could be an etiological agent in Type II diabetic patients with chronic periodontitis and Non diabetic patients with chronic periodontitis.

CONCLUSION
The search for the etiologic agent of periodontal diseases has been in progress for over a century. In this study it was found that the composition periodontal microflora in periodontal disease sites of Type II diabetic patients with chronic periodontitis was similar to that found in non diabetic patients with chronic periodontitis.

However, the significantly higher detection rate of P.gingivalis in diseased sites further confirms the possible pathogenic role of this bacteria for both groups studied. A.actinomycetemcomintans may not be a causative pathogen in Type II diabetic patients with chronic periodontitis and non diabetic patients with chronic periodontitis. Also, PCR assay provides only a binary results i.e it detects the presence/absence of the microorganism and cannot differentiate positive result s quantitatively. Therefore the difference may exist in the quantitative composition of periodontal microorganism present in Type II diabetic patients with chronic periodontitis and non diabetic patients with chronic periodontitis. Hence further studies with a large sample size and diagnostic technique to quantitatively analyse the composition of microorganisms may be needed.

ACKNOWLEDGEMENT
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.

References:

1. American Diabetes Association . Report of the Expert Committee on the Diagnosis and Classification of Diabetes mellitus Diabetes Care 2001: 24 (Suppl 1 ) S5 –S20

2. Armitage GC: Periodontal diagnosis and classification of periodontal diseases Periodontology 2000 :2004; 34;9 -21

3. Ashimoto A, I Bakker I Slots : Polymerase chain reaction detection of 8 putative periodontal pathogens in subgingival plaque of gingivitis and advanced periodontitis lesions. Oral Microbiol Immunol 1996; 11;266 -273

4. Cohen DW, Friedman LA, Shapiro J, Kyle GC, Franklin S Diabetes mellitus and periodontal disease Two year longitudinal observations Part I J Periodontol 1970 , 41; 709 -712

5. Hartroth B, Jeyfabrt I, Comado G Sampling of periodontal pathogens by paper points : Evaluation of basic parameters Oral Microbiol Immunol 1999; 14; 326 -330

6. Maiden MFJ, Tanner A, Mc Ardle S, Nagpauer K, Goodson JM Tetracycline fibre therapy monitored by DNA probe and culture methods J Periodont Res 1991 ;26;452-459

7. Mandell RL, Dirienzo T, Kent R, Joshipura K,Haber J Microbiology of healthy and diseased periodontitis sites in poorly controlled insulin dependant diabetes J Periodontol 1992;63; 274- 279

8. Mattila KJ, Nieminen MS, Valtonen W, Rasi VP, Kesaniemi YA, Syrjala SL Association between dental health and myocardial infarction BMJ 1989 ;298;779- 782

9. Rodenburg JP, Van Winkelhoff AJ, Winkel EG, Goene RJ, Abbas F, de Graff J Occurrence of Bacteroides gingivalis, Bacteroides intermedius and Actinobacillus actinomycetemcomitans in severe periodontitis in relation to age and treatment history J Clin Periodontol 1990; 17; 392-399

10. Slots J, Feik D, Rams JE Actinobacillus actinomycetemcomitans and Bacteroides intermedius in human periodontitis Age relationship and mutual association J Clin Periodontol 1990; 17;659 -662

11. Socransky SS and Haffajee AD The bacterial etiology of destructive periodontal disease current concepts J Periodontol 1992;63;4;322-331

12. TannerAC, Goodson JM Sampling of microorganisms associated with periodontal disease Oral Microbiol Immunol 1986; 1; 15 -22

13. Yuan K, Chang CJ, Hsu pc, Sun HS, Tseng CC, Wang Jr Detection of putative periodontal pathogens in non insulin dependant diabetes mellitus and diabetes mellitus by Polymerase chain reaction Periodont Res 2001; 36;18-24

14. Zappa u, Reinking – Zappa M ,Graf H, Comparison of serological and DNA probe analysis for detection of suspected periodontal pathogens in subgingival plaque samples Arch Oral Biol 1990; 35;161-164.



Announcements

Dr. Pramod Kumar Manjhi joined Editor-in-Chief since July 2021 onwards

COPE guidelines for Reviewers

SCOPUS indexing: 2014, 2019 to 2021


Awards, Research and Publication incentive Schemes by IJCRR

Best Article Award: 

One article from every issue is selected for the ‘Best Article Award’. Authors of selected ‘Best Article’ are rewarded with a certificate. IJCRR Editorial Board members select one ‘Best Article’ from the published issue based on originality, novelty, social usefulness of the work. The corresponding author of selected ‘Best Article Award’ is communicated and information of award is displayed on IJCRR’s website. Drop a mail to editor@ijcrr.com for more details.

Women Researcher Award:

This award is instituted to encourage women researchers to publish her work in IJCRR. Women researcher, who intends to publish her research work in IJCRR as the first author is eligible to apply for this award. Editorial Board members decide on the selection of women researchers based on the originality, novelty, and social contribution of the research work. The corresponding author of the selected manuscript is communicated and information is displayed on IJCRR’s website. Under this award selected women, the author is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.

Emerging Researcher Award:

‘Emerging Researcher Award’ is instituted to encourage student researchers to publish their work in IJCRR. Student researchers, who intend to publish their research or review work in IJCRR as the first author are eligible to apply for this award. Editorial Board members decide on the selection of student researchers for the said award based on originality, novelty, and social applicability of the research work. Under this award selected student researcher is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.


Best Article Award

A study by Dorothy Ebere Adimora et al. entitled \"Remediation for Effects of Domestic Violence on Psychological well-being, Depression and Suicide among Women During COVID-19 Pandemic: A Cross-cultural Study of Nigeria and Spain\" is awarded Best Article of Vol 14 issue 23
A study by Muhas C. et al. entitled \"Study on Knowledge & Awareness About Pharmacovigilance Among Pharmacists in South India\" is awarded Best article for Vol 14 issue 22
A study by Saurabh Suvidha entitled \"A Case of Mucoid Degeneration of Uterine Fibroid with Hydrosalphinx and Ovarian Cyst\" is awarded Best article of Vol 14 issue 21
A study by Alice Alice entitled \"Strengthening of Human Milk Banking across South Asian Countries: A Next Step Forward\" is awarded Best article of Vol 14 issue 20
A study by Sathyanarayanan AR et al. entitled \"The on-task Attention of Individuals with Autism Spectrum Disorder-An Eye Tracker Study Using Auticare\" is awarded Best article of Vol 14 issue 19
A study by Gupta P. et al. entitled \"A Short Review on \"A Novel Approach in Fast Dissolving Film & their Evaluation Studies\" is awarded Best Article of Vol 14 issue 18.
A study by Shafaque M. et al. entitled \"A Case-Control Study Performed in Karachi on Inflammatory Markers by Ciprofloxacin and CoAmoxicillin in Patients with Chronic Suppurative Otitis Media\" is awarded Best Article of Vol 14 issue 17
A study by Ali Nawaz et al. entitled \"A Comparative Study of Tubeless versus Standard Percutaneous Nephrolithotomy (PCNL) \? A Randomized Controlled Study\" is awarded Best Article for Vol 14 issue 16.
A study by Singh R. et al. entitled \"A Prospective Study to Find the Association of Astigmatism in Patients of Vernal Keratoconjunctivitis (VKC) in a Tertiary Health Care Centre in India (Vindhya Region MP)\" is awarded Best Article for Vol 14 issue 15
A Study by Humaira Tahir et al. entitled "Comparison of First Analgesic Demand after Major Surgeries of Obstetrics and Gynecology between Pre-Emptive Versus Intra-Operative Groups by Using Intravenous Paracetamol: A Cross-Sectional Study" is awarded Best Article for Vol 14 issue 14
A Study by Monica K. entitled "Risk Predictors for Lymphoma Development in Sjogren Syndrome - A Systematic Review" is awarded Best Article for Vol 14 issue 13
A Study by Mokhtar M Sh et al. entitled "Prevalence of Hospital Mortality of Critically Ill Elderly Patients" is awarded Best Article for Vol 14 issue 12
A Study by Vidya S. Bhat et al. entitled "Effect of an Indigenous Cleanser on the Microbial Biofilm on Acrylic Denture Base - A Pilot Study" is awarded Best Article for Vol 14 issue 11
A Study by Pandya S. et al. entitled "Acute and 28-Day Repeated Dose Subacute Toxicological Evaluation of Coroprotect Tablet in Rodents" is awarded Best Article for Vol 14 issue 10
A Study by Muhammad Zaki et al. entitled "Effect of Hemoglobin Level on the Severity of Acute Bronchiolitis in Children: A Case-Control Study" is awarded Best Article for Vol 14 issue 09
A Study by Vinita S & Ayushi S entitled "Role of Colour Doppler and Transvaginal Sonography for diagnosis of endometrial pathology in women presenting with Abnormal Uterine Bleeding" is awarded Best Article for Vol 14 issue 08
A Study by Prabhu A et al. entitled "Awareness of Common Eye Conditions among the ASHA (Accredited Social Health Activist) Workers in the Rural Communities of Udupi District- A Pilot Study" is awarded Best Article for Vol 14 issue 07
A Study by Divya MP et al. entitled "Non-Echoplanar Diffusion-Weighted Imaging and 3D Fiesta Magnetic Resonance Imaging Sequences with High Resolution Computed Tomography Temporal Bone in Assessment and Predicting the Outcome of Chronic Suppurative Otitis Media with Cholesteatoma" is awarded Best Article for Vol 14 issue 06
A Study by Zahoor Illahi Soomro et al. entitled "Functional Outcomes of Fracture Distal Radius after Fixation with Two Different Plates: A Retrospective Comparative Study" is awarded Best Article for Vol 14 issue 05
A Study by Ajai KG & Athira KN entitled "Patients’ Gratification Towards Service Delivery Among Government Hospitals with Particular Orientation Towards Primary Health Centres" is awarded Best Article for Vol 14 issue 04
A Study by Mbungu Mulaila AP et al. entitled "Ovarian Pregnancy in Kindu City, D.R. Congo - A Case Report" is awarded Best Article for Vol 14 issue 03
A Study by Maryam MJ et al. entitled "Evaluation Serum Chemerin and Visfatin Levels with Rheumatoid Arthritis: Possible Diagnostic Biomarkers" is awarded Best Article for Vol 14 issue 02
A Study by Shanthan KR et al. entitled "Comparison of Ultrasound Guided Versus Nerve Stimulator Guided Technique of Supraclavicular Brachial Plexus Block in Patients Undergoing Upper Limb Surgeries" is awarded Best Article for Vol 14 issue 01
A Study by Amol Sanap et al. entitled "The Outcome of Coxofemoral Bypass Using Cemented Bipolar Hemiarthroplasty in the Treatment of Unstable Intertrochanteric Fracture of Femur in a Rural Setup" is awarded Best Article Award of Vol 13 issue 24
A Study by Manoj KP et al. entitled "A Randomized Comparative Clinical Trial to Know the Efficacy of Ultrasound-Guided Transversus Abdominis Plane Block Against Multimodal Analgesia for Postoperative Analgesia Following Caesarean Section" is awarded Best Article Award of Vol 13 issue 23
A Study by Karimova II et al. entitled "Changes in the Activity of Intestinal Carbohydrases in Alloxan-Induced Diabetic Rats and Their Correction with Prenalon" is awarded Best Article of Vol 13 issue 22
A Study by Ashish B Roge et al. entitled "Development, Validation of RP-HPLC Method and GC MS Analysis of Desloratadine HCL and It’s Degradation Products" is awarded Best Article of Vol 13 issue 21
A Study by Isha Gaurav et al. entitled "Association of ABO Blood Group with Oral Cancer and Precancer – A Case-control Study" is awarded Best Article for Vol 13 issue 20
A Study by Amr Y. Zakaria et al. entitled "Single Nucleotide Polymorphisms of ATP-Binding Cassette Gene(ABCC3 rs4793665) affect High Dose Methotrexate-Induced Nephrotoxicity in Children with Osteosarcoma" is awarded Best Article for Vol 13 issue 19
A Study by Kholis Ernawati et al. entitled "The Utilization of Mobile-Based Information Technology in the Management of Dengue Fever in the Community Year 2019-2020: Systematic Review" is awarded Best Article for Vol 13 issue 18
A Study by Bhat Asifa et al. entitled "Efficacy of Modified Carbapenem Inactivation Method for Carbapenemase Detection and Comparative Evaluation with Polymerase Chain Reaction for the Identification of Carbapenemase Producing Klebsiella pneumonia Isolates" is awarded Best Article for Vol 13 issue 17
A Study by Gupta R. et al. entitled "A Clinical Study of Paediatric Tracheostomy: Our Experience in a Tertiary Care Hospital in North India" is awarded Best Article for Vol 13 issue 16
A Study by Chandran Anand et al. entitled "A Prospective Study on Assessment of Quality of Life of Patients Receiving Sorafenib for Hepatocellular Carcinoma" is awarded Best article for Vol 13 issue 15
A Study by Rosa PS et al. entitled "Emotional State Due to the Covid – 19 Pandemic in People Residing in a Vulnerable Area in North Lima" is awarded Best Article for Vol 13 issue 14
A Study by Suvarna Sunder J et al. entitled "Endodontic Revascularization of Necrotic Permanent Anterior Tooth with Platelet Rich Fibrin, Platelet Rich Plasma, and Blood Clot - A Comparative Study" is awarded Best Article for Vol 13 issue 13
A Study by Mona Isam Eldin Osman et al. entitled "Psychological Impact and Risk Factors of Sexual Abuse on Sudanese Children in Khartoum State" is awarded Best Article for Vol 13 issue 12
A Study by Khaw Ming Sheng & Sathiapriya Ramiah entitled "Web Based Suicide Prevention Application for Patients Suffering from Depression" is awarded Best Article for Vol 13 issue 11
A Study by Purushottam S. G. et al. entitled "Development of Fenofibrate Solid Dispersions for the Plausible Aqueous Solubility Augmentation of this BCS Class-II Drug" is awarded Best article for Vol 13 issue 10
A Study by Kumar S. et al. entitled "A Study on Clinical Spectrum, Laboratory Profile, Complications and Outcome of Pediatric Scrub Typhus Patients Admitted to an Intensive Care Unit from a Tertiary Care Hospital from Eastern India" is awarded Best Article for Vol 13 issue 09
A Study by Mardhiah Kamaruddin et al. entitled "The Pattern of Creatinine Clearance in Gestational and Chronic Hypertension Women from the Third Trimester to 12 Weeks Postpartum" is awarded Best Article for Vol 13 issue 08
A Study by Sarmila G. B. et al. entitled "Study to Compare the Efficacy of Orally Administered Melatonin and Clonidine for Attenuation of Hemodynamic Response During Laryngoscopy and Endotracheal Intubation in Gastrointestinal Surgeries" is awarded Best Article for Vol 13 issue 07
A Study by M. Muthu Uma Maheswari et al. entitled "A Study on C-reactive Protein and Liver Function Tests in Laboratory RT-PCR Positive Covid-19 Patients in a Tertiary Care Centre – A Retrospective Study" is awarded Best Article of Vol 13 issue 06 Special issue Modern approaches for diagnosis of COVID-19 and current status of awareness
A Study by Gainneos PD et al. entitled "A Comparative Evaluation of the Levels of Salivary IgA in HIV Affected Children and the Children of the General Population within the Age Group of 9 – 12 Years – A Cross-Sectional Study" is awarded Best Article of Vol 13 issue 05 Special issue on Recent Advances in Dentistry for better Oral Health
A Study by Alkhansa Mahmoud et al. entitled "mRNA Expression of Somatostatin Receptors (1-5) in MCF7 and MDA-MB231 Breast Cancer Cells" is awarded Best Article of Vol 13 issue 06
A Study by Chen YY and Ghazali SRB entitled "Lifetime Trauma, posttraumatic stress disorder Symptoms and Early Adolescence Risk Factors for Poor Physical Health Outcome Among Malaysian Adolescents" is awarded Best Article of Vol 13 issue 04 Special issue on Current Updates in Plant Biology to Medicine to Healthcare Awareness in Malaysia
A Study by Kumari PM et al. entitled "Study to Evaluate the Adverse Drug Reactions in a Tertiary Care Teaching Hospital in Tamilnadu - A Cross-Sectional Study" is awarded Best Article for Vol 13 issue 05
A Study by Anu et al. entitled "Effectiveness of Cytological Scoring Systems for Evaluation of Breast Lesion Cytology with its Histopathological Correlation" is awarded Best Article of Vol 13 issue 04
A Study by Sharipov R. Kh. et al. entitled "Interaction of Correction of Lipid Peroxidation Disorders with Oxibral" is awarded Best Article of Vol 13 issue 03
A Study by Tarek Elwakil et al. entitled "Led Light Photobiomodulation Effect on Wound Healing Combined with Phenytoin in Mice Model" is awarded Best Article of Vol 13 issue 02
A Study by Mohita Ray et al. entitled "Accuracy of Intra-Operative Frozen Section Consultation of Gastrointestinal Biopsy Samples in Correlation with the Final Histopathological Diagnosis" is awarded Best Article for Vol 13 issue 01
A Study by Badritdinova MN et al. entitled "Peculiarities of a Pain in Patients with Ischemic Heart Disease in the Presence of Individual Combines of the Metabolic Syndrome" is awarded Best Article for Vol 12 issue 24
A Study by Sindhu Priya E S et al. entitled "Neuroprotective activity of Pyrazolone Derivatives Against Paraquat-induced Oxidative Stress and Locomotor Impairment in Drosophila melanogaster" is awarded Best Article for Vol 12 issue 23
A Study by Habiba Suhail et al. entitled "Effect of Majoon Murmakki in Dysmenorrhoea (Usre Tams): A Standard Controlled Clinical Study" is awarded Best Article for Vol 12 issue 22
A Study by Ghaffar UB et al. entitled "Correlation between Height and Foot Length in Saudi Population in Majmaah, Saudi Arabia" is awarded Best Article for Vol 12 issue 21
A Study by Siti Sarah Binti Maidin entitled "Sleep Well: Mobile Application to Address Sleeping Problems" is awarded Best Article for Vol 12 issue 20
A Study by Avijit Singh"Comparison of Post Operative Clinical Outcomes Between “Made in India” TTK Chitra Mechanical Heart Valve Versus St Jude Mechanical Heart Valve in Valve Replacement Surgery" is awarded Best Article for Vol 12 issue 19
A Study by Sonali Banerjee and Mary Mathews N. entitled "Exploring Quality of Life and Perceived Experiences Among Couples Undergoing Fertility Treatment in Western India: A Mixed Methodology" is awarded Best Article for Vol 12 issue 18
A Study by Jabbar Desai et al. entitled "Prevalence of Obstructive Airway Disease in Patients with Ischemic Heart Disease and Hypertension" is awarded Best Article for Vol 12 issue 17
A Study by Juna Byun et al. entitled "Study on Difference in Coronavirus-19 Related Anxiety between Face-to-face and Non-face-to-face Classes among University Students in South Korea" is awarded Best Article for Vol 12 issue 16
A Study by Sudha Ramachandra & Vinay Chavan entitled "Enhanced-Hybrid-Age Layered Population Structure (E-Hybrid-ALPS): A Genetic Algorithm with Adaptive Crossover for Molecular Docking Studies of Drug Discovery Process" is awarded Best article for Vol 12 issue 15
A Study by Varsha M. Shindhe et al. entitled "A Study on Effect of Smokeless Tobacco on Pulmonary Function Tests in Class IV Workers of USM-KLE (Universiti Sains Malaysia-Karnataka Lingayat Education Society) International Medical Programme, Belagavi" is awarded Best article of Vol 12 issue 14, July 2020
A study by Amruta Choudhary et al. entitled "Family Planning Knowledge, Attitude and Practice Among Women of Reproductive Age from Rural Area of Central India" is awarded Best Article for special issue "Modern Therapeutics Applications"
A study by Raunak Das entitled "Study of Cardiovascular Dysfunctions in Interstitial Lung Diseas epatients by Correlating the Levels of Serum NT PRO BNP and Microalbuminuria (Biomarkers of Cardiovascular Dysfunction) with Echocardiographic, Bronchoscopic and HighResolution Computed Tomography Findings of These ILD Patients" is awarded Best Article of Vol 12 issue 13 
A Study by Kannamani Ramasamy et al. entitled "COVID-19 Situation at Chennai City – Forecasting for the Better Pandemic Management" is awarded best article for  Vol 12 issue 12
A Study by Muhammet Lutfi SELCUK and Fatma entitled "Distinction of Gray and White Matter for Some Histological Staining Methods in New Zealand Rabbit's Brain" is awarded best article for  Vol 12 issue 11
A Study by Anamul Haq et al. entitled "Etiology of Abnormal Uterine Bleeding in Adolescents – Emphasis Upon Polycystic Ovarian Syndrome" is awarded best article for  Vol 12 issue 10
A Study by entitled "Estimation of Reference Interval of Serum Progesterone During Three Trimesters of Normal Pregnancy in a Tertiary Care Hospital of Kolkata" is awarded best article for  Vol 12 issue 09
A Study by Ilona Gracie De Souza & Pavan Kumar G. entitled "Effect of Releasing Myofascial Chain in Patients with Patellofemoral Pain Syndrome - A Randomized Clinical Trial" is awarded best article for  Vol 12 issue 08
A Study by Virendra Atam et. al. entitled "Clinical Profile and Short - Term Mortality Predictors in Acute Stroke with Emphasis on Stress Hyperglycemia and THRIVE Score : An Observational Study" is awarded best article for  Vol 12 issue 07
A Study by K. Krupashree et. al. entitled "Protective Effects of Picrorhizakurroa Against Fumonisin B1 Induced Hepatotoxicity in Mice" is awarded best article for issue Vol 10 issue 20
A study by Mithun K.P. et al "Larvicidal Activity of Crude Solanum Nigrum Leaf and Berries Extract Against Dengue Vector-Aedesaegypti" is awarded Best Article for Vol 10 issue 14 of IJCRR
A study by Asha Menon "Women in Child Care and Early Education: Truly Nontraditional Work" is awarded Best Article for Vol 10 issue 13
A study by Deep J. M. "Prevalence of Molar-Incisor Hypomineralization in 7-13 Years Old Children of Biratnagar, Nepal: A Cross Sectional Study" is awarded Best Article for Vol 10 issue 11 of IJCRR
A review by Chitra et al to analyse relation between Obesity and Type 2 diabetes is awarded 'Best Article' for Vol 10 issue 10 by IJCRR. 
A study by Karanpreet et al "Pregnancy Induced Hypertension: A Study on Its Multisystem Involvement" is given Best Paper Award for Vol 10 issue 09

List of Awardees

A Study by Ese Anibor et al. "Evaluation of Temporomandibular Joint Disorders Among Delta State University Students in Abraka, Nigeria" from Vol 13 issue 16 received Emerging Researcher Award


RSS feed

Indexed and Abstracted in


Antiplagiarism Policy: IJCRR strongly condemn and discourage practice of plagiarism. All received manuscripts have to pass through "Plagiarism Detection Software" test before Toto Macau forwarding for peer review. We consider "Plagiarism is a crime"

IJCRR Code of Conduct: To achieve a high standard of publication, we adopt Good Publishing Practices (updated in 2022) which are inspired by guidelines provided by Committee on Publication Ethics (COPE), Open Access Scholarly Publishers Association (OASPA) and International Committee of Medical Journal Editors (ICMJE)

Disclaimer: International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal.



ABOUT US

International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal

Contact

148, IMSR Building, Ayurvedic Layout,
        Near NIT Complex, Sakkardara,
        Nagpur-24, Maharashtra State, India

editor@ijcrr.com

editor.ijcrr@gmail.com


Copyright © 2026 IJCRR. Specialized online journals by ubijournal