<?xml version="1.0"?>
<xml><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>IMPROVING GROWTH INDICES AND PERFORMANCE IN WEANED PIGS UPTO GROWER STAGE WITH HERBAL ANTISTRESS SUPPLEMENT&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>01</FirstPage><LastPage>06</LastPage><AuthorList><Author>Praveen Kumar</Author><AuthorLanguage>English</AuthorLanguage><Author> K. Ravikanth</Author><AuthorLanguage>English</AuthorLanguage><Author> Adarsh</Author><AuthorLanguage>English</AuthorLanguage><Author> C. Abhinay</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Objective: Studying the growth promoting and performance enhancing activity of Stresomix in weaned pigs up to grower stage.12 weaned pigs (Tamworth &#xD7; Desi breed) of almost same age group (2-3month) and body weight were procured. All the 12 experimental piglets were randomly divided into 2 groups- group T1 and group T2 maintaining similar male: female ratio (n=6). Each group was allotted to different dietary treatments. Group T1 served as no treatment control group fed with basal ration only and group T2 piglets were supplemented with Stresomix (1kg/tone of feed) (M/S Ayurvet Limited, Baddi, India). Growth and haemato biochemical parameter were studied for 90 days on fortnightly basis. Daily body weight gain and linear body measurements were high in Stresomix supplemented group T2. Feed conversion efficiency was significantly improved in Stresomix supplemented&#xD;
group T2. Haemato biochemical parameters were normal in Stresomix supplemented group T2. Stresomix improved the growth parameters and enhanced the feed efficiency in the piglets.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Stress, Growth rate, Haemato biochemical parameters</Keywords><Fulltext>NTRODUCTION&#xD;
&#xD;
Immature immune system, hypothermia and immature gastrointestinal system at the time of birth are three important challenges for newborn piglets1 . Chilling &#x2013; or hypothermia &#x2013; is a major problem for newborn piglets. Perinatal mortality in modern pig production herds is relatively high (15 to 25%) compared with values for other production animal species2 . High variation in birth weight contributes to reduced survival, at least for litters of low mean birth weight, and to variable weaning weights3,4,5. Survival rate for the first seven days of life was 32% for piglets weighing less than 0.8 kg, compared to 97% for piglets weighing more than 2.0 kg, meaning that the piglets&#x2019; birth weight affects its chances for survival6 . At weaning, piglets are exposed to a range of stressors, including changes in diet composition, environment and bacterial challenges, contributing to digestive upsets and depressions in growth rate7,8,9,10. Number of piglets produced per sow per year is the most important trait affecting the financial results11, so it is of great importance to reduce stress induced mortality in piglets and increase the body weight of the piglets by using a natural antistressor. The current study was designed to study the effect of Stresomix, a natural antistress agent (M/S Ayurvet Limited, India) on growth and performance in piglets.&#xD;
&#xD;
MATERIAL AND METHODS&#xD;
&#xD;
Experimental design &#xD;
&#xD;
12 weaned piglets (Tamworth &#xD7; Desi breed) of almost same age group (2-3monthes) and body weight were procured for the experiment from instructional pig farm, R.V.C. Two weeks before starting of experiment piglets were maintained on balanced ration. 15 day before start of the experiment all the piglets were dewormed with Albendazole. All animals were vaccinated against FMD and swine fever. Thereafter, all the 12 experimental piglets were randomly divided into 2 groups- group T1 and&#xA0;group T2 maintaining similar male: female ratio (n=6). Each group was allotted to different dietary treatments. Group T1 served as no treatment control group fed with basal ration only and group T2 piglets were supplemented with Stresomix (1kg/tone of feed) along with basal ration. Basal ration formula given in table 1 and table 2.&#xD;
&#xD;
&#xD;
&#xD;
The experiment was carried in weaned piglets upto grower stage. For 2 months experimental feeding was done followed by post treatment period of one month. Growth performance parameters viz. fortnightly body measurement, fortnightly body weight gain, Daily feed consumption and fortnightly feed conversion efficiency were recorded. Haematobiochemical parameters were also recorded during the study period on 0day, 45th day and on 90th day. Comparative economic of feeding was calculated on the basis of total feed consumption during experiment and total body weight gain in same period.&#xD;
&#xD;
Statistical analysis &#xD;
&#xD;
All the results were analyzed statistically by analysis of variance to determine the means and standard error as per the methods described by Snedecor and Cochran12.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
Feed Consumption per pig per fortnight (0-90 days/ 6 fortnights) Total feed consumption per pig was 121.63 kg/pig (table 3) in Stresomix supplemented piglets of group T2 . The increase in feed consumption may be increased because of improvement in appetite and reduction in stress. Wide variety of herbal constituents improve appetite by stimulation of saliva secretion, enhance the synthesis of bile acids in the liver, helps in digestion and absorption of lipids and some also increase the activity of digestive enzymes of gastric mucosa13. Stresomix contain herbs like Withania somnifera, Ocimum sanctum which are reported to possess appetite stimulatory and antistress activity 14,15,16,17.&#xD;
&#xD;
&#xD;
&#xD;
Body weight (g) daily change&#xD;
&#xD;
The daily weight was significantly (P</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=603</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=603</Fulltext></URLs><References>1. Sangild PT, Thymann T, Schmidt M, Stoll B, Burrin DG, Buddington RK. The preterm Pig as a Model in Pediatric Gastroenterology. J Anim Sci 2013; 91: 4713-29.&#xD;
&#xD;
2. Rootwelt V, Reksen O, Farstad W, Framstad T. Postpartum deaths: Piglet, placental, and umbilical characteristics. J Anim Sci 2013; 91: 2647-56.&#xD;
&#xD;
3. Milligan BN, Fraser D, Kramer DL. Within-litter birth weight variation in the domestic pig and its relation to preweaning survival, weight gain, and variation in weaning weights. Livest Prod Sci 2002; 76: 181-91.&#xD;
&#xD;
4. Johnson RK, Nielsen MK, Casey DS. Reponses in ovulation rate, embryonal survival, and litter traits in swine to 14 generations of selection to increase litter size. J Anim Sci 1999; 77: 541-57.&#xD;
&#xD;
5. Quiniou N, Dagorn J, Gaudre D. Variation of piglets birth weight and consequences on subsequent performance. Livest Prod Sci 2002; 78: 63-70.&#xD;
&#xD;
6. Gardner IA, Hird DV, Franti CE.. Neonatal survival in swine: Effects of low birth weight and clinical disease. Am J Vet Res 1989; 50: 792-97.&#xD;
&#xD;
7. Le Dividich J, Herpin P. Effects of climatic conditions on the performance, metabolism and health status of weaned piglets: a review. Livest Prod Sci 1994; 38: 79-90.&#xD;
&#xD;
8. McCracken BA, Gaskins HR, Ruwe-Kaiser PJ, Klasing KC, Jewell DE. Diet-dependent and diet-independent metabolic responses underlie growth stasis of pigs at weaning. J Nutr 1995; 125: 2838-45.&#xD;
&#xD;
9. McCracken BA, Spurlock ME, Roos MA, Zuckermann FA, Gaskins HR. Weaning anorexia may contribute to local inflammation in the piglet small intestine. J Nutr 1999; 129: 613-19.&#xD;
&#xD;
10. Fraser D, Milligan BN, Pajor EA, Philips PA, Tayor AA, Weary DM. Progress in pigs science. In: Wiseman JM, Varley A, Chadwick JP, editors. Nottingham University Press; 1997.p. 121-40.&#xD;
&#xD;
11. Palm&#xF8; HA. Derivation of economic values for sow litter, oestrus and longevity traits, offspring production and carcass traits under Danish production circumstances using a profit equation model. PhD-thesis. The Royal Veterinary and Agricultural University, Copenhagen, Denmark, 1999.&#xD;
&#xD;
12. Snedecor GW, Cochran WG. Statistical Methods. 8th ed. IOWA: IOWA State University Press; 1994. p. 1-503.&#xD;
&#xD;
13. Srinivasan K. Spices as influencers of body metabolism: An overview of three decades of research. Food Res Int 2005; 38: 77-86&#xD;
&#xD;
14. Bhattacharya SK, Muruganandam AV. Adaptogenic activity of Withania somnifera: an experimental study using a rat model of chronic stress. Pharmacol Biochem Behav 2003; 75(3): 547-55.&#xD;
&#xD;
15. Kaur P, Mathur S, Sharma M, Tiwari M, Srivastava KK, Chandra R. A biologically active constituent of Withania somnifera (ashwagandha) with antistress activity. Indian J Clin Biochem 2001; 16(2): 195-98.&#xD;
&#xD;
16. Godhwani S, Godhwani JL and Vyas DS. Ocimum sanctum. A preliminary study evaluating its immunoregulatory profile in albino rats. J Ethnopharmacol 1988; 24: 193-98.&#xD;
&#xD;
17. Rastogi S. Ayurveda for comprehensive healthcare. Indian J Med Ethics 2009; 6(2): 101-02.&#xD;
&#xD;
18. Hou&#x161;ka L, Wolfov&#xE1; M, Nagy I, Cs&#xF6;rnyei Z, Koml&#xF3;si I. Economic values for traits of pigs in Hungary. Czech J Anim Sci 2010; 55 (4): 139-48.&#xD;
&#xD;
19. Rukmini C, Vijayarahhavan M. Nutritional and Toxicological evaluation of mango kernal oil. J Enviromental Pathological Toxicol 1980; 4: 93-103.&#xD;
&#xD;
20. Mwale M, Mupangwa JF, Mapiye C. Growth performance of guinea fowl keets fed graded levels of baobab seed cake diets. Int J Poult Sci 2008; 7: 429-32.&#xD;
&#xD;
21. Reddy ET, Reddy PS, Satyanarayana PVV Reddy, Shakila S. Effect of herbal preparations (Phyllanthus emblica, Curcuma longa and Ocimum sanctum) on the performance of broilers. Tamilnadu J Veterinary &amp; Animal Sciences 2012; 8(4): 209-14.&#xD;
&#xD;
22. Kale VR, Wankhede SM, Karle SD. Effect of Dietary Supplementation of Ashwagandha (Withania somnifera) on Carcass Quality of Broiler Chicken. Indian J Anim Nutr 2014; 31(1): 81-5&#xD;
&#xD;
23. Tegbe JS, Olurunju SAS. The Prediction of Liveweight of crossbred pigs from three body measurements. Nig J Anim Prod 1988; 15: 9-13.&#xD;
&#xD;
24. Oke UK, Ibe SN, Ologbose FI, Amaefule KU. Effect of breed of sire on growth performance of exotic and crossbreed pigs in a humid tropical environment. J Anim Vet Adv 2006; 5: 744-48.&#xD;
&#xD;
25. Sungirai M, Masaka L, Benhura TM. Validity of Weight Estimation Models in Pigs Reared under Different Management Conditions. Vet Med Int 2014; 1: 1-5.&#xD;
&#xD;
26. Khan TA, Zafar F. Haematological Study in Response to Varying Doses of Estrogen in Broiler Chicken. Int J Poult Sci 2005; 4(10): 748-51.&#xD;
&#xD;
27. Etim NN, Enyenihi GE , Williams ME, Udo MD, Offiong EEA. Haematological Parameters: Indicators of the Physiological Status of Farm Animals. British J Sci. 2013; 10(1): 33-45.&#xD;
&#xD;
28. Adenkola AY, Ayo JO, Asala OO. Variations in Haematological Parameters and Erythrocyte Osmotic Fragility of Pigs during Hot-Dry and Harmattan Season in Northern Guinea Savanna Zone of Nigeria. Niger J Physiol Sci 2011; 26: 113-18.&#xD;
&#xD;
29. Svobodov&#xE1; AR, Galand&#xE1;kov&#xE1; A, Siansk&#xE1; J, Dole&#x17E;al D, Ulrichov&#xE1; J, Vost&#xE1;lov&#xE1; J. Acute exposure to solar simulated ultraviolet radiation affects oxidative stress-related biomarkers in skin, liver and blood of hairless mice. Biol Pharm Bull 2011; 34(4): 471-9.&#xD;
&#xD;
30. Sahin K, Sahin N, Onderci M, Yaraliogu S, Kucuk O. Protective role of supplemental vitamin E on lipid peroxidation, vitamins E, A and some mineral concentrations of broilers reared under heat stress. Vet Med Czech 2001; 46: 140-44.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>DETERMINATION OF HUMAN IMMUNODEFICIENCY VIRUS TYPE-1 AND ALLIED SUBTYPES IN SUDAN&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>07</FirstPage><LastPage>12</LastPage><AuthorList><Author>Mohammed A. Hammad</Author><AuthorLanguage>English</AuthorLanguage><Author> Karimeldin M.A. Salih</Author><AuthorLanguage>English</AuthorLanguage><Author> Mohammed A. Abdallah</Author><AuthorLanguage>English</AuthorLanguage><Author> Rashid A. Salih</Author><AuthorLanguage>English</AuthorLanguage><Author> Ahmed A. Mohammedani</Author><AuthorLanguage>English</AuthorLanguage><Author> Isam M. Elkhidir</Author><AuthorLanguage>English</AuthorLanguage><Author> Ayman A. Elshayeb</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Human Immunodeficiency Virus-1 (HIV-1) is the most common infection of an unresolved global disease that has had massive impact on human life since its emergence. Transmission of HIV-1 is still rapidly spreading despite identification over 33 years ago and an immense worldwide research effort to counter it.&#xD;
Objectives: The aim of this study is to determine the HIV-1genotype and subtypes that cause AIDS in Sudan.&#xD;
Methods: Samples were investigated and analyzed in three different laboratories; two in Sudan and the third one in Kenya, the Central Lab of Omdurman Military Hospital, Department of Microbiology, Virology Lab of Faculty of Medicine University of Khartoum and Kenya Medical Research Institute (KMERI) -Virus Research Center- Nairobi Kenya.&#xD;
Results: HIV-1 was detected by RT-PCR at the virology lab and the result revealed (188) samples (90.9 %) positive for HIV- 1 (12) samples (9.1%) were negative for HIV-1. Concerning HIV-1 subtypes or clades one hundred of EDTA samples were processed at Kenya Medical Research Institute (KMERI), Using hetero-duplex Mobility Assay Technique (HMA) for env gene. Three subtypes were detected: subtype (A) (46%), Subtype (C) (33%) and subtype (D) (21%). CD4 count was estimated before antiretroviral therapy and three month after treatment, it was found that 71% were responding and 29% were not.&#xD;
Conclusion: The study concluded that the detected HIV subtypes in Sudan were subtypes (A) (C) and (D). Most of the patients were responding to ARV.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>AIDS, Genotype, Heteroduplex, Kenya, Serotype, Sudan</Keywords><Fulltext>INTRODUCTION &#xD;
&#xD;
Acquired Immunodeficiency Syndrome (AIDS) was first recognized as a new and distinct clinical entity in 1981. The first cases were recognized become of unusual clustering of diseases such as kaposi sarcoma and pneumocystis carinii, and pneumonia in young homosexual men, [1]. Analysis of HIV-1 genes of virus strains from different geographical locales has revealed that HIV-I can be divided into two distinctive groups, M (major) and O (outlier) [2]. HIV-1 group M isolates can be further subdivided into at least 10 distinct genetic subtypes (A-J) [3]. According to recent report by UN estimate in 2008 people living with HIV/AIDS is about 33 million 66.7% found in Africa [1]. HIV is an RNA virus from Lentivirus of the Retroviridae family [4] prevalent in Sudan with a figure of 1.6% among adults [5]. The first case reported was in 1986 and since then WHO become partner in the program [6]. Clinical presentation of HIV may usually pass through four phases depending on the status of immunity primary, early, intermediate and advanced HIV infection [7]. The presentation is ranging from reasonable mild to general (fever, urti, myalgia, arthralgia, lymphadenopathy, weight loss). Skin manfestaion, neurological (encephalopathy, headache, neuropathy), gastrointestinal tract manifestation (vomiting, diarrhea pharyngitis, oral ulcers, fungal infection), or&#xA0;respiratory system(like cough, shortness of breathing) [7], where WHO classification of the disease is according to the presentation rather than the immunological status[8]. AIDS cases were reported in other populations including intravenous drug users and hemophiliacs [9]. Blood transfusion recipients, adults from central Africa and infants born to mothers who themselves had AIDS or were intravenous drug users [9]. A virus related to human T-cell leukemia virus (HTLV-1) and (HTLV-2) was in criminated as a causative agent but later on the causative agent of AIDS was characterized and termed Human Immunodefiency virus Type-1 (HIV-1 and HIV-2) [10]. Sudan is a large country with opened boarders, and due to its geographical location, it is surrounded by nine countries some of which have a high incidence of HIV/AIDS. In addition, uncontrolled migrations of refigures across the borders, drought, famine in some areas, civil wars and difficult economic situations, resulted in immigration and displacement of many people whether from local population or from these neighboring countries. HIV is an important public health problem that prevalent at internationally, and nationally, Regional. The incidence of HIV/AIDS is on increase in Sudan and neighboring countries. The area of HIV diagnosis, management and monitoring are very important. Appearance of Resistance to antiretroviral therapy is increasing. Studies in the area of antiretroviral therapy and HIV drugs resistance are very essential. Such studies are very few in Sudan and are very strategic in the managements of HIV/AIDS [11,12]. The strains of HIV-1 can be classified in to three groups the &#x201C;Major&#x201D; group (M), the outlier group (O) and the New group (N). These three groups may represent three separate introductions of simian immunodeficiency virus in to humans; each type is divided in to subtypes and Circulatory Recombinant Forms (CRFs). Group (O) appears to be restricted to west and central Africa and Group (N), discovered in 1998, in Cameron, is extremely rare. More than 90% of HIV-1 infection belong to HIV-1 group (M) and unless specified the rest of this page relate to HIV-1 group (M) only. Within group (M) there are known to be at least nine genetically distinct sub types or (clades) of HIV-1. These are subtypes A, B, C, D, F, G, H, J, and K. Occasionally, two viruses of different sub types can meet in the cell of an infected person and mix together their genetic materials to create a new hybrid virus caprices similar to sexual reproduction and some new strain do not survive for long, but those that infect more than one person are known as circulatory recombinant forms (CRFs) [13]. The CRFs/A/B is a mixture of sub types A &amp;B. The classification of HIV strain into subtypes and CRFs is a complex issue and the definitions are subject to some Subtypes into division of A1, A2, A3, F1 and F2 instead of A &amp; F. Globally speaking, subtype A is the principal HIV-1 subtype found in Central and North African countries, sub type B is predominant in USA, Europe, Australia, Thailand and Brazil; subtype C is prevalent in south Africa, Ethiopia and India; CRFO_AE is common in south Africa. Information on HIV subtypes appears to divers in Iran, were HIV-1 subtypes A&amp;B and has been reported among respectively intravenous by drug users and hemophiliac [14, 15].&#xD;
&#xD;
MATERIALS AND METHODS &#xD;
&#xD;
This cross-sectional study of HIV-1 was held to determine the seropositive patients from different areas of Sudan. Systematic random sampling were done by collecting blood, from South, North, West, East and Central Sudan. Forty samples were collected from 200 investigated patient&#x2019;s attending different clinics and hospitals in every area during two years of study period. The sample was a venous blood, collected in a plain and EDTA vaccutainer containers, from those suspected patient&#x2019;s positive for HIV-1. From those confirmed HIV-1 positive patient, 100 EDTA blood sample were chosen for the purpose of HIV-1 sub typing, the sub typing methodology was determined in Kenya Medical Research Institute (KMRI), Virus Research Center at the HIV Laboratory. Many techniques have been used to define subtypes of HIV-1 in Sudan, these include; serological test by ELISA, CD4 count by FACS, Heteroduplex mobility assay (HMA) and subtype classification by polymerase chain reaction (RT-PCR). After processing the sample for sub typing, the amplified samples were run on an agarose gel 2% with ethiduium bromide for staining, and visualized .under UV light to confirm HIV-1. Amplicon was used to detect the subtype by specific subtype primer. The subtypes that detected by specific subtype for the universal groups M, N, and O; the Unipol5 for forward and Unipol6 for reverse direction (5&#x2019;TGGGTACCAGCACA CAAAGGAATAGGAGGAA A3&#x2019;and5&#x2019;CCACAGCTGATCTCTGGCCTTCTCTGTAATAGA CC- 3&#x2019;). For nesting PCR Universal for groups M, N, and O, the Unipol1 for forward and Unipol2 for reverse direction (5&#x2019;-CCCCTATTCCTTCCCCTTCTTTTAAAA-3&#x2019; and 5&#x2019;-CCCCTATTCCTTCCC CTTCTTTTAAAA-3&#x2019;) [16], were confirmed by Heteroduplex Mobility Assay (HMA). After determining the HIV-1 subtypes, the patient given a dose of antiretroviral drugs which was Triomue (lamivudine, stavudine and Nevirapine) and after three months of treatment CD4 count was estimated.&#xD;
&#xA0;&#xD;
&#xD;
RESULTS &#xD;
&#xD;
Determination of HIV- 1 genotype and subtypes is a key role in facilitating the treatment, trails of vaccination, and confirming the results of diagnosis. The Sudan, according to its geographical location is surrounded by countries with high HIV prevalence.&#xD;
&#xD;
&#xD;
&#xD;
The Geographical distribution of the patients was, as follows: 75 patients from South of Sudan (37.5 % ) 55 patients from the Center (27.5%) 44 patients from the East (22.5%) 22 patient from the West (11.5%) and 4 patients from the North (2.0%)&#xD;
&#xD;
&#xD;
&#xD;
One hundred &#x2013; eighty eight (90,9%) were found to be HIV-1 positive samples ,twelve (9,1 %) were negative (-ve), pro-viral DNA in the DBS was amplified by nested PCR, and a 389-nucleotide segment of the C2-V3 env gene region was sequenced.&#xD;
&#xD;
&#xD;
&#xD;
Blood samples were analyzed on a Partect Automatic Machine to estimate CD&#xAC;4 count (FACS). The EDTA blood samples were divided in to two parts, one for the purpose of CD4 count &amp; the other for subtyping after extraction of provirus from peripheral mononuclear cells (PMNCs).&#xD;
&#xD;
&#xD;
&#xD;
After processing the sample for subtyping, the amplified samples were run on an agarose gel 2% with ethidium bromide for staining, and visualized .under UV light to confirm HIV-1. Amplicon was used to detect the subtype by specific subtype primer.&#xD;
&#xD;
&#xD;
&#xD;
The distribution of HIV-1 subtypes according to the different areas was; in North Sudan subtypes (A) n=1 (1.0%), subtype (C) n=1 (1%). In South Sudan subtype (A) n=15 (15%), subtype (C) n=10 (10%) and n=13 (13%) for subtype (D) .In East Sudan subtype (A) n=8 (8%), subtype (C) n=9 (9%) and subtype (D) n=3 (3%). In West Sudan subtype (A) n=3 (3%) subtype (C) n=7 (7%) and subtype (D) n=2 (2%).In Center Sudan subtype (A) n=19 (19%), subtypes (C) n=6 (6%) and subtype (D) was n=3 (3%).&#xD;
&#xD;
DISCUSSION &#xD;
&#xD;
Two hundred units of seropositive HIV Patients were tested by ELISA as reactive units then by using (RT-PCR) to detect HIV-1. For the patients&#x2019; sex, 186 (84%) were male and 32 (16%) were female which is in agreement with HIV male to female ratio in Yemen that were 4:1 male to female [17,18], 88 (90.9%) were HIV-1 positive. The Geographical distribution of the HIV-1 in Sudan is closely related to the distribution of variants in neighboring countries [19]. Consequently, patients from South of Su-dan before separation were n=75 (37.5 %), from Center Sudan n=55 (27.5%), from East Sudan n=44(22.5%), from West Sudan n=22 (11.5%) and from North Sudan (2.0%). The high prevalence estimated rate of HIV was found in South Sudan, and this was related to the geographical location of being near the high prevalence African countries [20]. However, this finding is disagreed with other authority where type A is the subtype that is common in west Africa but agree with them regarding subgroup (C) and (D) which usually found in central and east Africa(Sudan) [21,22]. However, to have subtype (A) dominant in Sudan is not strange since a good number of western Africa citizens migrate to Sudan throughout the last century to pilgrim. Determination of HIV-1 genotype and subtype is the key tools in determine the treatment, since a lot of gene mutation to the virus are reported [23]. Several techniques have been used to determine subtypes of HIV-1: The serological test by ELISA techniques, the CD4 count by FACS, the Heteroduplex Mobility Assay (HMA) and subtype classification by polymerase chain reaction (RT-PCR).This assist the indication of the high specificity and sensitivity for HIV-1 subtypes. Compared with molecular diagnosis technique (RT-PCR) which was the golden standard (figure 2), the use of serologically defined subtype was mainly confined to subtype B infection among whites, as serotyping has been shown to be of good specificity for differentiating subtype B from non-B infections in populations predominantly infected with B subtype [24]. The result for HIV-1 sub typing were n=46 (46%) subtypes (A), n=33 (33%) subtype (C) and n=21 (21%) subtype (D), (figure 3). However, some studies suggest that the CD4 count is a better predictor of disease progression than is plasma HIV-1 RNA in patients with very low CD4 (counts &gt;50 cells/mm3 ) [25]. The Heteroduplex mobility assay (HMA) and multiregion hybridization assay (MHA) offered more affordable option for simple and rapid classification of HIV-1 subtypes in Sudan. However, due to cross-reactivity across subtypes, this method could not define specific sequence differences between isolates of the same or different HIV-1 subgroup (M). Therefore, the protocol was developed in combination with the (RT-PCR) as following; for subtype (A) by (HMA) and for subtype classification by polymerase chain reaction (PCR). The sequence analyses of envelope genes, using geographically diverse subtype reference sequences as well as envelope sequences of known subtype from Sudanese patients&#x2019; genotyping. Because the RT-PCR genotyping system proved to be highly successful for the amplification of local strains with positive results [26], for the 100 cases a final algorithm of incorporating serology and genotypic subtype HIV-1 subtype was resulted as following; HIV-1 group (M) subtype (A) n=46 (46%), HIV-1 group (M) subtype (C) n=33 (33%) and HIV-1 group (M) subtype (D) n=21 patient (21%). The distribution of HIV-1 subtypes according to the different areas (fig 5) was agreed with local study of detecting HIV-1 subtypes in Sudan which were subtype (C) (30%) and subtype (D) (50%) [21], subtype (C) is similar to our result, but we were disagreed with that in the following that the commonest subtype we were detected was subtype (A). The transmission and distribution of HIV- 1 subtypes is common and recognized as geographical distribution in the Democratic Republic of Congo which is closely related to the distribution of variants in neighboring countries the dominant strains are A, C and D. this would explain the difference in prevalence between the neighbor boarders [27]. In Sudan, subtype D is the most common 20. However, its introduction here might have been from two fronts; from Central Africa and also from Uganda or Kenya where this subtype is prevalent the three subtypes detected, A, C, and D was shared with Kenya, Uganda and Ethiopia, and these countries became the main source of infection to Sudan [26, 27, 28]. Altlas et al [29] stated that; the HIV patients of African origin showed that 77% of them were responded to ARV triple therapy). The distribution of HIV-1 subtypes B9 and E in this study population is in line with several other studies into the molecular epidemiology of HIV-1 in Thailand.&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Lastly we conclude that the detected HIV subtypes in Sudan were subtypes (A) (C) and (D). The high prevalence of HIV-1 infection in neighbor countries affected the citizens of Sudan&#x2019;s Border States with a significant impact of refugees&#x2019; mobility across the country. The study showed that there was a significant association between CD4 count and anti-retroviral therapy (ARV) the commonest subtypes that responding to dray were subtypes that responding to dray were subtype (A) and (D) the tubercles patients in subtype (C) treated with rifampicin were not responding to (ARVs).&#xD;
&#xD;
ACKNOWLEDGMENT&#xD;
&#xD;
Authors would like to acknowledge with gratitude the assistance that they received from the staff of the Central Lab of Omdurman Military Hospital (Sudan), Virology Lab of Faculty of Medicine University of Khartoum (Sudan) and Kenya Medical Research Institute (Kenya). Authors would also like to extend their gratitude to the teaching staff and technicians of Karary University (Sudan). Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
&#xD;
Informed Consent: This work is approved by the ethical committee of Medical Laboratory Science college and under the responsibility of the faculty board members.&#xD;
&#xD;
Source of Funding: This work was partially supported by the National Treasury for Promoting Medical Service (NTPMS) and United Nation AIDS (UNAIDS) in Sudan and self-finance from the authors.&#xD;
&#xD;
Conflict of interest: Since AIDS is a global disaster, the authors had decided to evaluate the disease situation in Sudan by using advanced protocols, techniques and analysis. All the authors who had participated in this work performed high calibrations in their contribution for establishing a biomonitoring system for HIV-1.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=604</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=604</Fulltext></URLs><References>1. UNAIDS, AIDS. Epidemic update: June 2008. UNAIDS: Geneva; 2008. http://www.unaids.org/Epi2008/doc/report_pdf.html&#xD;
&#xD;
2. Charneau P, Borman A, Quillent C, et al. Isolation and envelope sequence of a highly divergent HIV-1 isolate: definition of a new HIV-I group. Virology 1994; (2): 59 247-253.&#xD;
&#xD;
3. Fauci AS, Lane HC. Human immunodeficiency virus disease: AIDS and related disorders. Harrison&#x2019;s Principles of Internal Medicine 16th Edition. New York, McGraw-Hill Medical Publications Division 2005.&#xD;
&#xD;
4. UNGASS HIV/AIDS in Northern Sudan. UNGASS Report January 2008. World Health Organization, WHO report 2014.&#xD;
&#xD;
5. Graeme JS, Irvine SS, Scott M, Kelleher AD, et al. Strategies of care in managing HIV. In Managing HIV. Sydney: Australasian Medical Publishing Company Limited 1997.&#xD;
&#xD;
6. World Health Organization, WHO Case Definitions of HIV for Surveillance and Revised Clinical Staging and Immunological Classification of HIV-related disease in Adults and Children, August 7, 2006.&#xD;
&#xD;
7. UNAIDS. Epidemiological Fact Sheets on HIV/AIDS and Sexually Transmitted Infections: Yemen. Geneva: UNAIDS; 2004a [Accessed 12 May 2006]. Online at: http://data.unaids.org/Publications/FactSheets01/yemen_EN.pdf.&#xD;
&#xD;
8. Louise Lambert, M. Ed., D, HIV and development challenges in Yemen: which grows fastest? Oxford journal. 2007; volume22,issue 1p60-62.&#xD;
&#xD;
9. WHO-UNAIDS Network for HIV isolation and characterization, Hemelaar J, Gouwsb E, Ghysb DP: Global trends in molecular epidemiology of HIV-1 during 2000&#x2013;2007. AIDS 2011; (25): 679&#x2013;689.&#xD;
&#xD;
10. Lihana WR, Ssemwanga D, Abimiku A, Ndimbi A: Update on HIV-1 diversity in Africa: A decade in review. AIDS Rev 2012; 14:83&#x2013;100.&#xD;
&#xD;
11. Philippe D and Charles B. The HIV/AIDS Epidemic in SubSaharan Africa in a Historical Perspective Philippe Denis and Charles Becker (eds) Online edition, October 2006; pp. 35-54.&#xD;
&#xD;
12. Osmanov S, Pattou C, Walker N, et al: WHO-UNAIDS Network for HIV Isolation and Characterization: Estimated global distribution and regional spread of HIV-1 genetic subtypes in the year 2000. J Acquir Immune Defic Syndr 2002; 29:184-190.&#xD;
&#xD;
13. Geretti AM: HIV-1 subtypes: epidemiology and significance for HIV management. Curr Opin Infect Dis 2006; 19(1):1- 7.&#xD;
&#xD;
14. Khamadi S., Ocheing W., Raphael C., et al, HIV Type 1 Subtypes in Circulation in Northern Kenya. AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 21, Number 9, 2005, pp. 810&#x2013;814.&#xD;
&#xD;
15. Bobkov AF, Kazennova EV, Selimova LM et al. &#x201C;Temporal trends in the HIV-1 epidemic in Russia: predominance of subtype A&#x201D;. J. Med. Virol. 2004;74 (2): 191&#x2013;6. doi:10.1002/ jmv.20177. PMID 15332265.&#xD;
&#xD;
16. Goudsmit, Jaap. Viral Sex; The Nature of AIDS. Oxford University Press. New York, New York, 1997. Pg. 51-58. Retrieved May 25, 2008.&#xD;
&#xD;
17. Robertson DL, Hahn BH, Sharp PM. &#x201C;Recombination in AIDS viruses&#x201D;. J. Mol. Evol. 1995,40 (3): 249&#x2013;59. doi:10.1007/ BF00163230. PMID 7723052.&#xD;
&#xD;
18. UNAIDS and Government of South Sudan. Global AIDS response report, 2001; (2): 44- 46.&#xD;
&#xD;
19. U.S. Department of Health and Human Services&#x2019; Guidelines for the Use of Antiretroviral Agents in HIV-1-Infected Adults and Adolescents (available at http://aidsinfo.nih. gov/guidelines).&#xD;
&#xD;
20. Hierholzer M, Graham RR, ElKhidir I, et al. HIV Type 1 Strains from East and West Africa are intermixed in Sudan. AIDS Res Hum Retroviruses. 2002; 18 (15): 1163-6.&#xD;
&#xD;
21. Centers for Disease Control and Prevention. Vital signs: HIV prevention through care and treatment&#x2014;United States. MMWR Morb Mortal Wkly Rep. 2011; 60(47):1618- 1623.Availableat http://www.ncbi.nlm.nih.gov/pubmed/22129997.&#xD;
&#xD;
22. Cozzi Lepri A, Katzenstein TL, Ullum H, et al. The relative prognostic value of plasma HIV RNA levels and CD4 lymphocyte counts in advanced HIV infection. AIDS. 1998;12:1639-43.&#xD;
&#xD;
23. Kim S, Els D, Nancy D et al. A sensitive in-house RT-PCR genotyping system for combined detection of plasma HIV-1 and assessment of drug resistance. Journal of Virological Methods 133. 2006; 137&#x2013;145.&#xD;
&#xD;
24. Vidal N, Mulanga C, EdidiBazepeo S, et al. Distribution of HIV-1 Variants in the Democratic Republic of Congo Suggests Increase of Subtype C in Kinshasa Between 1997 and 2002. J AIDS. 2005; 40 (4): 456-62.&#xD;
&#xD;
25. Gardner EM, McLees MP, Steiner JF, et al. The spectrum of engagement in HIV care and its relevance to test-and-treat strategies for prevention of HIV infection. Clin Infect Dis. 2011;52(6):793-800. Available at http://www.ncbi.nlm. nih.gov/pubmed/21367734.&#xD;
&#xD;
26. Janssens W, Heyndrickx L, Fransen K, et al: Genetic variability of HIV type 1 in Kenya. AIDS Res Hum Retroviruses 1994;10:1577&#xB1;1579.&#xD;
&#xD;
27. Poss M, Gosink J, Thomas E, et al: Phylogenetic evaluation of Kenyan HIV type 1 isolates. AIDS Res Hum Retroviruses 1997;13: 493&#xB1;499.&#xD;
&#xD;
28. Zachar V, Goustin AS, Zacharova V, et al: Genetic polymorphism of envelope V3 region of HIV type 1 subtypes A, C, and D from Nairobi, Kenya. AIDS Res Hum Retroviruses 1996;12:75&#xB1;78.&#xD;
&#xD;
29. Ann A, Fredrik G, Anna Li, et al. Impact of HIV type1 genetic subtype on the outcome of antiretroviral therapy.AIDS research and human retrovirus march 2005;21(3) 227.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>CLINICO-BACTERIOLOGICAL PROFILE AND ANTIBIOTIC SENSITIVITY PATTERN OF NEONATAL SEPTICAEMIA- A PROSPECTIVE OBSERVATIONAL STUDY&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>13</FirstPage><LastPage>20</LastPage><AuthorList><Author>Dipak Madavi</Author><AuthorLanguage>English</AuthorLanguage><Author> Farookh Aziz</Author><AuthorLanguage>English</AuthorLanguage><Author> Gopal Agrawal</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Context: Neonatal septicaemia is most common cause of morbidity and mortality in NICU in developing countries with emergence&#xD;
of antibiotic resistant organisms. For effective management of neonatal septicaemia cases and to formulate antibiotic&#xD;
policy for NICU, blood culture is most important investigation.&#xD;
Aims: This study was carried out to study clinical, microbial profile and antibiotic sensitivity pattern of neonatal septicaemia at&#xD;
our institute.&#xD;
Settings and Design: Present study was a prospective observational study, carried out in the Department of paediatrics, IGGMC Nagpur.&#xD;
Methods &amp; material: 292 neonates admitted with diagnosis of neonatal septicaemia were included in the study. Diagnostic work up included complete hemogram with peripheral blood smear, CRP, blood culture and sensitivity (C/S) and other relevant investigations according to cases.&#xD;
Statistical analysis: Obtained data was analysed and presented. 95 % confidence interval values were also calculated.&#xD;
Results: Out of 292 cases of neonatal septicaemia blood culture was positive in 107(36.64%). Culture positivity in EOS &amp; LOS were 66(34.74%) &amp; 41(40.20%) respectively. In EOS gram negative organisms (83.33%) were common isolates while in LOS gram positive organisms (46.34%) were predominant. Gram positive were sensitive to vancomycin, linezolid while gram negative were sensitive to imipenam, amikacin, piperacillin + tazobactum.&#xD;
Conclusion: Neonatal septicemia is an important cause of morbidity and mortality. This is due to infection by both Gram positive and gram negative bacteria most of which are multi drug resistant especially in the hospital environment. Acinetobacter spp is one of the emerging causes of neonatal sepsis.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Neonatal septicaemia, Early onset septicaemia (EOS), Late onset septicaemia (LOS), Antibiotic sensitivity</Keywords><Fulltext>INTRODUCTION &#xD;
&#xD;
The term neonatal sepsis used broadly in clinical context encompasses the diagnosis of septicaemia, meningitis, pneumonia, arthritis, osteomyelitis and urinary tract infection in newborn. This excludes local infection of newborn such as omphalitis, pyoderma and conjunctivitis. Prompt recognition, appropriate antimicrobial therapy and judicious supportive care are the key determinants of positive outcome in this serious paediatric emergency1 . It is estimated that almost 20% of all neonates develop infection and approximately 1% die of serious systemic infection. Not surprisingly, sepsis is the commonest admitting diagnosis among neonates at referral facilities1 . The detection of microorganisms in patient&#x2019;s blood has a great diagnostic and prognostic significance. Many infections in the neonatal and paediatric age group can only be established on the basis of etiologic agent recovered from blood. In the major 16 hospitals of our country, the incidence of neonatal sepsis was 38 per 1000 live births as per the report of National Neonatal Perinatal database2 . This is in&#xA0;contrast with the reported incidence of 1 to 10 per1000 live births in developed countries1 . Over the last few decades, various studies have been conducted to find out causative organisms &amp; their sensitivity patterns in neonatal septicaemia. The results obtained vary from place to place &amp; from period to period in which the studies were conducted 3,4,5. Hence it is important to study neonatal septicaemia in different hospital settings and geographical areas to pin point the microbial aetiology and determine the antimicrobial susceptibility of the microbial isolates for effective management of the cases. It also helps to develop rational antibiotic policy for the NICU. So the present study was undertaken to know the clinicoetiological profile and antibiotic sensitivity pattern of neonatal septicaemia.&#xD;
&#xD;
MATERIAL &amp; METHODS&#xD;
&#xD;
This prospective observational study was carried out in the neonatal unit of tertiary care teaching hospital in central India during the period of August 2011 to September 2013 after acceptance from institutional ethical committee. Aims of the study were to study the microbial profile of neonatal septicemia at our institute &amp; to study the antimicrobial resistance &amp; sensitivity pattern of bacterial isolates. Both outborn as well as inborn neonates admitted with diagnosis of neonatal septicemia were included in study after informed written parental consent. As per the criteria by Vergnonoet al5 all the neonates were included in the study. Septicemia was classified into Early onset septicemia (EOS) and late onset septicemia (LOS) as per standard guidelines6 . Diagnostic workup included complete hemogram with peripheral blood smear, CRP, blood culture and sensitivity (C/S). Chest X-ray, Urine C/S, cerebrospinal fluid (CSF) analysis and fungal C/S were done wherever necessary. All specimens were collected before starting antibiotics.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
Over the study period, 292 neonates with neonatal septicemia were included in the study. Amongst them, EOS was seen in 190 (65.07%) cases and LOS in 102 (34.93%) cases. Of the total 292 neonatal septicemia cases, 182 (62.33%) were male and 110 (37.67%) were female. Of the total 292 cases, 58.91% were delivered in hospital, 14.38% were delivered at home, Lower segment caesarean section (LSCS) was performed in 21.92% cases and instrumentation was done in 4.79% cases. In the present study, 49 (16.78%) cases have history of maternal fever and mother of 60 (20.55%) cases showed premature rupture of membrane.In present study, most common risk factor observed in neonates in neonatal septicemia was low birth weight (69.18%), followed by prematurity (28.08%). Neonatal resuscitation, lack of breast feeding, superficial skin infection including umbilical sepsis and meconium aspiration were observed in 25.34%, 13.70%, 13.01% and 5.48% neonates respectively. In the present study, most common manifestation observed in neonatal septicemia cases were lethargy (72.60%) and poor sucking (72.60%) while least common were bulging fontanel (8.90%) and convulsions (9.93%). Other manifestations were decreases capillary refill time (21.92%), hypothermia (42.12%) and tachypnea (23.97%). Table 1 shows blood culture positivity in EOS and LOS cases. Amongst total 292 cases of neonatal septicaemia, in 107 (36.64%) cases blood culture was positive, whereas in 185 (63.36%) cases blood culture was negative. Of the total 292 cases of neonatal septicemia, early onset septicemia cases were 190 and late onset septicemia cases were 102. Of the 190 early onset neonatal septicemia cases, blood culture was positive in 66 (34.74%) cases. Similarly, out of 102 late onset neonatal septicemia cases, blood culture was positive in 41 (40.20%) cases. Table 2 shows the microbial isolates from blood culture of neonatal septicemia cases. Table 2 shows that, in the present study, gram negative bacilli were found to be commonest cause of neonatal septicemia (68.22%). Gram positive organisms were found in 28.04% cases. Klebsiella pneumoniae (19.62%), Pseudomonas aeruginosa (16.82%) and Acinetobacter baumannii(15.89%) were the commonest isolates from neonatal septicemia cases. In blood culture positive early onset neonatal septicemia cases (66), gram negative bacilli (83.33%) were common aetiological agents as compared to gram positive cocci (16.67%). Among gram negative bacilli, Klebsiella pneumoniae(31.82%), Acinetobacter baumannii(21.21 %) and Pseudomonas aeruginosa (15.15%) were the common isolates. Among gram positive organisms Enterococcus fecalis(10.61%) was the commonest organism. In blood culture positive late onset neonatal septicemia cases (41), both gram negative bacilli (43.90 %) and gram positive cocci (43.90 %) were isolated in equal number of cases while Candida albicans and Streptomyces spp were isolated in 4 (9.76%) and 1 (2.44%) cases each. S.epidermidis (24.39%) followed by P. aeruginosa (19.51%) formed the common bacterial isolates in LOS. Table 3 shows the antimicrobial sensitivity of enterobacteriaceae isolates from blood culture of neonatal septice-mia cases. It shows that all the enterobacteriaceae isolates (except S. Typhi, where imipenem sensitivity is not advised) are sensitive to imipenem. Except S. Typhi all the isolates were resistant to ampicillin. As many as 93.93% isolates of enterobacteriaceae were sensitive to piperacillin + tazobactam while only 33.33% were sensitive to piperacillin. Among aminoglycosides enterobacteriaceae isolate showed maximum sensitivity to amikacin (60.60%) fallowed by netilmicin (39.39%). All the isolates of Klebsiella pneumonia and Klebsiella aerogens were sensitive to piperacillin + tazobactam and imipenem. Klebsiella isolates in our study showed complete resistance to ampicillin, amoxyclav, 1st and 2nd generation cephalosporins. Among aminoglycosides amikacin showed maximum sensitivity to Klebsiella pneumoniae(47.62%) and Klebsiella aerogens(50%). Among the six isolates of E. coli complete sensitivity was seen with imipenem and amikacin. All the six isolates were resistance to ampicillin. Two isolates each of Citrobacter fruendii and Enterobacter aerogens showed complete resistance to ampicillin, amoxyclav, 1st and 2nd generation cephalosporins, kanamycin and aztreonam. In the present study, two strains of S. Typhi were isolated. Both were sensitive to ampicillin, cefotaxime &amp; ciprofloxacin. Antimicrobial sensitivity of Acinetobacter spp. and Pseudomonas aeruginosa is shown in table 4. It shows that maximum isolates of Acinetobacter baumannii(88.24%), Acinetobacter woffii(100%), and Pseudomonas aeruginosa(88.89%) were sensitive to imipenem. As many as 82.35% strains of Acinetobacter baumannii were sensitive to Piperacillin + tazobactam while 70.59% to ciprofloxacin. Only 25.52% strains were sensitive to ceftazidime, cefotaxime and cefepime. None of the isolate of Acinetobacterl woffii showed sensitivity to ceftazidime, cefotaxime, cefepime, piperacillin, gentamicin and tobramycin. Pseudomonas aeruginosa isolate showed good sensitivity to Piperacillin + tazobactam (66.67%), Ciprofloxacin (66.67%) and Amikacin (61.11%). These isolates showed poor sensitivity to ceftazidime (27.78%), cefotaxime (16.67%) and cefepime (27.78%). Table 5 shows the antimicrobial sensitivity of gram positive cocci isolates from blood culture of neonatal septicemia cases. It shows that gram positive cocci isolates were 100% sensitive to linezolid, vancomycin and pristinomycin. Methicillin resistance was 100% in Staph.aureus and Staph. Hemolyticus while it was 58.33% in Staph. epidermidis. Among the aminoglycosides amikacin showed a maximum sensitivity in Staph. aureus (100%) and Staph. hemolyticus (100%). As many as 8 strains (66.67%) of Staph. Epidermidis were sensitive to amikacin, tobramycin and netilmicin. Table 6 shows mortality of neonate as per positivity of blood culture. Table 6 shows that mortality of neonates in blood culture positive cases was more (46.73%) than the culture negative cases (11.35%). It was found to be statistically significant (p= 0.0000).&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
Neonatal septicemia remains a challenging and important problem even with modern drug therapy. It is associated with considerable morbidity and mortality. It is difficult to diagnose the neonatal infection, because of its non-specific clinical signs and symptoms. Microorganism detection has its value as a strong diagnostic method for neonatal septicemia. For the effective management of neonatal septicemia cases, study of bacteriological profile with their antibiotic sensitivity pattern plays a significant role7 . In present study, maternal pyrexia was seen in 16.78% cases. A similar finding was seen by Soman et al8 (18.6%) and Saxena et al9 (17.34%). In the present study, 20.55% of cases had history of premature rupture of membranes for more than 24 hours. A similar finding was seen in Roy et al10 (28.9%), Hossain et al11 (29.2%) &amp; Kuruvilla et al12 (12.8%). Most important neonatal factor predisposing to infection is prematurity. Preterm infants have a 3-10 fold higher incidence of infection than full term normal weight infants.LBW is a well accepted risk factor for neonatal septicaemia13,14.Khatua et al15 and Mondal et al16 stated that LBW infants have low IgG and they are more susceptible to infections. There is little correlation between clinical manifestations and etiological agents4,17,18,19 . Lethargy (72.6%) was most common manifestation in present study similar to Guha et al20 (66.25%), Mishra et al21 (62.52%) &amp; Gupta et al22 (66.7%). Ahmed et al23 (40%) &amp; Buetow et al24 (31.01%) found lethargy in less number of cases. Poor feeding (71.925) was second most common manifestation in present study, a finding similar to Guha et al20 (66.25%), Mishra et al21 (62.52%). Buetow et al25 (19.62%) found that poor feeding was less common. In the present study, blood culture positivity in neonatal septicemia cases was 107 (36.64%), whereas in 185 (63.36%) of cases there was no growth. Culture positivity for aerobic organisms in neonatal sepsis varies widely (19.20% to 76.8%) among different studies7,26,27,28 . These wide variations might be due to the fact that most of the patients receive the antibiotics before they come to the tertiary care hospital. Further, self medication is&#xA0;very common as the medicines are easily available at the counter29. It can also be explained by technique &amp; volume of blood sample collection, methods used for bacterial isolation or presence of anaerobic infection. The negative cultures were presumed to be due to anaerobic infections or antibiotic usage before collection of samples for culture or clinically overdiagnosing the bacterimias as a prelude to avoid the risk of missing any true bacterimias7 . In the present study, the percentage of gram negative septicemia is 68.22% and that of gram positive is 28.04% (Table 1). Observation made by various workers is given in Table 7. The increased susceptibility of neonates to the gram negative bacteria may be explained by the fact that the antibodies against these organisms are primarily IgM type, which do not transfer passively through placenta and are at very low level in blood (about 5% of adult value) at birth, and reaches the adult level by 2 years of age. This is in contrast with IgG type, which are passively transferred to placenta and are almost at adult level at birth and falls gradually reaching lowest level around 3 to 4 months of age after which they start to rise again gradually. Adequate IgG (except IgG 2-subtype) levels at term, afford protection against several gram positive bacteria30. In the present study (Table 1), it was observed that gram negative organisms causing EOS (83.33%) outnumbered gram positive organisms (16.67%). In contrast in LOS gram positive organisms isolates (46.34%) were more common than gram negative organisms (43.90%). The bacteriological profile differs in EOS and LOS and it also differs in developing and developed countries. In developed countries gram positive organism is predominant in both EOS and LOS but Group B streptococci is found more in EOS. In developing countries gram negative organism are predominant in EOS &amp; LOS both.23 Kaushik et al13 had reported that gram negative bacilli predominated in EOS (62.5%) whereas gram positive organisms accounted for majority of LOS cases (58.33%). Chugh et al3 reported 90.31% gram negative bacilli in EOS and 29% positive organisms in LOS. Stoll et al14 stated that majority of EOS 60.7% were caused by gram negative organisms. Antimicrobial sensitivity showed that all the enterobacteriaceae isolates (except S. Typhi) were sensitive to imipenem. Except S. Typhi all the isolates were resistant to ampicillin. As many as 93.93% isolates of enterobacteriaceae were sensitive to piperacillin + tazobactam while only 33.33% were sensitive to piperacillin. Among aminoglycosides enterobacteriaceae isolate showed maximum sensitivity to amikacin (60.60%) followed by netilmicin (39.39%). Twenty three Klebsiella isolates and two isolates each of Citrobacter fruendii and Enterobacteraerogens showed complete resistance to ampicillin, amoxyclav, 1st and 2nd generation cephalosporins, cephamycin and tetracycline. Two strains of S. Typhi were sensitive to ampicillin, cefotaxime, ciprofloxacin and chloramphenicol. There were 21 isolates of Staphylococcus spp., with 5 S. aureus, 12 S. epidermidis and 4 S. hemolyticus. All the 21 Staphylococcus isolates showed 100% sensitivity for vancomycin, linezolid and pristinomycin. For S. aureus and S. hemolyticus maximum resistance (100%) was seen in penicillin G, cefoxitin and erythromycin. All the 7 strains of Enterococcus fecalis were sensitive to vancomycin, linezolid, pristinomycin whereas all were resistant to penicillin G and erythromycin. One isolate of Streptococcus pneumoniae was found to be 100% sensitive to all the drugs (penicillin G, erythromycin, vancomycin, pristinomycin, linezolid, chloramphenicol and tetracycline) tested. In our study, overall mortality rate was 24.31%. Further the mortality in blood culture positive cases of neonatal septicemia was higher (46.73%) as compared to culture negative cases (11.35%) and this difference was statistically significant (p value=0.0000 df=1 ).&#xD;
&#xD;
CONCLUSIONS&#xD;
&#xD;
Overall Gram negative bacilli were found to be commonest cause of neonatal septicemia. In EOS gram negative while in LOS gram positive organisms predominate. In EOS, Klebsiella pneumoniae, Pseudomonas aeruginosa and Acinetobacter baumannii whereas in LOS Staphylococcus epidermidis and Pseudomonas aeruginosa were found to be common. Acinetobacter spp is one of the emerging cause of neonatal septicaemia because of the high potential of this genus to develop antibiotic resistance, leading to a considerable selective advantage in environments with widespread and heavy use of antibiotic, especially with relation to hospital environment and nosocomial infections. This was evident in the present study with substantial isolation of this organism in cases of neonatal sepsis. The most effective antibiotic for gram negative isolates was imipenem, while the most effective antibiotic for gram positive isolates was vancomycin. Reserve drugs like linezolid and pristinomycin have not yet developed resistance42. Most of the organisms had good sensitivity to amikacin and ciprofloxacin. It is therefore necessary to generate hospital data on antimicrobial sensitivity of common isolates, provide timely sensitivity report and advise them regarding judicious use of antibiotics.&#xD;
&#xD;
ACKNOWLEDGEMENT&#xD;
&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=605</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=605</Fulltext></URLs><References>1. Paul VK and Singh MB. Neonatal sepsis. In: Meharban Singh, editor. Medical emergencies in children. 3rd ed. New Delhi: Sagar publications; 2000. p.117-35.&#xD;
&#xD;
2. Aggarwal R, Sarkar N, Deokari AK and Paul VK. Sepsis in the newborn. Indian J Pediatr 2001; 68: 1143-7.&#xD;
&#xD;
3. Chugh K, Aggarwal BB, Kaul VK and Arya SC. Bacteriological profile of neonatal septicaemia. Indian J Pediatr 1988; 55: 961-5.&#xD;
&#xD;
4. Gotoff SP, Behrman RE. Neonatal septicemia. J Pediatr 1970; 76: 142-53.&#xD;
&#xD;
5. Vergnono S, Sharland M, Kazembe P,Mwansambo and Heath PT. Neonatal sepsis: An international perspective. Arch Dis Child Fetal Neonatal Ed 2005; 90: 220-4&#xD;
&#xD;
. 6. Stoll BJ. Infection of neonatal infant. In: Kliegman RM, Behrman RE, Jenson HB, Stanton BF, eds. Nelson Textbook of Pediatrics: The Fetus and the Neonatal Infant. 18th ed. vol. 1. Philadelphia: WB Saunders Company; 2007:798e809.&#xD;
&#xD;
7. Murty DS &amp; Gyaneshwari M. Blood cultures in paediatric patients: A study of clinical impact. Indian J Med Microbiol 2007; 25; 220-4.&#xD;
&#xD;
8. Soman M, Green B and Daling J. Risk factors for early neonatal sepsis. Am J Epidemiol 1985; 121: 712-9.&#xD;
&#xD;
9. Saxena S, Anand NK, Saini L and Mittal SK. Bacterial infections among home delivered neonates: Clinical picture and bacteriological profile. Indian Pediatr 1980; 17:17-24.&#xD;
&#xD;
10. Roy I, Jain A, Kumar M and Agrawal SK. Bacteriology of neonatal septicemia in a tertiary care hospital of Northen India. Indian J Med Microbiol 2002; 20: 156-9.&#xD;
&#xD;
11. Hossain MM, Afroza S, Shirin M, Chowdhury NA, Saha SK. Bacterial aetiology of neonatal sepsis in a tertiary care hospital in Bangladesh. Bang J Child Health 2004; 28: 81-5.&#xD;
&#xD;
12. Kuruvilla KA, Pillai S, Jesudason M and Jana AK. Bacterial profile of sepsis in a neonatal unit in south India. Indian Pediatrics 1998; 35: 851-8.&#xD;
&#xD;
13. Kaushik SL, Parmar VR, Grover N, Grover PS and Kaushik R. Neonatal sepsis in Hospital born babies. J Commun Dis 1998; 30: 147-52.&#xD;
&#xD;
14. Stoll B J, Hansen N, Fanaroff AA, Wright LL, Carlo WA, Ehrenkranz RA, Lemons JA, Donovan EF, Stark AR, Tyson JE. Late-onset sepsis in very low birth weight neonates: the experience of the NICHD Neonatal Research Network.Pediatrics 2002; 110: 285&#x2013;91.&#xD;
&#xD;
15. Khatua SP, Das AK, Chattergee BD, Khatua S, Ghose B et al. Neonatal septicaemia. Indian J Pediatr 1986; 53: 509-14.&#xD;
&#xD;
16. Mondal GP, Raghvan M, Bhat BV and Srinivasan S. Neonatal septicaemia among inborn and outborn babies in a referral hospital, Indian J of Pediatr 1991; 58: 529-33.&#xD;
&#xD;
17. Bhakoo ON, Agarwal KC, Narang A, Bhattacharya S. Prognosis and treatment of neonatal septicemia a clinicopathological study of 100 cases. Indian Paediatr 1974; 11: 519.&#xD;
&#xD;
18. Tak SK, Bhandari PC. Value of buffy coat examination in early diagnosis of neonatal septicemia. Indian Pediatr 1980; 17: 399.&#xD;
&#xD;
19. Bhakoo ON, Agarwal KC, Mohini Mahajan C, Walia BNS. Septicemia in infant and children- a bacteriological study. Indian Paediatr 1968; 5: 518.&#xD;
&#xD;
20. Guha DK, Jaspal D, Das K, Khatri RL, and Srikumar R. Outcome of neonatal septicemia- A clinical and bacteriological profile. Indian Pediatr 1978; 15: 423-7.&#xD;
&#xD;
21. Mishra JN, Rai MK, Chakraborty S, Prasad S. Study of neonatal septicemia. Indian pediatr 1985; 22: 281-5.&#xD;
&#xD;
22. Gupta P, Murali MV, Faridi MMA, Kaul PB, Ramachandran VG. Clinical profile of Klebsiella septicemia in neonates. Indian J Pediatr 1993; 60: 565-72.&#xD;
&#xD;
23. Ahmed ASMNU, Chowdhury MAKA, Hoque M, Damstadt GL. Clinical &amp; Bacteriological profile of neonatal septicemia in tertiary level pediatric hospital in Bangladesh. Indian Pediatr 2002; 39: 1034-9.&#xD;
&#xD;
24. Erikson M. Neonatal Septicemia. Acta Paeditr Scand 1983; 72: 1-8.&#xD;
&#xD;
25. Buetow YC, Klein SW, Lane RB. Septicemia in premature infants- The characteristics, treatment and prevention of septicemia in premature infants. Am J Dis Child 1965; 110: 29-41.&#xD;
&#xD;
26. Dunham EC. Septicemia in the newborn. Am J Dis Child 1933; 45: 229-53.&#xD;
&#xD;
27. Todd. Septicemia of the newborn- A clinical study of 15 cases. Arch Dis Child 1946; 23: 102.&#xD;
&#xD;
28. Ananthakrishnan S, Gunasekaran D. Etiology and risk factors for early onset neonatal sepsis. IJMM 2009; 27: 279.&#xD;
&#xD;
29. Arora U and Devi P. Bacterial profile of blood stream infections and antibiotic resistance pattern of isolates. JK Sci 2007; 9: 185-90.&#xD;
&#xD;
30. Singh MB. Perinatal infections. In: Care of the newborn. 6th ed. New Delhi: Sagar publications; 2004. p.196-216.&#xD;
&#xD;
31. Smith and Jenison. Perinatal infections and perinatal death. Lancet 1956; 2: 903.&#xD;
&#xD;
32. Silverman and Homan. Sepsis of obscuse origin in newborn. Pediatr 1969; 3: 157.&#xD;
&#xD;
33. Choudhary P, Srivastva G, Agrawal DS, Saini L and Gupta S. Bacteriological study of neonatal infections. Indian Pediatr 1975; 11: 519-28.&#xD;
&#xD;
34. Somu N, Shetty VS, Moses IG, Raju VB. A critical analysis of septicemia in infancy. Indian Pediatr 1976; 13(6): 443-6.&#xD;
&#xD;
35. Singh M. Nosocomial bacterial infection among newborn babies. Indian J Pediatr 1978; 45: 313-7.&#xD;
&#xD;
36. Mathur M, Shah H, Dixit K, Khambadkone S, Chakrapani A. Bacteriological profile of neonatal septicemia cases (for the year 1990-91). J Postgrad Med 1994; 40: 18-20.&#xD;
&#xD;
37. Ghanshyam DK, Ramachandran VG, and Gupta P. Bacteriological analysis of blood culture isolates from neonates in a tertiary care hospital in India. J Health Popul Nutr 2002; 20(4): 343-7.&#xD;
&#xD;
38. Agnihotri N, Kaistha N and Gupta V. Antimicrobial susceptibility of isolates from neonatal septicemia. J Infect Dis 2004; 57: 273-5.&#xD;
&#xD;
39. Movahedian AH, Moniri R and Mosayebi Z. Bacterial culture of Neonatal Sepsis. Iranian J Publ Health 2006; 33: 84-9.&#xD;
&#xD;
40. Bhattacharjee A, Anupurba S, Gaur A and Sen MR. Prevalence of inducible amp C &#x3B2;-lactamase- producing Pseudomonas aeruginosa in a tertiary care hospital in Northen India. IJMM 2008; 26: 89-98.&#xD;
&#xD;
41. Guleria S, Kaushal R, Sharma J. Neonatal septicemia Emergence of coagulase negative Staphylococcus as major etiological agent. pediatric infectious disease 2013, http:// dx.doi.org/10.1016/j.pid.2013.10.003 In Press&#xD;
&#xD;
42. Khaleel M, Wajid M, A Study on Neonatal Septicemia in Blood Culture Isolates and their Antimicrobial Susceptibility Pattern in View of Emerging Drug Resistance. http:// ijhsonline.com 2014; vol 1, issue 3: 52-57.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>VARIATION IN THE BRANCHING PATTERN OF THORACO-ACROMIAL ARTERY&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>21</FirstPage><LastPage>23</LastPage><AuthorList><Author>Jaishree H.</Author><AuthorLanguage>English</AuthorLanguage><Author> Ashwini H.</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>In our present case, we observed a variation in branching pattern of the thoraco-acromial artery which in turn is a branch of second part of axillary artery. Normally the thoraco-acromial artery arises as a single trunk giving rise to four branches. In the present case the thoraco-acromial artery was absent. The clavipectoral trunk and deltoacromial trunk arose directly from axillary artery. The clavipectoral trunk divided into clavicular and pectoral branch whereas the deltoacromial trunk divided into deltoid and acromial branch, the course and termination of branches were normal. The present variation was observed in right axillary artery of a male cadaver during routine dissection of undergraduate students, in Bidar institute of medical sciences, Bidar. There was no variation in the branching pattern of thoraco-acromial artery of second part of left axillary artery. The knowledge of such variation is of important for surgeons while performing cannulation of axillary artery for various procedures and also for orthopaedicians while reducing dislocations of shoulder and correction of fractures of upper end of humerus.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Axillary artery, Thoraco-acromial artery, Subclavian artery</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Axillary artery is the main arterial stem of the upper limb and is a continuation of third part of subclavian artery. It commences at the outer border of first rib and enters the axilla and at the lower border of teres major, nominally becomes brachial artery.1 It is divided into three parts by the pectoralis minor muscle. The first part is proximal, second part is posterior and third part is distal to pectoralis minor. It is conventionally described as giving of six branches. The first part of axillary artery has one branch, the superior thoracic artery. The second part of axillary artery has two branches i.e. thoraco-acromial artery and lateral thoracic artery. The third part of axillary artery has three branches anterior circumflex humeral, posterior circumflex humeral and subscapular artery.2 The thoraco-acromial artery skirts over the upper border of pectoralis minor muscle to pierce the clavipectoral fascia, often separately by its four terminal branches i.e. deltoid, clavicular, acromial and pectoral. These branches radiate away at right angles from each other in the directions indicated by their names.1 The pectoral branch descends between the pectoralis minor and major muscle and supplies both muscles and to the mamma. The acromial branch runs laterally over the coracoid process and under the deltoid supplies the deltoid muscle, it then pierces the muscle and ends on the acromion. The clavicular branch runs upward and medially towards the sternoclavicular joint, supplies the joint and the subclavius. The deltoid (humeral) branch crosses over the pectoralis minor and passes in the deltogroove, between the pectoralis major and deltoid and gives branches to both muscles.2&#xD;
&#xD;
CASE REPORT&#xD;
&#xD;
During routine dissection of undergraduate students in Bidar institute of medical sciences, Bidar. In a male cadaver, we found a variation in the branching pattern of right thoraco-acromial artery, a branch of second part of right axillary artery. In present case the thoraco-acromial artery was absent. At the upper border of pectoralis minor the clavipectoral trunk and deltoacromial trunk arose directly from the axillary artery. The clavipectoral branch divided into clavicular and pectoral branch both the branches supplied the clavicle and pectoralis, where as the deltoacromial branch divided into deltoid and acromial branch and supplied the deltoid muscle and acromian. Normally the thoraco-acromial artery arises as&#xA0;&#xA0;a single trunk give rise to four branches separately. The course and branching pattern of thoraco-acromial artery arising from the second part of left axillary artery was normal. The course and branching pattern of first and third part of right axillary artery was normal.&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
Rajesh astik et al dissected 80 limbs of 40 human adult cadavers and reported that in 3 male cadavers (8.8%) there was bilateral absence of thoraco-acromial artery and origin of its all branches directly from the axillary artery. Bilateral absence of thoraco-acromial artery and absence of its all branches were found in 1 female cadaver (16.7%), unilateral absence of thoraco-acromial artery in 1 male cadaver (2.9%) on the right side. Division of thoraco-acromial trunk into deltoacromial and clavipectoral trunk was found only in male cadavers and the incidence was 7.5% i.e. 3 out of 40 cases.3 Pandey et al in their study described the variations of thoraco-acromial artery by dividing it into 3 groups. In the first group, thoraco-acromial trunk was absent, the deltoacromial trunk and clavipectoral trunk arose directly from the second part of axillary artery. In the second group the thoraco-acromial artery was present and gave 3 branches i.e. deltoid, pectoral and acromial branch whereas the clavicular branch arose directly from second part of axillary artery. In the third group thoraco-acromial artery was absent and all branches of thoraco-acromial artery arose directly from aorta.4 Chitra et al reported absence of thoraco-acromial trunk and all the branches i.e. deltoid, pectoral, acromial and clavicular arose directly from the 2nd part of axillary artery.5 The braches of third part of axillary artery may show great variations i.e. the anterior and posterior circumflex may arise from common trunk or very rarely may arise along with profunda brachii artery.6&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
The thoraco-acromial artery in the present case is absent, the clavipectoral trunk and deltoacromial trunk arose directly arising from the right axillary artery. The knowledge of such vascular variation is important for surgeons while performing axillary lymph node dissection especially during surgeries involving breast, during subclavian artery occlusion creating the bypass between axillary and subclavian artery, while treating the aneurysm of axillary artery, axillary haematoma, and axillary artery after trauma. Sound knowledge of anatomy of axillary artery is important as the branches of axillary artery are used for microvascular graft to replace the damaged arteries.7&#xD;
&#xD;
AKNOWLEDGMENT &#xD;
&#xD;
Authors would like to acknowledge the scholars whose articles are cited and used for references in manuscript. We are also grateful to ijcrr editorial members and reviewers for their suggestion and also for publishing the article.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=606</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=606</Fulltext></URLs><References>1. Chummy S. Sinnatamby. Last&#x2019;s Anatomy, Regional and Applied Anatomy. 12th edition. London: Churchill Livingstone; 2005. p-51.&#xD;
&#xD;
2. Standring S, Gray&#x2019;s Anatomy 40th Edition. New York Churchill Livingstone; 2008. p-815.&#xD;
&#xD;
3. Rajesh Astik, Urvi Dave. Variations in branching pattern of the axillary artery: A study in 40 human cadavers. Journal Vascular Bras.2012; 11 (1):12-17.&#xD;
&#xD;
4. Pande SK, Shukla VK. Anatomical variation in origin and course of the thoraco-acromial trunk and its branches. Nepal Medical College Journal. 2004; 6:88-91.&#xD;
&#xD;
5. P. S. Chitra and V. Anandhi, A unique variation in branching pattern of axillary artery International Journal of Anatomical Variations. 2013;( 6):1-3.&#xD;
&#xD;
6. Bergman R.A, Thomson S.A, Afifi A.K, Saadeh F.A. Compendium of Anatomic variation in Cardio vascular system. Baltimore, Urban and Schwarzenber, 1988. p-72-73.&#xD;
&#xD;
7. Bhat KM, Gowda S, Potu BK, Rao MS. A unique branching pattern of the axillary artery in a South Indian male cadaver. Bratisl Lek Listy. 2008; 109: 587-589.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>ANALYSIS OF VIRAL PROTEIN U VARIANT AT AMINO ACID POSITION 61 AMONG THE HETEROSEXUALLY TRANSMITTED HIV-1 PATIENTS OF MANIPUR&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>24</FirstPage><LastPage>29</LastPage><AuthorList><Author>Adhikarimayum Lakhikumar Sharma</Author><AuthorLanguage>English</AuthorLanguage><Author> Thiyam Ramsing Singh</Author><AuthorLanguage>English</AuthorLanguage><Author> Khuraijam Ranjana Devi</Author><AuthorLanguage>English</AuthorLanguage><Author> Lisam Shanjukumar Singh</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background: Mutation at amino acid position 61 of vpu influences the stability, release and toxicity of the HIV-1. Previously, we have reported that the seryl residue 61 of HIV-1 was mostly conserved among the HIV-1 infected Intravenous Drug Users (IDUs) of Manipur. In this study, we further analyzed the site mutagenesis at seryl residue 61 among the heterosexually transmitted HIV-1 infected individuals of Manipur.&#xD;
Methodology: Heterosexually transmitted HIV-1 infected blood samples from forty eight individuals have been studied by viral amplification and sequencing at vpu gene of HIV-1. Translated amino acid sequences were aligned with reference strain of HIV- 1 for analysis of amino acid variation at position number 61. Phylogenetic tree were also interfered among the studied sample.&#xD;
Results: The results revealed that 91.67% of heterosexually transmitted HIV-1 infected individuals were harboring virus with conserved seryl residue 61 which has viral-enhancement function while only 8.33% harbored mutated virus. Phylogenetic tree of the vpu sequences among the heterosexually transmitted HIV-1 infected individuals of Manipur displayed multiple clusters.&#xD;
Conclusions: Among the heterosexually transmitted HIV-1 infected individuals of Manipur, vpu is highly conserved at amino nacid position 61 with serine (wild-type) which predicts virus to be more virulent. The analysis also indicated that the heterosexually transmitted virus was possibly introduced from multiple sources. The understanding developed on HIV-1 pathogenicity will provide vital information for the policy makers and clinicians for sentinel surveillance of this pandemic and may help the vaccine/ drug developers to design effective anti-HIV-1 therapeutic agents to fight back the deadly AIDS pandemic.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>HIV, Heterosexual, vpu, Manipur, AIDS, India</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
HIV/AIDS is a life-threatening disease and remains a threat to all over the world. In India, HIV/AIDS related case was detected for the first time in the year 1986(1). Four year later, in February 1990, the HIV/AIDS was reported in Manipur, a northeastern state of India, for the first time from a blood sample of an intravenous drug user collected on October 1989(2). Since then, Manipur is one of three epicenters of the HIV/AIDS epidemic in India, and arguably the fastest growing. Initially, the progress of HIV epidemic was relatively slow but over the years the number of HIV infected individuals increased and it is a major public health problem now. Manipur is an important gateway of India to &#x201C;golden triangle&#x201D; of Southeast Asia, the second largest opium producer in the world where illicit drugs are commonly available(3). Easy available of heroin (locally call as &#x201C;number four&#x201D;), an injecting drugs used in Manipur, from the major trafficking route have led to mass uses of these injecting drugs among the youth of this region(4-6). Youths during early 1980&#x2019;s were commonly addicted to injecting drugs, share injecting equipment and exposing themselves of contracting the deadly virus. The HIV-1 infection was once dominated among IDUs in Manipur(7). In sparsely populated, HIV transmission in Manipur was earlier associated with the sharing of HIV infected needles among the Injecting drug users(8). However, the&#xA0;HIV/AIDS epidemic in Manipur has now penetrated into the general population including children through risk behaviors of IDUs. Manipur, a small state with hardly 0.2% of India&#x2019;s population, has contributed the highest HIV prevalence approximately 8% of India&#x2019;s total HIV positive cases(7). According to National AIDS Control Society (NACO) annual report 2013-2014, the epidemiological indices of HIV-1 in this region was estimated to be 1.22% among the adult HIV prevalence and out of 51,583 general clients tested for HIV positive, 1,536 are found to seropositive with HIV-1 (9). The pathogenesis of HIV infection is different from other primate lenti-viruses. It induces immunodeficiency, the pathological hallmark of HIV infection caused by severe depletion of infected as well as uninfected lymphocyte populations. HIV-1 has three main gene gag, pol and env genes along with six accessory gene(10). Vpu gene is one of accessory gene and hallmark features of HIV- 1. Vpu (16-kd, 81-amino acid) is a type I integral membrane protein consisting of a short N-terminal domain, a single transmembrane a-helix domain, two cytosolic &#x3B1;-helices separated by a flexible connector loop, and a short C-terminal tail(11, 12). It has two different biological functions (a) cytoplasmic domain (CTD): degradation of CD4 and (b) transmembrane domain (TMD): enhancement of virion release(13). Moreover, vpu locus is considered as one of the most variable regions in HIV-1 genome. Replacement of serine at position 61 (S61) with alanine was associated with a significant increase in p24 production, confirming that S61 contributes to the viralenhancement function of this particular viral strain(14, 15). Viral releases as well as apoptosis were influenced by mutation at S61 (14, 16). In continuation to our previous mutational study among the IDUs of Manipur(17), the variability of HIV-1 vpu was further investigated among the heterosexually transmitted HIV-1 infected individuals of Manipur.&#xD;
&#xD;
MATERIAL AND METHODS&#xD;
&#xD;
Ethics Statement&#xD;
&#xD;
Written informed consent was obtained from each participant involved in the study. This study was reviewed and approved by Institutional Human Ethical Committee (IHEC), Manipur University (MU) and Regional Institute of Medical Science (RIMS).&#xD;
&#xD;
Study Subjects&#xD;
&#xD;
Forty eight heterosexually transmitted HIV-1-positive individuals from Manipur were recruited for the study. Participants were counseled individually and allowed to sign voluntary the informed consent form before the sample collection. All the samples were collected from Regional Institute of Medical Science (RIMS) where the participants from different district of Manipur have been registered at the Anti-retroviral therapy (ART) Centre. All enrolled patients had previously received antiviral treatments. Two milliliters (2ml) of whole blood drawn from each participant&#x2019;s veins was collected in an EDTA Vacutainer (Becton Dickinson, USA). Blood samples were collected in the year 2012-2013.&#xD;
&#xD;
DNA Extraction&#xD;
&#xD;
Peripheral Blood Mononuclear Cells (PBMCs) were separated from whole blood samples by Ficoll&#x2013;hypaque (GE healthcare, USA) gradient centrifugation method as per manufacturer&#x2019;s instructions. PBMCs were used to extract genomic DNA using QIAamp DNA blood mini kit (Qiagen GmbH, Germany), according to the manufacturers&#x2019; protocol. Genomic DNA was analyzed on 0.8% agarose gel to check the integrity prior to viral gene amplification.&#xD;
&#xD;
Viral Gene Amplification:&#xD;
&#xD;
The complete vpu region of HIV-1 genome was amplified from genomic DNA by nested polymerase chain reaction (PCR) technique using high fidelity Taq polymerase (Invitrogen, USA) with forward primer (MUHIVVF1: 5&#x2019;- AGARGAYAGATGGAACAAGCCCCAG - 3&#x2019;) and reverse primer (MUHIVVR1: 5&#x2019;- GTGTGTAGTTCTGCCAATCAGGGAA- 3&#x2019;) in the first round PCR and forward primer (MUHIVVF2: 5&#x2019;- TGGAAGCATCCRGGAAGTCAGCCT- 3&#x2019;) and reverse primer (MUHIVVR2: 5&#x2019;- GGTACCCCATAATAGACTGTRACCCACAA- 3&#x2019;) in the second round PCR(18). PCR reactions were carried out in 50&#xB5;L final volumes containing 250&#xB5;M dNTPs, 200nM of each primer, 2mM of MgCl2 , 1&#xB5;g genomic DNA and 6U of Taq polymerase. Cycling parameters were one cycle of denaturation at 94o C for 5 minutes and then add 6U of PCR enzyme as a manual hot-start; followed by 10 cycles of: 94o C for 30s, 60o C for 30s, and 68o C for 45s; then 20 cycles of: 94o C for 30s, 55o C for 30s and 68o C for 45s; one final extension at 68o C for 10 minutes. Identical conditions were used for the pre-nested PCR except for cycling extension for 4mins.&#xD;
&#xD;
DNA Purification and Sequencing:&#xD;
&#xD;
The amplified products were electrophoresed onto a 2.0 % agarose gel, stained with ethidium bromide and evaluated under UV light. Desired PCR products were excised and purified for sequencing by using the QIA quick PCR purification kit (Qiagen GmbH, Germany) according to the manufacturer&#x2019;s protocols. Sequencing of PCR products was performed with an ABI PRISM 3730XL DNA Analyzer using Big Dye terminators (Applied Biosystems, Foster City, California, USA).&#xD;
&#xD;
Sequence Comparison and Phylogenetic tree construction: &#xD;
&#xD;
The nucleic acid sequences were analysed using HIV Blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to search similarity of the sequences with previously reported ones. The nucleic acid sequences were translated into amino acid sequences and aligned with reference sequences by the ClustalW method under BioEdit software (BioEdit software version 7. 1.11), followed by manual adjustment. Reference sequences were retrieved from the Los Alamos National Laboratory HIV Sequence Database (http://www.hiv.lanl.gov). Phylogenetic analyses were interfered using the Maximum Likelihood tree and method/model based on the Kimura 2-parameter distance matrix and bootstrap method (1000 replicates) of test phylogeny, using MEGA software (Version 6.0).&#xD;
&#xD;
RESULT &#xD;
&#xD;
Study Population: In this study, 48 heterosexually transmitted HIV-1-positive patients, including 12 males and 36 females from different district of Manipur, were recruited during 2012- 2013. All the males used in study were infected due to multiple sex partners while all the females used in study were either wives of IDUs or female sex workers (FSWs). All the participants had received antiviral treatments. The median age of the participants was 32 years. 35.42% (17/48) were co-infected with hepatitis B/or C (Table 1).&#xD;
&#xD;
Origin and Phylogenetic analysis: &#xD;
&#xD;
According to BLAST similarity search, most of the sequences of vpu regions isolated from heterosexually transmitted HIV-1 infected individuals were found to have the best match with sequences originated from China. The results revealed that 84% (40/48) showed highest similarity score with the HIV-1 variants originated from China, 6% (3/48) were originated from India, 4% (2/48) were originated from Myanmar and 6% (3/48) were originated from other countries Zambia, Kenya (Figure 1). Phylogenetic tree of the vpu sequences among the heterosexually transmitted HIV-1 infected individuals of Manipur displayed multiple clusters (Figure 2). The analysis indicated that the heterosexually transmitted virus was possibly introduced from multiple sources.&#xD;
&#xD;
VPU variants among the heterosexually transmitted HIV&#xD;
&#xD;
Among the heterosexually transmitted HIV-1 infected individuals, 91.67% (44/48) were found to be harboring virus with conserved seryl residue at amino acid position 61 of vpu gene while only 8.33% (4/48) were found to harbor virus with mutation at the amino acid position number 61. Four individuals (Sample ID: MU065, MU077, MU106 and MU116) display amino acid substitutions at position number 61 by isoleucine, asparagine, glutamine and proline respectively (Figure 3 and 4).Moreover, due to the extensive polymorphisms the size of the open reading frame (ORF) of vpu variants was differently displayed. Most of them showed unique transmembrane and cytoplasmic deletions which may have functional implications with respect to various vpu mediated functions.&#xD;
&#xD;
DISCUSSION &#xD;
&#xD;
Manipur which located near China-Myanmar-India border region is an interesting area for illegal drug trafficking from the &#x201C;Golden triangle&#x201D; to other countries/ regions and has very high prevalence of HIV-1 and other viruses (e.g. HCV and HBV)(8, 19). The present study is the continuation of our previous mutational study of vpu to predict the pathogenicity of virus among the HIV- 1 infected population of Manipur(17). The study site shares about 90% of its entire border area with China, Myanmar, Bangladesh, and Bhutan, whereas only about 10% share with mainland India and is one of highest HIV prevalence in the country. The main obstacle to control HIV is due to its ability to accumulate mutations in all its genes in the infected individuals. These mutants are continuously generated and infect new host cells. HIV- 1 encodes a small integral membrane vpu protein and has no homolog HIV-2 virus (less pathogenic)(11, 20). Vpu locus is considered one of the most variable regions in HIV-1 genome and these variations play a major role in controlling viral release as well as apoptosis, both of which are important for HIV-1 pathogenesis. It was previously reported that variation at serine 61 determined the virus pathogenicity by controlling viral release as well as apoptosis. According to published data, seryl residue substitution to alanine at amino acid position 61 in vpu variants showed enhanced intracellular expression and intracellular stability(16). Analysis of vpu sequences among the heterosexually transmitted HIV-1 infected individuals reveal that 91.67% (44/48) harbor virus with highly conserved seryl residue at amino acid position number 61while only 8.33% (4/48) harbors mutated virus with the substitution of serine at amino acid position 61 by isoleucine, asparagine, glutamine and proline. Moreover, our study also suggested that the vpu sequences of HIV found in northeastern region of India were closely similar to HIV- 1 strains of China, mainland India, Myanmar and other countries indicating that heterosexually transmitted virus circulating in Manipur was possibly introduced from multiple sources.&#xD;
&#xD;
CONCLUSION &#xD;
&#xD;
The overall finding of this study reveals that among the heterosexually transmitted HIV-1 infected individuals of Manipur, vpu is highly conserved at amino acid position 61 with serine (wild-type) which has been predicted virus to be more virulent. The understanding developed on HIV-1 pathogenicity will provide vital information for the policy makers and clinicians for sentinel surveillance of this pandemic and may help the vaccine/drug developers to design effective anti-HIV-1 therapeutic agents to fight back the deadly AIDS pandemic. Accession Numbers The GenBank accession numbers are KM359881, KM359886, KM359888, KM359870-KM359872, KM359919-KM359928 and KM359930-KM359960.&#xD;
&#xD;
Ethical: Institutional Human ethical committee (IHEC) (Reference no- Ac/112/EC/RIMS/2005 of 25th July 2010) by Regional Institute of Medical Science (RIMS) and Manipur University (MU) approved this study.&#xD;
&#xD;
Conflict of interest: The authors declare that there are no conflicts of interest. Authors&#x2019;&#xD;
&#xD;
Contributions: ALS carried out the molecular biology work and subsequent analysis; KRD provided the samples; LSS and TRS conceived, designed and supervised the study. All authors have approved the final manuscript.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=607</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=607</Fulltext></URLs><References>1. Simones EA BP, John TJ, Nirmala S, Solomon S , et al. Evidence for HTLV-III infection in prostitutes in Tamil Nadu (India). Indian J Med Res. 1987;85:335-8.&#xD;
&#xD;
2. (MACS) MACS. Annual Report. 2008.&#xD;
&#xD;
3. United Nation Office on Drugs and Crime (UNODC). South East Asia Survey 2013. 2013.&#xD;
&#xD;
4. Eicher AD, Crofts N, Benjamin S, Deutschmann P, Rodger AJ. A certain fate: spread of HIV among young injecting drug users in Manipur, north-east India. AIDS Care. 2000;12(4):497-504.&#xD;
&#xD;
5. Chandrasekaran P, Dallabetta G, Loo V, Rao S, Gayle H, Alexander A. Containing HIV/AIDS in India: the unfinished agenda. Lancet Infect Dis. 2006;6(8):508-21.&#xD;
&#xD;
6. Kermode M, Longleng V, Singh BC, Hocking J, Langkham B, Crofts N. My first time: initiation into injecting drug use in Manipur and Nagaland, north-east India. Harm Reduct J. 2007;4:19.&#xD;
&#xD;
7. About AIDS in Manipur. national informatics centre, porompat 795005, http://imphaleastnicin/aidshomehtm#a.&#xD;
&#xD;
8. Chris Beyrer MHR, Khomdon Lisam, Jei Chen, Wei Lui and Xiao-Fang yu. Overland heroin traficking routes and HIV-1 spread in south and south east asia. AIDS 2000. 1999;14:75-83.&#xD;
&#xD;
9. National AIDS Control Society (NACO) DoACMoHFW, Government of India. Annual Report 2013-2014. 2014.&#xD;
&#xD;
10. Cullen BR, Greene WC. Functions of the auxiliary gene products of the human immunodeficiency virus type 1. Virology. 1990;178(1):1-5.&#xD;
&#xD;
11. Cohen EA, Terwilliger EF, Sodroski JG, Haseltine WA. Identification of a protein encoded by the vpu gene of HIV-1. Nature. 1988;334(6182):532-4.&#xD;
&#xD;
12. Matsuda Z, Chou MJ, Matsuda M, Huang JH, Chen YM, Redfield R, et al. Human immunodeficiency virus type 1 has an additional coding sequence in the central region of the genome. Proc Natl Acad Sci U S A. 1988;85(18):6968- 72.&#xD;
&#xD;
13. Nomaguchi M, Doi N, Fujiwara S, Fujita M, Adachi A. SiteDirected Mutagenesis of HIV-1 vpu Gene Demonstrates Two Clusters of Replication-Defective Mutants with Distinct Ability to Down-Modulate Cell Surface CD4 and Tetherin. Front Microbiol. 2010;1:116.&#xD;
&#xD;
14. Estrabaud E, Le Rouzic E, Lopez-Verges S, Morel M, Belaidouni N, Benarous R, et al. Regulated degradation of the HIV-1 Vpu protein through a betaTrCP-independent pathway limits the release of viral particles. PLoS Pathog. 2007;3(7):e104.&#xD;
&#xD;
15. De Candia C, Espada C, Duette G, Salomon H, Carobene M. Human immunodeficiency virus-1 BF intersubtype recombinant viral protein U second alpha helix plays an important role in viral release and BST-2 degradation. J Gen Virol. 2013;94(Pt 4):758-66.&#xD;
&#xD;
16. Verma S, Ronsard L, Kapoor R, Banerjea AC. Genetic characterization of natural variants of Vpu from HIV-1 infected individuals from Northern India and their impact on virus release and cell death. PLoS One. 2013;8(3):e59283.&#xD;
&#xD;
17. Sharma AL Singh TR, Machathoibi TC, Singh S D, Devi KR and Singh LS. Genetic study of vpu variant among the HIV-1 infected intravenous drug users of Manipur predicts highly pathogenic virus. IIJSR. 2014;vol 1(no.2):106-12.&#xD;
&#xD;
18. Nadai Y, Eyzaguirre LM, Constantine NT, Sill AM, Cleghorn F, Blattner WA, et al. Protocol for nearly full-length sequencing of HIV-1 RNA from plasma. PLoS One. 2008;3(1):e1420.&#xD;
&#xD;
19. Sibnarayan Datta AB, Partha K. chandra, pradip K. Mahapatra, Shekhar Charabarti and Runu Chakravarty.Drug Trafficking Routes and Hepatitis B in Injecting Drug users, Manipur, india. Emerging Infectitious Disease. 2006;12(12):1954-7.&#xD;
&#xD;
20. Strebel K, Klimkait T, Martin MA. A novel gene of HIV-1, vpu, and its 16-kilodalton product. Science. 1988;241(4870):1221-3.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>STUDY ON KNOWLEDGE AND ATTITUDE REGARDING THE OCCUPATIONAL SAFETY IN TERTIARY CARE HOSPITAL&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>30</FirstPage><LastPage>33</LastPage><AuthorList><Author>Meenakshi Khapre</Author><AuthorLanguage>English</AuthorLanguage><Author> Smrutiranjan Naik</Author><AuthorLanguage>English</AuthorLanguage><Author> Abhay Mudey</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: The vision of Occupational health and safety (OHS) is to create better, healthier and more competitive workplaces for sustainable development of health institutions. .Hospitals provides wide range of services due to which health workers are exposed to list of potential hazards. As there are millions of health workforces it is necessary to protect this vulnerable group and promote their health. This study was done to know the awareness and attitude towards the safety programme.&#xD;
Method: Study population includes 3 professions i.e. 10 % of total doctors, nurses and attendants. Data was collected by structured questionnaire and descriptive analysis was done.&#xD;
Result: Doctors were aware that occupational safety as employees, employers and third party welfare while nurses and attendants define it as just employees and employers welfare. 68.5% of attendants, 83.3% of doctors and 94.4% of nurses have favourable attitude towards protective devices. Very few nurses and attendants were aware of infection control committee in the hospital. Less than one third of doctors, 25.9% of nurses and 18.5% of attendants have suffered with injury in the hospital of which 91% have reported it. They believe that mostly the accidents were due to lack of safety equipments or lack of training.&#xD;
Conclusion: Awareness regarding occupational health and safety was poor among the hospital staff.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Occupational safety, Health, Doctors, Nurses, Attendants</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Every person indulge in any type of occupation is exposed to some or other risk which if not taken care off at early stage will further mount to disease. [1] Workplace-related health impairments, injuries and illnesses cause great human suffering and incur high costs, both for those affected and for society as a whole. The vision of Occupational health and safety (OHS) is to create a better, healthier and more competitive workplaces where managers and workers discuss work processes together in a continuous improvement process including all related risks and possible measures for improvements. Optimal occupational safety results from a continuous proactive process of anticipating, identifying, designing, implementing, and evaluating risk-reduction practices. [2] Hospitals plays an integral role in health care for inpatients, nosocomial infection control, evacuation plans for emergencies and natural disaster , and maintenance in the hospital kitchen, also concerned with environment protection through their waste (contaminated) management strategy. As a results the list of potential hazards includes radiation, toxic chemicals, biological, heat, noise, dusts and psychological (stress). Along with health care workers, community also directly or indirectly are at substantial risk of these hazards. Thus Occupational Health and Safety issues relating to the personal safety and protection of its workers are a very important. According to World Health Organisation estimates, there are 59.8 million HCWs worldwide. About two-thirds of them (39.5 million) provide health services; the other one-third (19.8 million) are management and support workers, which includes those working in ancillary Departments such as Laundry, Dietary, Central store and Supply division (CSSD), Laboratory, Mortuary, Ambulance Services and Administrative Departments. [3]. In India as per estimates there were 2.17 million health workforces in 2005. [4] It is very essential to protect this vulnerable group and promote their health by educating&#xA0;employers, employees and the community on occupational health and safety (OHS). The first step to protect health workers and community is to improve their practice at workplace. Hence this study was planned to assess or to study their knowledge and attitude towards occupational safety.&#xD;
&#xD;
METHOD&#xD;
&#xD;
A hospital based cross-sectional Study was conducted in Acharya Vinobha Bhave Rural Hospital (A.V.B.R.H.) a 950 bedded rural tertiary hospital of Datta Meghe Institute of Medical Sciences (DMIMS) during February to April 2014. A list of working staff was procured from health resource department. 10% of total number of doctors, nurses and attendants (at least 1% from each department) working in AVBRH were randomly selected. Data was collected in a predesigned structured questionnaire. Data analysis was done using Spreadsheet.&#xD;
&#xD;
RESULTS &#xD;
&#xD;
Total 151 health personnel (41 doctors, 56 nurses, 54 attendants) were recruited in study. About 80 % of nurses were female while 46 % and 42 % were female doctors and attendants as given in Table 1. Barring Doctors (69%) more than half of nurses and attendants had experience of more than 5 years. (fig1). 80 % and 76 % of doctors and nurses were working in surgical/maternity/ medical/paediatrics ward while attendants were widely distributed in other support department too like laundry, kitchen, administration etc. (Fig 2) 47.6% of doctors understand occupational safety as employees, employers and third parties welfare while other health personnel consider it to be for their and employers safety only. (Fig 3). Proper disposal of waste and protective clothing were only considered as safety measures by most of health personnel. Very few attendants were aware of training, monitoring, reporting of accidents as depicted in Table 2. 68.5% of attendants, 83.3% of doctors and 94.4% of nurses felt that protective clothing is necessary as given in fig 4. It is given in fig 5 that 18.5%, 26 % and 31 % of attendants, nurses and doctors reported injury / infection in hospital and more than 90 % of them reported it to Infection control committee (ICC). Fig 6 depicts, Lack of training and safety equipment to be the main cause of injury according to health personnel. . More than half of nurses and attendants and 26 % of doctors not aware of existence of ICC in hospital (fig7).&#xD;
&#xD;
DISCUSSION &#xD;
&#xD;
The present study was conducted on various categories of hospital staff to know their outlook towards the occupational health and safety measures. The representative from each department of hospital was included in study population. OSH benefits the employee by promoting the improvement of the working environment in order to give greater protection to the health and safety of workers. The employee is benefitted by having the low staff turnover rate, absenteeism and good reputation in society. While the community is benefited by Promoting public health,. Increasing commitment to quality assurance. Most of the staffs consider it to be only limited to employee and employers while very few were aware of third party welfare. All the safety measures are equally important but only half of the health workers (nurse and attendants) perceive proper disposal of waste and protective clothing as safety precaution while other were considered as safety measures by only 5 % - 27 %. Doctors were better aware of safety measures than others. Only 68 % of attendants consider the necessity of protective equipments, though they are most exposed to risk. Almost all of those injured or infected informed the infection control committee and started the prophylaxis or treatment. Trainings of OHS in hospitals are mostly organized for nurses or doctors. Safety equipments are inadequate in quantity. The OHS is not implemented, monitored and supervised properly. More than half of nurses and attendants were unaware of Infection Control Committee. The pre placement and refreshers training is not organized frequently, at definite time. Employers, including the government, are required to provide information for employees to ensure that current legislative requirements are known, and that relevant, up-to-date information is given regarding all identified hazards and their control. [5,6] Staff members need to be aware of policies and procedures for appropriate management of exposures. ICC manual and protocol should be displayed and known to working staff.&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Awareness regarding occupational health and safety is poor among the hospital staff and as a result there is no felt need for proper implementation of OHS and ICC. . Nurses, doctors and attendants feel that by organising safety training as part of orientation on first employment and by using protective clothing we can certainly improve the infection control in the hospital. Recommendations: Pre placement training and refreshers training for all the hospital staffs including the attendants has to be organised at regular interval. The OHS should be properly implemented, monitored and supervised in accordance with relevant national and international laws and regulations to eliminate or minimize the risk at work and their safety and health is protected&#xA0;&#xD;
&#xD;
Source of funding: Nil&#xD;
&#xD;
Conflict of interest: None&#xD;
&#xD;
Acknowledgement: &#xD;
&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. Authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=608</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=608</Fulltext></URLs><References>1. Dunmire T. What is occupational safety and health? OHSAS 18001 Expert Blog, 2007 July 11. Available from: http:// www.ohsas18001expert. com/2007/07/11/what-is-occupational-safety-health/. [Last accessed on 2014 Sep 03]&#xD;
&#xD;
2. National Safety Council. Occupational safety terms and concepts. Available from: http://www.nsc.org/resources/ issues/safetyknow/safety_terms.aspx. [Last accessed on 2014 Sep 14]&#xD;
&#xD;
3. World Health Organisation. The World Health Report 2006, Working Together for Health: Health Workers a Global Profile. Geneva: WHO Press; 2006. p. xvii-xviii. Available from: http://www.who.int/whr/2006/chapter 1/en/index.html. [Last accessed on 2014 Aug 30].&#xD;
&#xD;
4. Rao KD, Bhatnagar A, Berman P. India&#x2019;s health work force: Size, composition and distribution. India Health Beat 2009; 1(3). Available at http://www.hrhindia.org/ assets/ images/HRH% 20Policy%20 Note3.pdf (accessed on 9 February 2014)&#xD;
&#xD;
5. Occupational health and safety risks in the healthcare sector, Luxembourg: Publications Office of the European Union, 2011, pg 17&#xD;
&#xD;
6. Shilla, C.P.N. (1995) The power of information. African Newsletter on Occupational Health and Safety 5, 3.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>COEXISTENCE OF TUBERCULOSIS WITH WARTHIN TUMOR OF SUBMANDIBULAR SALIVARY GLAND: A CASE REPORT&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>34</FirstPage><LastPage>37</LastPage><AuthorList><Author>S. S. Bhosle</Author><AuthorLanguage>English</AuthorLanguage><Author> B. S. Warad</Author><AuthorLanguage>English</AuthorLanguage><Author> Saumya Nair</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>The concomitant occurrence of tuberculosis infection within a Warthin tumor of submandibular salivary gland is extremely rare as only one case has been previously reported to best of our knowledge. Warthin tumor is an exclusive tumor of the parotid gland and involvement of submandibular gland is very rare. Tuberculous infection of the salivary gland is also very rare. We report a case of a 50 yr old male who presented with a gradually increasing swelling of left upper neck. Surgical excision was done. Histopathology revealed warthin tumor with multiple epitheloid granulomas with caseous necrosis and the patient was treated&#xD;
with antituberculous drugs.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Warthin tumor, Tuberculosis, Submandibular gland</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Primary salivary gland tumors account for less than 2% of all neoplasms in human.1 Approximately 10% of all salivary gland tumors are localized in the submandibular gland of which 40% are malignant tumors.2 Warthin&#x2019;s tumor forms 15% of epithelial salivary gland neoplasms and is almost exclusively a tumor of the parotid gland.1 Involvement of submandibular salivary gland is rare. Tuberculosis is the biggest health issue that lies around India. To prevent spread of tuberculosis, it is important to get treatment quickly and to follow it through to completion. Extrapulmonary tuberculosis is not at all uncommon in India and account for approximately 20% of overall active tuberculosis.3 Tuberculous lymphadenitis is the most common extrathoracic form. The cervical lymph nodes, including lymph nodes in and around the salivary glands are the ones most frequently involved.3 Salivary glands appear to be rarely infected.3&#xD;
&#xD;
CASE REPORT&#xD;
&#xD;
A 50-year-old male presented with a gradually increasing left neck swelling (level II) since last 2 months. He gave history of night sweats and weight loss but no history of any pulmonary symptoms. On Local examination there was a swelling in the left submandibular region of size 5 x 3 cm, firm, mobile, non tender. Routine laboratory test and X&#x2013; ray chest findings were normal. The mass was excised and sent for histopathology.&#xD;
&#xD;
Gross: Received a single globular tissue mass measuring 4.5 x 3x 2 cm with a smooth external surface. Cut surface was solid grey white with few cleft like spaces &amp; with no obvious calcification. Tiny areas of caseous necrosis were noted.&#xD;
&#xD;
Microscopy: Revealed a tumor composed of cystic spaces separating the lobules of neoplastic epithelium consisting of double layer of eosinophilic epithelial cells based on a prominent lymphoid stroma, some with germinal centre. At places within the stroma areas of caseous necrosis were noted surrounded by epitheloid cells, multinucleated langhans type giant cells and lymphocytes.&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
In 1929, Aldred Warthin first described Warthin tumor in the American literature, he named this tumor papil&#xA0;lary cystadenoma lymphomatosum, but since then it was also known as adenolymphoma, cystadenolymphoma, and Warthin tumor.4 Warthin tumor is commonly present in the sixth or seventh decade of life and has a definite male predominance.4 Warthins tumor which is exclusively found in parotid gland also has certain other sites of occurrence like lateral neck, palate, upper lip, nasopharynx, submandibular gland, sinuses, lacrimal gland.5 Some think that this tumor develops from the epithelial cell rests within the intraparotid lymph nodes on heterotopic salivary gland.6 while some consider that it is an adenoma with lymphocytic infiltration.7 Recent molecular studies have shown that the epithelial component is polyclonal and does not exhibit clonal allelic losses, suggesting that this tumor is not a true neoplasm.8 Warthin tumor has an epithelial component and a lymphoid stroma. The epithelial cells, the oncocytes, are disposed on two layers, a luminal layer of oncocytic columnar cells, supported by a layer of oncocytic basal cells. The nuclei of the luminal cells appear uniform and display palisading towards the free surface. The basal cells posses small, centrally located, round to oval nuclei with conspicuous nucleoli.4 The oncocytes cytoplasm is granular and eosinophilic due to accumulation of mitochondria. The lumen of the cysts contains thick proteinaceous secretions, cellular debris, cholesterol crystals, and sometimes-laminated bodies that resemble corpora amylacea.4 The cellular composition of the stroma is largely that of small lymphocytes with only few medium to large lymphocytes. The ratio of B &amp; T cells is 0.8:1.9 Von Stubenrauch in 1894 first described tuberculosis of salivary gland.10 More than 50% of extrapulmonary tuberculosis cases occur with no pulmonary disease.11 There is increased incidence of isolated head and neck tuberculosis. Salivary glands are relatively immune to tuberculosis because of thiocynates ions and proteolytic enzymes like lysozymes, which impart antibacterial property.1 Continuous flow of saliva which prevents lodging and growth of mycobacteria is also an important inhibitory factor.12 In majority of the cases of tuberculosis involving the salivary glands, the parotid is the commonest gland to be affected.13 Involvement of salivary gland is by first, a focus of mycobacterial infection in the oral cavity that liberates the mycobacterium which ascend into the salivary gland via its duct or pass to its associated lymph nodes via lymphatic drainage. The second pathway involves hematogeneous or lymphatic spread from a distant primary lung focus.3 Primary tuberculosis of salivary gland may occur in two forms as an acute inflammatory lesion (mimicking acute suppurative sialadinitis) or as a chronic mass (tumor) lesion that may be asymptomatic for many years. 13 The typical histology of tuberculosis presents as granulomas with caseous necrosis, epitheloid cells and Langerhans cells. Due to low concentrations of organisms in the tissue, acid-fast bacillus may not be demonstrable.11 In 1959, the first case of tuberculosis associated with Warthin tumor was reported.11 The tumor presents as a slow growing nodular, painless mass, firm or fluctuant at palpation.4 Coexistence of warthins tumor with tuberculosis has been reported but mostly of the parotid gland as in Sieferts14 series and in Sugouls15 series one case each. Wen &amp; Chen16 have reported a single case of tuberculosis with Warthin tumor in parotid gland in an 81 yr old male. Watanabe17 has reported two cases of tuberculosis with warthin tumor one in parotid gland in a 75yr old female and other in submandibular gland in a 78 yr old male. Ozcan18 has reported one case of tuberculosis coexistent with warthin tumor of parotid gland in a 53 yr old male. Ulusan M11 et al has reported a case in a 41 yr old male. The majority of cases of coexistence of tuberculosis with warthin tumor have been reported in parotid gland and only one case of submandibular gland involvement has been reported by Watanabe et al.&#xD;
&#xD;
CONCLUSION &#xD;
&#xD;
Warthin tumor considered to be exclusively involving parotid gland should be considered in the differential diagnosis of submandibular gland tumors and a coexistent disease in a tumor must be kept in mind during histopathological examination, especially in a developing country like India where the incidence of tuberculosis is very high. It is important to give treatment for tuberculosis quickly and to follow it through.&#xD;
&#xD;
ACKNOWLEDGEMENT&#xD;
&#xD;
Authors acknowledge immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to the authors/ editors/ publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
&#xD;
SOURCE OF FUNDING &#xD;
&#xD;
As this study was carried out in the histopathology section of our Department, there was no separate financial aid provided for it.&#xD;
&#xD;
CONFLICT OF INTEREST&#xD;
&#xD;
There are no conflict of interests.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Figure 2: Microscopy showing warthin tumor and granuloma with central caseous necrosis.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=609</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=609</Fulltext></URLs><References>1. Maheshwari V, Jain A, Varshney M, Alam K, Gaur K, Sharma SC. Warthin&#x2019;s tumour with coexistent tuberculosis. BMJ Case Reports. 2011;10.1136/bcr.09.2010.3349.&#xD;
&#xD;
2. Adeyemo WL, Ajayi OF, Anunobi CC, Ogunlewe MO, ALLadeinde, Omitola OG et al. Tumours of the Submandibular Salivary Gland: a Clinicopathologic Review of Cases over a 17-year period. West Indian Med J. 2009; 58 (4): 388.&#xD;
&#xD;
3. Birkent H, Karahatay S, Akcam T, Durmaz A , Ongoru O. Primary parotid tuberculosis mimicking parotid neoplasm: a case report.Journal of Medical Case Reports.2008;2: 62.&#xD;
&#xD;
4. Faur A, Lazar E, Cornianu M, Dema A, Vidita CG, Galu?can A. Warthin tumor : a curious entity &#x2013; case reports and review of literature. Romanian Journal of Morphology and Embryology. 2009; 50(2):269-73&#xD;
&#xD;
. 5. Sudarshan, Vivek G K, Ghosh A, Bhattacharya D. Extraparotid warthin tumor &#x2013; A diagnostic dilemma.J Indian Acad Oral Med Radiol 2013; 25(1):51-54.&#xD;
&#xD;
6. Chapnik J. S. The controversy of Warthin&#x2019;s tumor.Laryngoscope. 1983; 93(6):695-716.&#xD;
&#xD;
7. Kotwall C, Smoking as an etiologic factor in the development of Warthin&#x2019;s tumor of the parotid gland. Am J Surg. 1992; 164(6):646-47.&#xD;
&#xD;
8. Arida M, Barnes EL, Hunt JL, Molecular assessment of allelic loss in Warthin tumors. Mod Pathol. 2005; 18(7):964- 68.&#xD;
&#xD;
9. Chin KW, Billings KR, Ishiyamma A, Wang MB, Wackym PA. Characterization of lymphocyte subpopulations in Warthins tumor. Laryngoscope. 1995;105: 928&#x2013;33.&#xD;
&#xD;
10. Al Bisher H. A rare case of primary tuberculosis infection with concurrent pleomorphic adenoma of the parotid gland. Infectious Disease Reports 2010; 2e6:14-15&#xD;
&#xD;
11. Ulusan M, Abul Y, Bak?r S. Mycobacterium Tuberculosis Infection within a Warthin Tumor: A Case Report and Literature Review.N Am J Med Sci.2013 oct;5(10):617-19&#xD;
&#xD;
12. Shilpa S. Patankar &amp; Shubha S. Chandorkar &amp; Amit Garg. Parotid Gland Tuberculosis: A Case Report. Indian J Surg.2012 Mar-Apr;74 (2):179-180.&#xD;
&#xD;
13. Tauro LF, George C, Kamath A, Swethadri GK, Gatty R. Primary Tuberculosis of Submandibular Salivary Gland. 2011(3):1;82-85.&#xD;
&#xD;
14. Seifert G, Bull HG, Donath K. Histologic subclassification of the cystadenolymphoma of the parotid gland. Analysis of 275 cases. Virchows Arch A Pathol Anat Histol. 1980; 388 : 13-38.&#xD;
&#xD;
15. Suoglu Y, Erdamar B, Colhan I, Katircioglu OS, Cevikbas U. Tuberculosis of the parotid gland. J Laryngol Otol. 1998 ;112: 588-91.&#xD;
&#xD;
16. Wen YH, Chen PR, Wu HP. Case report tuberculosis infection within a Warthin&#x2019;s tumor of the parotid gland. Tzu Chi Med J 2008; 20:4.&#xD;
&#xD;
17. Watanabe M, Nakayama T, Koduka Y, et al. Mycobacterium tuberculosis infection within Warthin&#x2019;s tumor: report of two cases. Pathol Int. 2001; 51:797-801.&#xD;
&#xD;
18. Ozcan C, Apa DD, Aslan G, et al.Mycobacterium tuberculosis infection within parotid gland Warthin tumor. J Craniofac Surg 2008;19:1561-65.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>HEALTH PROBLEMS OF ELDERLY: A CHALLENGE FOR CARE&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>38</FirstPage><LastPage>42</LastPage><AuthorList><Author>Solanki S. L.</Author><AuthorLanguage>English</AuthorLanguage><Author> Singhal G.</Author><AuthorLanguage>English</AuthorLanguage><Author> Mishra N.</Author><AuthorLanguage>English</AuthorLanguage><Author> Meharda B.</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background: Ageing is a natural process and in recent years, the ageing of population is on increase world over. Ageing brings about a number of physiological changes, leading to serious public health problems. Although the health care services are advanced and improved but still the burden of disease of elderly is increasing with a challenge for health care on family and nation.&#xD;
Objective: Good health is a pre requisite to good quality of life. Considering this fact, this study was planned to assess the health problems of elderly people for care and prevention.&#xD;
Material and Method: This cross sectional study was designed, to study 300 elderly people of age 60 years and above from the urban health training centre of department of community medicine, GMCH, Udaipur.&#xD;
Results: Majority of the elderly subjects were observed to be illiterate, married, with defective vision and certain addiction habits. Most of the elderly were observed with non-communicable and communicable diseases, involving almost all body systems. Among the elderly (13.67%) of the subjects needed physical assistance for carrying out their daily living activity.&#xD;
Conclusion: Most of elderly people are observed with poor health status affected by multiple social and medical problems. Elderly people are more likely to have ocular, musculoskeletal, hypertension, hearing problems, insomnia, dental problems, diabetes and other diseases. The prevalence of chronic diseases in elderly people could be cared by strengthening geriatric health services for control and health promotion.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Chronic illnesses, Health problems, Urban health training centre</Keywords><Fulltext>INTRODUCTION &#xD;
&#xD;
The term greying and ageing of nations with demographic transition of pyramid to pillar is a concern voice all over the world. Old age is, an incurable disease, you do not heal old age, you protect it, you promote it and you extend it. The word geriatrics is derived from Greek word gerus and iatrea which means old age and its treatment respectively. Geriatrics or geriatric medicine is now a well-recognized medical discipline in developed countries and also in developing country India. In the year 2002, there were an estimated 605 million old persons in the world of which 400 million are living in low income countries. By 2025, the number of elderly people is expected to rise more than 1.2 billion with about 840 million of these will be in low income countries (1). Demographic transition in India has changed the population structure due to all round socio-economic development. The life expectancy has increased to 64 years (2003) from 37 years (1951). Thus we have added 27 years of longevity of life. The population of 60 years and above which was 7.4% in year 2001 will rise to 9.0% by the year 2016. In India, although the percentage of aged to the total population is low in comparison to the developed countries, but still never the less the absolute size of the aged population is considerable (2). A few hospital based studies have been made in India on the health status of aged persons, but such studies provided only a partial view of the spectrum of social and medical illnesses in the aged. The overall data on aged are scarce.&#xD;
&#xD;
NEED FOR THE STUDY&#xD;
&#xD;
For older individuals, many factors that contribute to decrements of ageing and further the burden of illnesses, along with inability to perform their daily activity are potentially responsible to focus on the secondary and tertiary level preventive interventions (3).&#xD;
&#xD;
The present study was planned to understand the health problems of elderly with following Objectives:&#xD;
&#xD;
1. To study the demographic profile of elderly.&#xD;
&#xD;
2. To study the medical and social problem of elderly.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
The present cross sectional community based study was conducted on 300 elderly above 60 years of age, residing in urban field practice area Fatehpura, department of community medicine, GMCH, Udaipur. After randomly identifying the first house from the selected area, every 5th house by systematic sampling method, was visited to include all the elderly subjects, residing in those selected houses till the required sample is covered. The information regarding demographic profile, medical and social problems of the selected subjects was gathered in a pretested, pre-designed questionnaire. The study was conducted during period of 2014.&#xD;
&#xD;
RESULT&#xD;
&#xD;
Major fraction of the population of study subjects were observed in age group 60-69 years, while a small proportion was in 80 years and above. Out of 300 study subjects, (58.66%) were males and rest (41.34%) females. The subjects belonged to joint family (78.67%) while (21.33%) resided in nuclear family. The marital status shows that the majority (55.33%) were married. Widow/ widowers contributed to (43.0%). Maximum (39.33%) of the subjects were illiterate against (20.0%) of literate. Graduate/ postgraduate contributed (14.0%).&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
Population ageing, in varied ramification has acquired importance as a social concern, affecting the most aspects of our life-economy, labour force, health care, social welfare and medical institution to mention a few. The gerontological research is being devoted to give attention on health status of elderly, especially to those at very advanced age. The variation in health status and well-being among elderly, the trends of public health problems among them may give clues about the likely hood of better health. In our study, out of the three age categories, the majority (75.67%) of the subjects were observed in age group 60-69 years, while a small fraction (3.0%) were 80 years and above, similar findings were observed by (4) (5) (72.4%), and (72.3%) respectively, however (40.7%) were observed by (6) among 60-69 years which is not similar to our findings. A study done by (5) shows (2.8%) above 80 years, match to our study. According to distribution of gender the study done by (7) (8) observed (62.10%) male, (37.90%) female and (55.94%) male, (44.06%) female respectively, similar to our study. A joint family system was seen to be the most common (78.67%), among the population interviewed, similar finding were observed by (8) (75.74%). A majority of respondents were married and (43.0%) were widow/widower, similar findings were observed by (4) (5) (47.4%) married (43.8%) widower and (47.4%) married and (43.66%) widower respectively. In our study (39.33%) were illiterate, similar findings were observed by (4) (5) (6) (45.0%), (41.1%) and (38.6%) respectively. In our study most of the subjects did not have any addiction (60.33%). Among addiction majority of the subjects (21.33%) were found to be addicted to smoking and (6.0%) were alcoholic. Similar findings were observed by (8) (21.75%) and (10.45%) respectively. In our study (61.0%) of the subjects were having defective vision and all the subjects above 80 years had defective vision. Similar findings were observed by(8)(4) (62.0%) and (61.5%) respectively. As age increases, the ability to perform daily living activity decreases consistently and considerably. (86.33%) of the respondent were doing all the activities on their own. Similar finding were reported by (6) (75.3%). In our study it was found that only (17.7%) were not having any disease at the time of survey, otherwise nearly all respondents had health problems. The most common being joint pain (60.0%), hypertension was the&#xA0;second common symptom comprising (25.0%). Other common presenting symptoms were hearing problem (21.33%), insomnia (15.33%) and diabetes (12.33%). In a study done by(10) (4) joint pain (60.2%) and (63.4%) respectively were common to our study. A study done by (9) hypertension (21.6%), hearing impairment (24.8%), diabetes (13.92%) and skin disease (3.52%) were similar to our study. Compare to our study results, higher hypertension was found amongst study conducted by(10) (54.2%). (12.33%) subjects were diabetes, study done by(5) (10) observed (10.3%) and (14.9%) respectively, this is comparable with present study. (2.33%) respondents were suffering from tuberculosis, similar findings were observed by (8) (2.0%). (2.67%) urinary problems were observed in our study which is quite similar to study done by(10) (4.0%), whereas(4) observed (9.0%). (21.33%) hearing problem was observed, similar finding were observed by (9) (24.8%), but it is not similar to the study of (8) who, reported (58.0%). In our study (6.33%) heart problems were observed, similar findings were observed by (4) (7.0%). Asthma respondents were (3.0%), which is similar to the study of (6) (1.7%), but not similar to the study of (4) (5) (10.3%) and (10.7%) respectively. The reason for so much difference may be due to weather conditions are different, or allergy.&#xD;
&#xD;
CONCLUSION &#xD;
&#xD;
With the findings of this study it can be concluded that the number and type of variables, and their extent of influence on the health status of the elderly vary. The study highlighted that the elderly were affected with medical and social problems. A greater proportion of them reported having non communicable and minor communicable diseases. Measures should be initiated at appropriate time for geriatric health care and social support for ameliorating the conditions of aged with formulation of appropriate social and medical policy for promotion of health of elderly along with efforts for social mobilisation.&#xD;
&#xD;
ACKNOWLEDGEMENT&#xD;
&#xD;
The authors of this article acknowledge the help and assistance received from editors, scholars, publishers, Journals and books, from where the text and references have been reviewed and discuss.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=610</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=610</Fulltext></URLs><References>1. Elder Care- Health action, 2004; 17(2).&#xD;
&#xD;
2. WHO (2005), Healthy ageing, practical pointers on keeping well, WHO, Western Pacific Region.&#xD;
&#xD;
3. Govt. of India, WHO (2003), Student&#x2019;s handbook for IMNCI.&#xD;
&#xD;
4. Balamurugan J, Ramathirtham G. Health problems of aged people, IJRSS, 2012 ; 2(3): 139-150.&#xD;
&#xD;
5. Lena A, Ashok K, Padma M, Kamth V Kamth A. Health and social problems of the elderly. Indian Journal of Community Medicine 2009; 34(2): 131-134.&#xD;
&#xD;
6. Manikanta P. - A Study on the health status of the tribal elderly of Andhra Pradesh, IJR, 2013; Vol. 2, issue 10 : 188- 90.&#xD;
&#xD;
7. Surekha Kishore, Ruchi Juyal, Jayanti Semwal, Ramesh Chandra. Morbidity profile of elderly persons. J K Science 2007; 9(2): 87-89.&#xD;
&#xD;
8. Mohammed Ubaidula, Inamdar IF Asar NR Doibale MK. Medical and psychosocial profile of geriatric population IOSR-JDMS 2014; 13(3): 29-33.&#xD;
&#xD;
9. Jadhav VS, Mundada VD, Gaikwad AV Doibale MK, Kulkani AP. IOSR Journal of Pharmacy 2012; 2(2): 184-88.&#xD;
&#xD;
10. Kavita Banker, Bipin Prajapati, Geeta Kedia. Study of health profile of residents of geriatric home in Ahmedabad District. National Journal of Community Medicine 2011; 2(3): 378-82.&#xD;
&#xD;
11. Vinod Mundada, Vijay Jadhav, AV Gaikwad. Study of addiction problems and morbidity among geriatric population. Journal of Mid Life Health 2013; 4(3): 172-175.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>MORPHOLOGY OF MENISCI OF KNEE JOINT IN ADULT CADAVERS OF NORTH KARNATAKA&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>43</FirstPage><LastPage>47</LastPage><AuthorList><Author>Veeresh Itagi</Author><AuthorLanguage>English</AuthorLanguage><Author> V. S. Shirol</Author><AuthorLanguage>English</AuthorLanguage><Author> Jayasudha K.</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: The menisci are crescentic, intracapsular, fibrocartilaginous laminae deepening the articulation of the tibial surfaces that receive the femoral condyles forming the knee joint.&#xD;
Objective: To assess the incidence of different shapes of the lateral and medial meniscus in north Karnataka population and discuss its clinical implications.&#xD;
Methods: The cross sectional study included 120 menisci from 60 adult cadaveric knee joints which were preserved in 10% formalin. The morphological variants of the shapes of menisci were macroscopically noted and classified after methodical dissection procedure. The lateral menisci (LM) and medial menisci (MM) were classified as discoid and nondiscoid menisci. Further, the discoid menisci were divided into subgroups as the complete and incomplete discoid menisci. The nondiscoid menisci were subgrouped as crescentic (semilunar) shaped, C shaped, sickle shaped, sided U shaped and sided V shaped.&#xD;
Results and Conclusion: From our observations, 96.66% of medial menisci were cresentic in shape, 1.66% showed sided V shaped and 1.66% showed sickle shape. Among the lateral menisci 88.33% were C shaped, 6.66% sided U shaped and 5% showed incomplete discoid. This study is useful for the health professionals who work with the treatment of meniscal injuries to create an awareness of the anatomical variations that may exist in the menisci facilitating the rehabilitation process.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Discoid, Knee, Lateral meniscus, Medial meniscus, Shape</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Menisci are semicircular shaped fibrocartilagenous structures with bony attachments at the anterior and posterior aspects of tibial plateau and are wedged between the femoral condyles and the tibial plateau on the medial and lateral sides of the knee.1 The knee joint is considered the largest articulation in the body. It is a double condyloid joint with 20&#xB0; of freedom of motion. The condyles of the femur rest in unequal manner on the shallow concave surface of the tibia, therefore the knee joint depends on other structures to provide both static and dynamic stability which are achieved by a variety of soft tissue structures such as the medial and lateral collateral ligaments, anterior and posterior cruciate ligaments, the menisci, the capsule and the muscles crossing the joint.2, 3 The functions of the meniscus include load transmission, shock absorption, stress reduction, improve joint stability, limit to extreme flexion and extension, proprioception, joint lubrication and nutrition.4 With the advent of new techniques such as arthroscopy, computed tomography and magnetic resonance imaging, the anatomical abnormalities and variations of the intraarticular structures of the knee joint have become important.5 Long term complications of removal of a meniscus include cartilage degeneration and bone remodeling, this discovery changed considerably the therapeutic approach to this common work or sports injury.6 Hence, today a ruptured meniscus is repaired rather than removed, but this treatment is only feasible when the meniscus tissue is otherwise of good quality.7 Hence this study was undertaken with the objective to estimate the incidence of different shapes of the medial and lateral meniscus and discuss its clinical implications in the north Karnataka population.&#xD;
&#xD;
MATERIAL AND METHODS &#xD;
&#xD;
For this study, 120 menisci from 60 human knees, 29 right and 31 left, previously dissected and preserved with&#xA0;a solution of 10% formalin were used. Since the knee joints were removed from the cadavers thus presenting an isolated knee joint, it was not possible to determine whether the knees were from the same or different cadavers nor to determine other aspects related to weight, sex and height, even though these factors may influence certain anatomical variations. All cadaveric limbs available in the Department of Anatomy of J. N. Medical College during the study period were included in the study. Cadaveric lower limbs with abnormal knee joints such as deformity, exostosis, fractures or traumatic injury and all menisci that showed any structural change which prevent its morphological assessment such as injuries or advanced degenerative changes were excluded. After the dissection of skin and muscles, the approach to the menisci was performed. The joint cavity was opened, anteriorly by a longitudinal incision on each side of the joint capsule and cutting the patellar ligament and the collateral ligaments transversely. In order to expose the menisci clearly, the joint capsule and the intraarticular ligaments were cut, and the condyles were circumferentially detached from their soft tissue attachments and removed, exposing the tibial plateau. The anterior intermeniscal ligament, if present, was then identified, either within or overhung by the retropatellar fat pad. 8 All dissections were performed in a systematic fashion and data were recorded on a standardized collection sheet.9, 10 To minimize the error two observations were made by two authors. Morphological variants of the shapes of the menisci were macroscopically noted and classified. The lateral menisci (LM) and medial menisci (MM) were classified as discoid and nondiscoid menisci. Further, the discoid menisci were divided into subgroups as the complete and incomplete discoid menisci. The nondiscoid menisci were subgrouped as crescentic (semilunar) shaped, C shaped, sickle shaped, sided U shaped and sided V shaped. When the meniscus covers the tibial plateau circularly, the meniscus is said to be discoid type. 11 The incomplete discoid menisci had an opened area at the centre of the menisci and they were all horse shoe shaped.9 The menisci which did not have any opened area at the centre of the menisci were defined as the complete discoid menisci. The menisci, which had thin anterior and posterior horns and a thin body, were defined as the crescentic (semilunar) type. The menisci, which had thick anterior and posterior horns and a thick body, were named as the thick horse shoe shaped type. The menisci, which had thin anterior and posterior horns and a thick body, were defined as the sickle shaped type. The menisci which resembled like sided U, sided V and C were named as sided U, sided V and C shaped, respectively. 12&#xD;
&#xD;
RESULTS&#xD;
&#xD;
Study was done on 60 knee joints. In which 29 (48%) belonged to right knee joint and 31 (52%) were of left knee joint. In our study six morphological types of the shape of menisci were determined (Table 1). It was observed that 96.66% of medial menisci were cresentic shaped, 1.66% showed sided V shaped and 1.66% showed sickle shape. Among the lateral menisci 88.33% were C shaped, 6.66% sided U shaped and 5% showed incomplete discoid (Fig. 1).&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
The differences of the shape of meniscus may be due to the mesenchymal differentiation or to the development of the vasculature early in embryonic life.9 The meniscus arises from the differentiation of mesenchymal tissue within the limb bud and becomes a clearly defined structure by the eighth week of fetal development.13Variations of morphological differences of menisci can determine the possibility of an injury. However, the data related to the morphometric parameters of these structures are scarce.14 There are marked differences in the contour and insertion between the lateral and the medial menisci which are important in relation to the injury mechanisms.15 Study on 22 fetal knee joints, reported that 73% of the cadavers they studied had the same shape of meniscus on each side. According to their observations, medial menisci showed 18.18% (crescent-shaped), 22.72% (sided V-shaped), 9.09% (sided U-shaped), 36.36% (sickleshaped) and 13.63% (C- shaped). Discoid medial meniscus was not observed. In the same study, 13.63% of the LMs were crescent-shaped, 9.09% (C-shaped) and 77.27% (discoid-shaped). Among the discoid shaped 54.54% of the LMs were incomplete discoid and 22.72% were completely discoid.9 Normal variants of the meniscus are relatively uncommon and are frequently asymptomatic, although there is a greater propensity for discoid menisci to tear. However, recognizing these variants is important, as they can be misinterpreted for more significant pathology on MRI. The most common of these meniscal variants is the discoid lateral meniscus and the least common is complete congenital absence of the menisci. Normal variants of the meniscus include hypoplastic menisci, absent menisci, anomalous insertion of the medial meniscus, discoid lateral meniscus, including the Wrisberg variant and discoid medial meniscus.16 Anomalies of the meniscal shape have been reported in man and are classified as hypoplasia or hyperplasia. The meniscal hyperplasias or discoid menisci, have been the object of many studies, because they are frequently the source of symptoms.15t&#xA0;Of the several reported congenital meniscal abnormalities anomalous attachments of the meniscal horns and discoid menisci are the most frequent. They most frequently affect the lateral side of the knee. In 1967 first case of medial meniscal hypoplasia was reported. The association of simultaneous anomalies in the knee, in some cases is likely due to the common mesenchymal origin of some of these structures.17 There are reported cases of complete absence of the medial meniscus as described in thrombocytopenia absent radius syndrome (TAR syndrome). The congenitally absent meniscus appears to influence the development of the distal femur and proximal tibia, the proximal medial tibia was convex and the distal medial femoral condyle was saddle shaped in these cases.16,18 A new case was reported of bilateral hypoplasia of the medial meniscus not in association with other knee anomalies in a young woman as a consequence almost all the medial tibial plateau surface was uncovered.19 Anomalous insertion of the medial meniscus (AIMM) has been illustrated and it is into the anterior cruciate ligament. The anomalous insertion passes from the anterior horn of the medial meniscus to either the mid or base of ACL or the intercondylar notch. The insertion site of the AIMM into the ACL is classified as Type 1 (inferior third), Type 2 (middle third), or Type 3 (superior third; intercondylar notch). The incidence AIMM with discoid MM is greater than with discoid LM.16,20 A study reported a rare anatomical aberration case of double-layered lateral meniscus, where an accessory proximal hemimeniscus was overlying the body and posterior horn of the lateral meniscus in a male of Indian origin.21 Although both menisci have been reported to have discoid shape, lateral tends to be more common than the medial meniscus. Bilateral lateral meniscus involvement is rare and co-existence of both medial and lateral discoid menisci in the same knee has been reported only twice.22 One documented instance of familial transmission (father and two of his four children) of discoid meniscus was reported.23 A case reported in Scotland where the discoid meniscus patient&#x2019;s daughter also had an abnormality of knee suggesting the inheritance playing a part in its transmission.24 Two cases with abnormal band of lateral meniscus, which were serpentine shaped and narrower than the accessory meniscus were reported.25 A case gives description of a ring-shaped meniscus on the lateral side of the human knee without any other associated malformation. The rounded uniform rim with no evidence of a tear of that meniscus suggests that this finding is congenital in origin.26 The most frequently encountered abnormal meniscal variant in children is discoid meniscus.27 Discoid lateral meniscus is more common among Asians than that among Caucasians. The incidence of discoid meniscus ranges from 0.4% to 17% for the lateral and 0.06% to 0.3% for the medial side.28 It is still debatable whether this anatomic derangement necessarily leads to abnormal function or susceptibility to injury. The issue is complicated by the fact that several variants of the discoid meniscus have been described and that there is a continuous range of variation between normal, C-shaped menisci and those that extend completely across the lateral or medial joint space. Stable discoid meniscus is often an incidental finding in asymptomatic patients, which can become symptomatic in the presence of a tear. The most common tear pattern is the degenerative horizontal cleavage, that can result in pain, swelling and snapping of the affected knee. The abrupt change in the rapport between the meniscus and the femoral and tibial condyles leads to a snap sound.2813ngenita In a sample of 316 nonhuman primates, representative of 43 genera the lateral meniscus morphology was studied. The lateral meniscus has a crescentic shape in Prosimii, in Platyrrhinii (New World monkeys) and in Pongo pygmaeus. The lateral meniscus is disc-shaped, with a central foramen, in Catarrhinii (Old World monkeys), in Hylobates, in Gorilla and in Pan troglodytes. 29&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
From our study we can conclude that in most of the specimens the medial meniscus was crescentic in shape (96.66%). Commonest shape of the lateral meniscus was &#x2018;C&#x2019; shape (88.33%). Incomplete lateral discoid menisci were observed in 5% of lateral meniscus. No complete discoid medial or lateral menisci were observed in specimens. This study has provided further information on different shapes of the medial and lateral meniscus especially the presence of incomplete lateral discoid menisci in adults which is a rare finding. This study is useful for the health professionals who work with the treatment of meniscal injuries to create an awareness of the anatomical variations that may exist in the menisci facilitating the rehabilitation process.&#xD;
&#xD;
ACKNOWLEDGEMENT&#xD;
&#xD;
We acknowledge the support and help extended by all the staff of Department of Anatomy JNMC, Belgaum and SSIMSRC, Davangere. Authors Authors acknowledge the im acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where&#xA0;the literature for this article has been reviewed and discussed.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=611</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=611</Fulltext></URLs><References>1. Buckwalter JA, Amendolam A, Clark CR. Articular cartilage and meniscus. In: Insall and Scott NW. Surgery of the knee. 1st ed. London: Churchill Livingstone; 1986.p.310.&#xD;
&#xD;
2. Levangie P, Norkin C. Joint structure and function. 4th ed. Philadelphia: F.A. Davis Company; 2005. Cited by Chivers MD, Howitt SD. Anatomy and physical examination of the knee menisci: A narrative review of the orthopedic literature. J Can Chiropr Assoc 2009; 53(4): 319-33.&#xD;
&#xD;
3. Rath E, Richmond JC. The menisci: Basic science and advances in treatment. Br J Sports Med 2000; 34: 252&#x2013;57.&#xD;
&#xD;
4. Gray JC. Neural and vascular anatomy of the menisci of the human knee. J Orthop Sports Phys Ther. 1999; 29(1): 23-30.&#xD;
&#xD;
5. Moore KL, Dalley AF. Clinically oriented anatomy. 4th ed. Philadelphia: Lippincott Williams and Wilkins; 1999. p 690-99.&#xD;
&#xD;
6. Fairbank TJ. Knee joint changes after meniscectomy. Journal of Bone and Joint Surgery 1948; 30B: 664-70.&#xD;
&#xD;
7. Messner K, Gao J. The menisci of the knee joint: Anatomical and functional characteristics and a rationale for clinical treatment. J Anat 1998; 193:161-78.&#xD;
&#xD;
8. Nelson E W, LaPrade R F. The Anterior Intermeniscal Ligament of the Knee. An Anatomic Study. The American Journal of Sports Medicine. 2000; 28 (1): 74-76.&#xD;
&#xD;
9. Kale A, Kopuz C, Edyzer M, Aydin M.E, Demyr M, Ynce Y. Anatomic variations of the shape of the menisci: A neonatal cadaver study, Knee Surg Sports Traumatol Arthrosc. 2006; 14: 975-81.&#xD;
&#xD;
10. Murlimanju B V, Nair N, Pai S R, Pai M M, Gupta C, Kumar V &amp; Pulakunta T. Morphometric Analysis of the Menisci of the Knee Joint in South Indian Human Fetuses. Int. J. Morphol. 2010; 28(4):1167-71.&#xD;
&#xD;
11. Murlimanju B V, Nair N, Pai S, Pai M, Chethan P, Gupta C. Morphological study of the menisci of the knee joint in adult cadavers of the South Indian population. Marmara Medical Journal. 2010; 23(2 ): 270-75.&#xD;
&#xD;
12. Murlimanju B V, Nair N , Pai MM, Krishnamurthy A, Philip C. Morphology of the medial meniscus of the knee in human fetuses. Romanian Journal of Morphology and Embryology. 2010; 51(2): 347-51.&#xD;
&#xD;
13. Kaplan EB. Discoid lateral meniscus of the knee joint. J.Bone Joint Surg. 1957;39A: 77-87.&#xD;
&#xD;
14. Almeida SKS, De Moraes ASR, Tashiro T, Neves ES, Toscano EA, De Abreu RMR. Morphometric study of menisci of the knee joint. Int J Morphol. 2004; 22(3): 181-84.&#xD;
&#xD;
15. Smillie I.S. Injuries of the knee Joint. 4th ed. London: Churchill Living Stone; 1975.p 23-38.&#xD;
&#xD;
16. Ali S, Dass C, Shah P, Sewards JM. Normal variants of the meniscus. Applied Radiology 2013; 14-18.&#xD;
&#xD;
17. Clark C.R, Ogden J.A. Development of the menisci of the human knee joint. The Journal of Bone and Joint Surgery 1983; 65A (4): 538-47.&#xD;
&#xD;
18. Tolo VT. Congenital absence of the menisci and cruciate ligaments of the knee: A case report. J Bone Jt Surg Am 1981; 63: 1022-24.&#xD;
&#xD;
19. Monllau JC, Gonzalez G, Puig L, Caceres E. Bilateral hypoplasia of the medial meniscus. Knee Surg Sports Traumatol Arthrosc 2006; 14: 112-13.&#xD;
&#xD;
20. Nakajima T, Nabeshima Y, Fujii H,Ozaki A, Muratsu H, Yoshiya S. Symptomatic anomalous insertion of medial meniscus. Arthoscopy: The Journal of Arthoscopic and Related Surgery 2005; 21(5): 629e1-29e4.&#xD;
&#xD;
21. Karataglis D, Dramis A, Learmonth DJA. Double-layered lateral meniscus: A rare anatomical aberration. The Knee 2006; 13: 415-16.&#xD;
&#xD;
22. Vidyadhara S, Rao SK, Rao S. Discoid medial meniscus varied presentation of 3 knees. Saudi Med J 2006; 27(6): 888-91.&#xD;
&#xD;
23. Dashefsky J. Discoid lateral meniscus in three members of a family: Case reports. J Bone Joint Surg Am1971; 53A:1208-10.&#xD;
&#xD;
24. Ross JA, Tough ICK, English TA. Congenital discoid cartilage: Report of a case of discoid medial cartilage, with an embryological note. J Bone Joint Surg Br. 1958; 40: 262- 67.&#xD;
&#xD;
25. Lee B and Min KD. Abnormal band of the lateral meniscus of the knee. Arthroscopy: The Journal of Arthroscopic and Related Surgery 2000;16 ( 6 ): 1-4.&#xD;
&#xD;
26. Monllau JC, Leon A, Cugat R, Ballester J. Ring shaped lateral meniscus. Arthroscopy 1998; 14(5): 502-04.&#xD;
&#xD;
27. Kocher MS, Klingele K, Rassman SO. Meniscal disorders: Normal, discoid and cysts. Orthop Clin N Am 2003; 34: 329-40.&#xD;
&#xD;
28. Yaniv M, Blumberg N. The discoid meniscus. J Child Orthop 2007; 1: 89-96.&#xD;
&#xD;
29. Le Minor JM. Comparative morphology of the lateral meniscus of the knee in primates. J.Anat. 1990; 170: 161-71.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>BOVINE MASTITIS AS AN EVOLVING DISEASE AND ITS IMPACT ON THE DAIRY INDUSTRY&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>48</FirstPage><LastPage>55</LastPage><AuthorList><Author>Ahmad Arif Reshi</Author><AuthorLanguage>English</AuthorLanguage><Author> Ishraq Husain</Author><AuthorLanguage>English</AuthorLanguage><Author> S. A. Bhat</Author><AuthorLanguage>English</AuthorLanguage><Author> Muneeb U. Rehman</Author><AuthorLanguage>English</AuthorLanguage><Author> Rahil Razak</Author><AuthorLanguage>English</AuthorLanguage><Author> S. Bilal</Author><AuthorLanguage>English</AuthorLanguage><Author> Manzoor R. Mir</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Worldwide, mastitis is emerging as a major challenge in dairy development, on account of being the cause for severe wastage and undesirable milk quality, besides breed development, nutritional management, control of infections and internal parasitic diseases. The major factors found to be important and affecting the prevalence of subclinical mastitis included flock size, regional agro climatic conditions, distinctive socio-cultural practices, marketing of milk and its byproducts, literacy level of the animal owner, feeding system and administration. The continuing presence of the disease may be attributed to poor practices which includes unhygienic conditions, improper milking practices, faulty milking equipment, lack of veterinary medicines, poor housing besides breeding strategies for ever-increasing milk yield. It is important to be aware of the fact that being an infectious disease, all methods of commercial milk production may provide suitable breeding conditions for mastitis organisms and thus spread mastitis from cow to cow. On account of insights provided by a considerable body of evidence it is suggested that to increase exposure of cows to mastitis organisms and thereby get infected, several management and environmental factors interact together which compromise the cows natural resistance to disease help organisms in gaining entrance through the teat canal to milk secreting tissues of the udder where they cause infection. The incidence of disease is thus result of interplay between the infectious agents and management practices emphasizing the importance of udder defense.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Mastitis, Subclinical mastitis, Clinical mastitis, Dairy farms, Milk</Keywords><Fulltext>INTRODUCTION &#xD;
&#xD;
Bovine mastitis defined as &#x2018;parenchymal inflammation of the mammary gland&#x2019; is characterized by a range of physical and chemical changes of the milk and pathological changes in the udder glandular tissues (Radostits et al., 2000). Mastitis, one of the most widespread and common diseases is characterized as an endemic disease affecting dairy herds worldwide (Halasa et al., 2007). It is the most cost intensive production disease in dairy industry, causing a considerable financial burden in terms of medical treatment, reduced fertility, extra labor and reduced milk yield (Schroeder et. al., 2010). Worldwide, mastitis is one of the most widespread and expensive diseases affecting the dairy business (Petrovski et al., 2006). Mastitis, a multi-etiological complex disease associated with dairy production is the most costly production disease inflicting major economic losses to dairy industry worldwide, especially in developed countries (Seegers et al., 2003). Economic losses associated with mastitis derive mainly from a reduced milk production, discarded milk, early cow replacement costs, reduced cow sale value and to a lesser extent, from the culling of continually infected cows, veterinary services, cost of veterinary treatment, drugs, labor and penalties on milk quality (Seegers et al., 2003). The continuing incidence of the disease in spite of exhaustive research and the implementation of various mastitis control strategies over the decades may be attributed to deficient management, improper milking procedures, faulty milking equipment, inadequate housing and breeding for ever-increasing milk yield (Pyorala et al., 2002). It is important to be aware of the fact that being an infectious disease, all methods of commercial milk production provide suitable breeding conditions for mastitis organisms and thus spread mastitis from cow to cow. The incidence of disease is the result of interplay between the infectious agents and management practices stressing proper udder defense strategies. According to Kennedy and Miller (1993) mastitis is expressed by tissue injury caused by tissue invasive or toxigenic organisms, which become dominant due to upset of balance&#xA0;in microbial population or suppression of the innate immune response. Mastitis as per the present scenario has symbolized itself as a most challenging disease in high yielding dairy animals in India next only to FMD (Foot and Mouth Disease) (Varshney &amp; Mukherjee, 2002). But as per reports of its occurrence in dairy animals, it places itself at first position with its prevalence reported in more than 90% of high yielding cows (Sharma et al., 2003). Mastitis according to the clinical symptoms may be classified as Clinical mastitis or Sub- Clinical mastitis. In general Clinical mastitis portrays itself by rapid onset, inflammation, reddishness of the udder, tenderness, and reduced and altered milk discharge from the affected quarters. Clinical mastitis is also accompanied by fever, despair and anorexia, in addition the milk may have clots, flakes, gargot (Fibrin clots), off color, bloody or of watery in consistency. The Sub clinical mastitis on the other hand have no visible signs either in the udder or in the milk, but temporary decrease of milk quality may be observed. Subclinical mastitis can be detected by monitoring the number of somatic cells in the milk (Somatic Cell Count-SCC) (Schukken et al., 2003). Subclinical mastitis according to Shearer &amp; Harris (2003) is important due to the fact that it is 15 to 40 times more prevalent than the clinical form. Subclinical mastitis usually leads the clinical form as it is of longer period, difficult to diagnose, adversely affects milk production and quality and comprises a reservoir of pathogens that lead to disease of other animals within the herd.&#xD;
&#xD;
CAUSES&#xD;
&#xD;
Mastitis is a complex disease, mainly caused by a variety of pathogens, with substantial differences in infection patterns (clinical versus subclinical, acute vs. chronic) with no simple model encompassing all possible facets of the disease (Fetrow et. al., 2000). Mastitis is usually caused by bacterial pathogens which can be classified into two groups; the contagious pathogens including Streptococcus agalactiae, Staphylococcus aureus and Mycoplasma bovis which reside predominantly in the udder and spread during milking and environmental pathogens including Streptococcus species (Streptococcus uberis and Streptococcus dysgalactiae) and environmental coliforms (Gram negative bacteria Escherichia coli, Klebsiella spp., Citrobacter spp., Enterobacter spp., Enterobacter faecalis and Enterobacter faecium; and other gram negative bacteria such as Serratia, Pseudomonas and Proteus) (Radostits et al. 2000). The bovine mammary gland is protected by innate and specific immune responses (Sordillo &amp; Streicher, 2002) however; abnormal environmental and physiological factors could compromise the defense mechanism of the mammary gland (Waller et al., 2000). Milking by means of machines has been found to contribute to teat damage thereby increasing the vulnerability of mastitis causing pathogen colonization. Besides poor management practices including poor housing environment, increased cow densities per unit, low ventilation, unhygienic conditions, improper milking practices and lack of veterinary medicines can also increase the susceptibility to bovine mastitis (National Mastitis Council, 1996). Nevertheless, the lactation stage of a cow especially is the most important factor in contributing to increased susceptibility of bovines to mastitis (Oliver &amp; Sordillo, 1988). The genetic selection of cows for milk production has increased milk productivity but decreased resistance to mastitis, contributing to higher incidence (Waller et al., 2000).&#xD;
&#xD;
PATHOGENESIS&#xD;
&#xD;
Mastitis in dairy cattle&#x2019;s takes place when the udder becomes inflammed as a result of pathogenic (most often bacterial) invasion of the teat canal. These bacteria once inside the teat canal migrate up the teat canal and colonize and multiply in the alveoli. These colonized organisms then produce toxic substances, which causes injury to the milk secreting tissue besides physical trauma and chemical irritants. According to Sordillo (1987), the predominant cells found in the mammary tissue and mammary secretions during early stage of mastitis infection constituting &gt;90% of the total leukocytes are neutrophils. The neutrophils exercise their bactericidal effect through a respiratory burst and produce oxygen and hydroxyl radicals that kill the bacteria. During phagocytosis, bacteria are also exposed to several oxygen independent reactants such as peroxidases, lysozymes, hydrolytic enzymes and lactoferrin. In addition to their phagocytic activities, neutrophils are a source of antibacterial peptides called defensins, killing a variety of pathogens that cause mastitis (Selsted et al., 1993). As a result of mammary invasion by pathogenic species, masses of neutrophils pass between the milk secreting cells into the lumen of the alveoli, increasing the somatic cell counts besides injuring the secretory cells. The increase in the number of leukocytes in milk results in the increased number of somatic cells as well. This aggregation of leukocytes and blood clotting factors results in the formation of clots which may perhaps block the lacteal ducts and prevent complete removal of milk, resulting in scar formation along with proliferation of connective tissue elements (Jones et al., 2006). Macrophages, the chief cells found in milk and tissue of healthy involuted and lactating mammary glands (Sordillo &amp; Nickerson, 1988), ingest bacteria, cellular debris and accumulated milk components. The phagocytic activity of mammary gland macrophages can be increased in the presence of indiscriminate ingestion&#xA0;of fat, casein and milk components, usually less effective at phagocytosis than blood leukocytes (Sordillo &amp; Babiuk, 1991). Macrophages also play a role in antigen processing and presentation (Politis et al., 1992). In general invading pathogens are known to induce an immune response by exciting the native immune system in the mammary gland. The major pathogenic element of Staphylococcus aureus is Lipoteichoic Acid (LTA) and one of the chief pathogenic components of E. coli is Lipopolysacharide (LPS) (Beutler &amp; Rietschel, 2003). However, LTA is considered the gram-positive counterpart of LPS (van Amersfoort et al., 2003). Other cell wall components such as peptidoglycans also have immunological effects in gram-positive bacteria (Fournier &amp; Philpot, 2005). The significant systemic response of the organism to local or systemic disturbances in its homeostasis caused by infection, tissue injury, trauma or surgery, neoplastic growth or immunological disorders is Acute Phase Response (APR) (Gruys et al., 1999). For the development of an effective immune response the importance of inflammatory cytokines against mastitis has been documented in several researches, which collectively have evaluated changes in their concentrations in milk during tests on animals with experimentally infected udders (Bannerman et al., 2009). Acute Phase Index when applied to healthy animals separated from animals with some disease, much better results are achieved than with single analytes and statistically acceptable results for culling individual dairy animals may well be reached (Gruys et al., 2005). Since serum concentration of APPs (Acute Phase Proteins) during impaired physiological conditions changes by as much as 25%, APPs have been thought-out to be exploitable as potential biomarkers in the future for the diagnosis and prognosis of both companion and farm animal disease, examining health status, and assessing responses to primary and adjunctive therapy in veterinary practice. The pattern of protein synthesis by the liver is considerably changed within a few hours after infection resulting in an increase of some blood proteins, the APPs (Ingenbleek &amp; Young, 1994). Hepatic mRNA upregulation of the positive APPs is associated with a decreased synthesis of some normal blood proteins, like Retinol Binding Protein (RBP), Transthyretin (TTR), and Cortisol Binding Globulin, Albumin and Transferrin, representing the negative APPs. The positive APPs, like C - reactive protein (CRP), Serum Amyloid A (SAA) and Haptoglobin (Hp) are mainly the proteins released by the hepatocytes after cytokine stimulation (Heinrich et al., 1998). Besides the decreased level of zinc, iron and albumin in serum, a decrease of Transferrin, Cortisol-Binding Globulin, Transthyretin (TTR) and Retinol-Binding Protein (Retinol; Vitamin A) have also been described indicating a momentarily increased availability of free hormones bound to these proteins. On the farm, APP analysis may be used to help scrutinize the health and welfare of production animals for their optimal growth (Eckersall et al., 2000). In cattle, (Haptoglobin) is an effective marker in the diagnosis and prognosis of mastitis, peritonitis, pneumonia, enteritis, endometritis, and endocarditis (Murata et al., 2004; Petersen et al., 2004). Similarly Bovine Serum Amyloid A (SAA) is found to be elevated more by acute rather than chronic inflammatory conditions (Jacobsen et al., 2005). Investigational representations of mastitis have confirmed that both Hp and M-SAA3 (Mammary Associated Amyloid A3) are synthesized in the infected mammary gland (Eckersall et al., 2006) stressing their possible role as biomarkers to assess naturally-occurring (Gerardi et al., 2009) or experimentally-induced (Moyes et al., 2009; Simojoki et al., 2009; Zecconi et al., 2009) mastitis. Toll like Receptors (TLRs), belong to a family of conserved innate immune recognition receptors that trigger adaptive immune responses (Zhang et al., 2011). So far about 10 TLRs have been identified in cattle, (Menzies &amp; Ingham, 2006). In the mammary gland, cells from the immune system together with epithelial cells are responsible for recognizing the invading microorganism via Toll-like receptors, or TLRs (Griesbeck et al., 2008). The expression of inflammatory cytokines and other intermediaries related to immune response, cell differentiation and apoptosis are triggered via activation of TLRs (Cates et al., 2009). Development of an effective immune response against mastitis as documented in several researches have recognized the importance of inflammatory cytokines by evaluating changes in their concentrations in milk during tests on animals with experimentally infected udders (Bannerman et al., 2009). The genes involved in the immune response have been indicated as strong candidates in determining host resistance response because of the complex nature of mastitis (Fonseca et al., 2009). The intracellular TIR domain since its involvement in engaging signaling pathways within cells is highly conserved with functional resemblance among species and TLR genes, (Beutler and Rehli, 2002). The extracellular TLR domains however, exhibit significantlyhigher variance reflecting their involvement in MAMP (Microbe Associated Molecular Patterns) recognition from multiple microbial sources (Zhou et al., 2007). The molecular patterns recognized by TLR4 are mainly presented by lipopolysacharide (LPS) that is a component of the ectoblast of Gram-negative bacterium, and stimulate the over expression of inflammatory factors like , IL-1, IL-6, and IL-8, which participate in innate immune response and then confer resistance (Shizuo et al., 2001). TLR4 is the only important pattern recognition receptor of the TLRs family that recognizes endotoxins associated with gram-negative bacterial infections (McGuire et al.,&#xA0;2005). Because of its role in pathogen recognition and consequent initiation of the immune and inflammatory response makes it an appropriate candidate gene for enhancing disease resistance in dairy cattle (Sharma et al., 2006). Bovine TLR4 gene was discovered in 2003 and mapped to chromosome 8 (McGuire et al., 2005). The result indicated that mastitis strongly increased mRNA expression, thereby suggesting that TLR4 gene might be related with mastitis. TLR9 recognizes CpG DNA motif present in bacterial and viral genomes as well as nonnucleic acids such as hemozoin from the malaria parasite (Akira et al., 2006; Uematsu S et al., 2006).&#xD;
&#xD;
ECONOMIC DRAWBACKS&#xD;
&#xD;
The economic consequences of bovine mastitis are not restricted only to the farm but expand beyond the dairy farm (related to production losses, treatment, culling and changes in milk quality) thereby have a significant impact on the farm business. In India, the first comprehensive report on economic losses caused by mastitis was published in 1962 indicating annual losses of Rs. 52.9 Crores (Dandha &amp; Sethi, 1962). However in later years with the launching of operation flood, tremendous thrust was given on cross breeding program which resulted in tremendous increase in high yielding bovine population, leading to many fold increase in economic loss. The fact is evidenced from a recent report where in annual economic losses sustained by dairy industry in India on account of udder infections have been projected about Rs. 6053.21 crores. Out of this, loss of Rs. 4365.32 crores (70%-80% loss) was credited to sub clinical version of udder infections (Dua et al., 2001). The annual economic losses due to bovine mastitis are estimated to be Rs. 7165.51 crores in India, out of which 57.93% (Rs. 4151.16 crores losses) has been attributed to subclinical mastitis. Control of bovine mastitis is constrained because of multiple etiological agents. A rapid, sensitive and specific diagnostic method capable of simultaneously detecting multiple causative agents is essential for surveillance and monitoring of udder health. Mastitis, a multi-etiological complex disease associated is the most expensive production disease inflicting major economic losses to dairy industry worldwide especially in developed countries (Seegers et al., 2003). In U.S., the annual loss per cow from mastitis in 1976 were estimated to be $117.35 and losses of milk yields caused by mastitis were 386 kg/cow per year and losses of discarded milk 62 kg/cow per year (Blosser et al., 1979), which increased to $185 to $200 per cow per year (Costello et al., 2004). Similarly in 1976 losses from mastitis were $1.294 billion in U.S. which increased up to $2 billion in the year of 2009 (Viguier et al., 2009). Mastitis has been and continues to be recognized as one of the major disease problems concerning the dairy industry. Mastitis is a global problem as it adversely affects animal health, quality of milk and economics of milk production and every country including developed ones suffer huge financial losses (Sharma et al., 2007). Economic losses associated with are due to reduced milk yield (up to 70%), milk discard after treatment (9%), cost of veterinary services (7%) and premature culling (14%) (Bhikane &amp; Kawitkar, 2000). In both clinical and subclinical mastitis there is a substantial loss in milk production. A recent study by Wilson (2004) at Cornell University showed that clinical mastitis tends to strike high able producing animals in second-plus lactation. In other words mastitis often hits the cows with the highest production potential, which expands the loss due to mastitis. According to the study, the estimated loss following clinical mastitis was almost 700 kg for cows in first lactation and 1,200 kg for cows in second or higher lactation (Wilson et al., 2004). Rajala et al., (1999) reported in that cows with clinical mastitis did not return to the same production level within the remainder of the lactation, according to Miller et al., 2004.&#xD;
&#xD;
PREVENTIVE AND CONTROL STRATEGIES &#xD;
&#xD;
Monitoring udder health performance is possible only by the use of reliable but affordable diagnostic methods. Therefore, there is a constant need to improve diagnostic methods, in terms of their accuracy, cost, or convenience. The most commonly used diagnostic methods are SCC and bacteriological culturing of milk. The diagnostic approach to mastitis starts with visual examination of the udder and of the milk through the fore stripping, which is also an important part of udder preparation (Reneau et al., 2001). In case of any noticeable change in quarter or any noticeable abnormality in the milk, the quarter is defined as having clinical mastitis. There is a considerable body of evidence suggesting that the normal dairy cow milk has a regular level of 100,000- 150,000 somatic cells/ml and higher SCC point to secretory disturbance rather than any disease (Hillerton et al., 1999). The somatic cell count for the composite milk for an udder with four healthy quarters should not exceed 100,000 cells /ml (Ma et al., 2000). A value of SCC exceeding above 200,000 cells/ml in a composite sample of a cow is abnormal with 60% probability of inflammation in one or more quarters of the udder (Mellerberger et al., 1999). Other enzymatic tests include the esterase detection secreted by somatic cells using an enzymatic assay on a dipstick. Lately, bioluminescence-determination assays, based on estimation of the ATP concentrations in somatic cells or the recognition of somatic cell DNA by fluorescent staining, have also been used for the reliable&#xA0;determination of elevated SCC levels and hence the possible presence of mastitis (Frundzhyan et al.,2008). The identification of pathogens causing mastitis is important for disease control and epidemiological studies. Bacteriological culturing each specifying its own goal can be carried out at herd, as well as cow and quarter level. Conventionally identification of the microbial species is carried out according to biochemical, serological and cultural properties. Commercially biochemical kits for species identification are available but they have been proved unreliable for the identification of veterinary pathogens. For this reason, the use of molecular techniques like PCR (Polymerase Chain Reaction) has been employed in pathogen detection for a number of mastitis pathogens (Zadoks et al., 2006). Recently techniques like multiplex PCR tests in which several pathogens can be tested at the same time have been developed (Phuektes et al., 2003). Additionally, real-time PCR assays are being developed for detection and quantifying mastitis pathogens in milk. Recent advances in relevant proteomics techniques, such as twodimensional gel electrophoresis and mass spectroscopy, have led to the identification of various new proteins implicated in mastitis. The proteomics have revealed new information on the diverse protein expression pattern obtained from mastitis- infected milk and on the proteins expressed by invading pathogens. The information can further be applied not only in the discovery of new therapeutic targets but also in the search for identification of new diagnostic biomarkers. Recent advances in microfluidics and so-called &#x2018;biochips&#x2019; have the capacity to revolutionize diagnostics (Viguier et al., 2009). The clinical management of mastitis has become a concern to the veterinarians, as the conventional antibacterial therapy through intramammary route is largely associated with failures. Isolation of the causative organism also does not help much in the clinical management of the disease as the organisms frequently change their sensitivity and develop resistance against antibacterial. The selection of antibiotics for treatment of mastitis should be made on the basis of sensitivity testing and pharmacokinetics characteristics of the drug (Srivastava et al., 2000). Moreover the efficacy of antibiotic following intramammary administration is governed by factors like lipid solubility, tissue protein binding, pH and presence of inflammatory exudates. On the basis of observations done, it has been concluded that parenteral antibacterial therapy following cultural sensitivity testing may be recommended as the immediate therapeutic measure to save udder damage (Malik et al., 2004). In view of better prevention and control, National Mastitis Council in 2003 proposed the &#x201C;Five Point Plan&#x201D; summarizing numerous approaches for controlling herd mastitis. The plan was based upon implementation of preventive and control tactics including better diagnosis, isolation of the animals and the use of better hygiene and remedial protocols (Bramley et al., 2003). The key objectives of the plan were to reduce the scale and the strength of the infection to prevent inclusion of further cases. In India, it is important to educate the farmers regarding the risk factors of mastitis and also about teat dipping as a preventive measure to be practiced regularly by dairy farmers (Kavitha et al., 2009).&#xD;
&#xD;
FUTURE PROSPECTS&#xD;
&#xD;
The `Holy Grail&#x2019; for effective mastitis control remains vaccination and the use of reliable but affordable diagnostic methods. Despite decades of research no `truly effective&#x2019; vaccine is yet commercially available. The most exciting progress possibly in the field of mastitis vaccination has been the development of a subunit vaccine, the plasminogen activator pau A against Str. uberis (Leigh et al., 1999; Fontaine et al., 2002; Pereira et al., 2011) In the premise, for the effective management of the mastitis we need to focus our efforts on improving environmental management and also to approach the management of mastitis in a more holistic manner by ensuring optimal nutrition, minimizing stress and encouraging farmers to pay attention to various awareness programs in detail (Green &amp; Bradley, 2001).&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
Worldwide Bovine Mastitis remains the most costly production disease, considered as a complex disease with its management an increasing challenge to the dairy industry. The mastitis control program by the implementation of the Five-Point Plan and other such programs worldwide have led to a remarkable decrease in the occurrence and prevalence of disease, however this progress could be rapidly lost in the absence of continued implementation of these control strategies. The cost estimation associated with mastitis is notoriously difficult, with even more difficult to quantify the losses associated with subclinical mastitis being unnoticeable to the farmer. The economics of mastitis needs to be addressed at the herd level depending included flock size, regional agro climatic conditions, distinctive socio-cultural practices, marketing of milk and its byproducts, literacy level of the animal owner, feeding system and administration.&#xD;
&#xD;
CONCLUSION &#xD;
&#xD;
In general to establish and thereby implement an efficient mastitis management program in the herd, each&#xA0;dairy producer should create a mastitis advisory team to assess his herd&#x2019;s situation in terms of management, facilities, current level and types of mastitis, etc. The control programs in particular should contain realistic goals that can be attained, which once attained; should help in establishing more challenging goals. A program evaluation and goal reorganization process should be done as frequently as required for the herd, but certainly after a fixed period of time after every six months or as such.&#xD;
&#xD;
AKNOWLEDGEMENT &#xD;
&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/ editors/ publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=612</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=612</Fulltext></URLs><References>1. Akira S., Uematsu S. and Takeuchi O. (2006). Pathogen recognition and innate immunity. Cell 124:783-801.&#xD;
&#xD;
2. Bannerman, D.D. (2009). Pathogen-Dependent Induction of Cytokines and Other Soluble Inflammatory Mediators during Intramammary Infection of Dairy Cows. J Anim Sci. 87:10-25.&#xD;
&#xD;
3. Beutler and Rehli, (2002). Current topics in microbiology and immunology, 270:1-21.&#xD;
&#xD;
4. Beutler B. and Rietschel E.T. (2003). Innate immune sensing and its roots: the story of endotoxin. Nat. Rev. Immunol, 3:169-176.&#xD;
&#xD;
5. Bhikane, A.V. And S.B. Kawitkar, (2000). Hand Book for Asian J. Anim. Vet. Adv, 2: 50-62 Vet. Clin. Venkatesh Books. Udgir, India.&#xD;
&#xD;
6. Blosser T. (1979). Economic losses from the National Research Program on mastitis in the United States. J. of Dairy Sci. 62, 119-127.&#xD;
&#xD;
7. Bramley A., Cullor J., Erskine R., Fox L., Harmon R., Hogan J., Nickerson S., Oliver S., Larry Smith K. and Sordillo L. (2003). Current Concepts of Bovine Mastitis. 4th ed. 421 S. Nine Mound Rd. Verona, WI: National Mastitis Council Publications.&#xD;
&#xD;
8. Cates J.M., Byrd R.H., Fohn L.E., Tatsas A.D., Washington M.K. and Black C.C. (2009). Epithelial-Mesenchymal transition markers in pancreatic duct adeno-carcinoma Pancreas, NIH Public Access; 38(1):e1-6.&#xD;
&#xD;
9. Costello S. (2004). Consultant guide to economics of mastitis. Penn State Nutrition Conference, 2004.&#xD;
&#xD;
10. Dhanda, M.R. and Sethi, M.S. (1962). Investigation of mastitis in India. ICAR Res. Series No. 35. New Delhi, India.&#xD;
&#xD;
11. Dua K. (2001). Incidence, etiology and estimated economic losses due to mastitis in Punjab and in India- An update. Indian Dairyman, 53(10): 41-48.&#xD;
&#xD;
12. Eckersall P.D. (2000). Acute phase proteins as markers of infection and inflammation: monitoring animal health, animal welfare and food safety. Irish Vet. J., Vol. 53, No. 6,: 307-311.&#xD;
&#xD;
13. Eckersall P., Young F., Nolan A., Knight C., Mccomb C. and M. (2006). Acute Phase Proteins in Bovine Milk in an Experimental Model of Staphylococcus Aureus Subclinical Mastitis, J Dairy Sci, 89, 1488-501.&#xD;
&#xD;
14. Fetrow J., Stewart S., Eicker S., Farnsworth R. and Bey R. (2000). Mastitis: an economic consideration. In proceeding of the 29th annual meeting of National Mastitis Council Annual Meeting Proceedings, Atlanta, GA, February 112000: 3-47.&#xD;
&#xD;
15. Fonseca I., Priscila S.V., Carla C.L., Marta F.M., Guimar&#xE3;es, Mayara MDCLW, Katiene R.S.S., Paulo S.L., Jos&#xE9; D.G., Simone E.F. (2009). Expression profile of genes associated with mastitis in dairy cattle. Genet. Mol. Biol. 32 (4):776- 781.&#xD;
&#xD;
16. Fontaine M., Perez-Casal J., Song X., Shelford J., Willson P. and Potter A. (2002). Immunization of Dairy Cattle with Recombinant Streptococcus uberis GapC or a Chimeric Camp Antigen Confers Protection against Heterologous Bacterial Challenge. Vaccine. 20(17-18):2278-2286.&#xD;
&#xD;
17. Fournier B. &amp; Philpott Dj. (2005). Recognition of Staphylococcus Aureus by the Innate Immune System. Clin. Micro. Rev. 18: 521-540.&#xD;
&#xD;
18. Frundzhyan V., Parkhomenko I., Brovko L., Ugarova N.I. (2008). Improved bio-luminescent assay of somatic cell counts in raw milk. J Dairy Res., 75(3):279-83.&#xD;
&#xD;
19. Gerardi G., Bernardini D., Elia C.A. , Ferrari V., Iob L. and Segato S. (2009). Use of serum amyloid A and milk amyloid A in the diagnosis of subclinical mastitis in dairy cows. J. of Dairy Res., 76:411-417.&#xD;
&#xD;
20. Green, M. J. &amp; Bradley, A. J. (2001). Should you be using sand for dairy cow cubicles? In: Proceedings of the British Mastitis Conference, Garstang, and Lancashire. pp. 91-2. Institute of Animal Health, Compton.&#xD;
&#xD;
21. Griesbeck-Zilch B., Meyer H., Kuhn C., Schwerin M. and Wellnitz O. (2008). Staphylococcus Aureus And Escherichia Coli Cause Deviating Expression Profiles Of Cytokines And Lactoferrin Messenger Ribonucleic Acid In Mammary Epithelial Cells. J Dairy Sci 91: 2215-2224.&#xD;
&#xD;
22. Gruys E., Toussaint M., Landman W. (1999). Infection, Inflammation and Stress Inhibit Growth. Mechanisms and Non-specific Assessment of the Processes by Acute Phase Proteins. In: Wensing T, editor. Production Diseases in Farm Animals. 10th International Conference, 1998.Wageningen: Wageningen Press: 72-87.&#xD;
&#xD;
23. Gruys E., Toussaint M., Upragarin N., Van E.A., Adewuyi A.A, Candiani D., Nguyen T. K. and Sabeckiene J. (2005). Acute phase reactants, challenge in the near future of animal production and veterinary medicine. J. of Zhejiang Uni. Sci.&#xD;
&#xD;
24. Halasa, T., Huijps, K., Osteras, O. &amp; Hogeveen, H. (2007). Economic Effects of Bovine Mastitis and Mastitis Management: a Review. Vet. Quarterly 29(1), 18-31.&#xD;
&#xD;
25. Heinrich P.C., Behrmann I., M&#xFC;ller-Newen G., Schaper F., and Graeve L. (1998). Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochem J, 334:297-314.&#xD;
&#xD;
26. Heinrich P.C., Castell T.A. and Andus. T. (1990). Interleukin-6 and the acute phase response. Biochem J. 265:621- 636.&#xD;
&#xD;
27. Hillerton, J. E., 1999. Balancing mastitis and quality. Proc. British Mastitis Conference, Stonelergh, UK. Pp: 31-36.&#xD;
&#xD;
28. Ingenbleek M. and Young V. (1994). Transthyretin (prealbumin) in health and disease: nutritional implications.Ann Rev Nutr. 14:495-533.&#xD;
&#xD;
29. Jacobsen, S., Niewold, T.A., Kornalijnslijper, E., Toussaint, M.J., and Gruys, E. (2005). Kinetics of Local and Systemic Isoforms 0f Serum Amyloid A in Bovine Mastitic Milk. Vet. Immunol. Immunopathol. 104:21-31.&#xD;
&#xD;
30. Jones, G. M. (2006). Understanding the basics of mastitis. Virginia Cooperative Extension. Publication No. 404-233. Virginia State University, USA, pp: 1-7.&#xD;
&#xD;
31. Kavitha, K.L., Rajesh, K., Suresh, K., Satheesh, K. and Syama Sundar, N. (2009). Buffalo mastitis - risk factors. Buffalo Bull., 28(3): 134-137.&#xD;
&#xD;
32. Kennedy, P.C. and Miller, R.B. (1993). The mammary gland. In Pathology of Domestic Animals. Vol. 3. 4th edn. KVF Jubb, P.C. Kennedy and N. Palmer (Editor). Academic press Inc. pp. 454-469.&#xD;
&#xD;
33. Leigh, J. A., Finch, J. M., Field, T. R., Real, N. C., Winter, A., Walton, A. W. &amp; Hodgkinson, S. M. (1999). Vaccination with the plasminogen activator from Streptococcus uberis induces an inhibitory response and protects against experimental infection in the dairy cow. Vaccine 17, 851-7.&#xD;
&#xD;
34. Ma, Y., Ryan, C., D. M. Barbano, D. M. Galton, M. A. Rudan, and K. J. Boor. (2000). Effects of somatic cell count on quality and shelf-life of pasteurized fluid milk. J. Dairy Sci. 83:264-274.&#xD;
&#xD;
35. Malik , H. U. and Mir, A. Q. (2004). Clinical and therapeutic management of bovine mastitis. Indian J. Vet. Med. Vol. 24. No. 2, 2004 pp.120.&#xD;
&#xD;
36. Mcguire, K., Jones, M., Werling, D., Williams, J.L., Glass, E.J. And Jann, O. (2005). Radiation Hybrid Mapping Of All 10 Characterized Bovine Toll-Like Receptors. Ani. Genet. 37, 47-50.&#xD;
&#xD;
37. Mellenberger R.W. (1999). Milking procedures that assure milk quality. Proc. Regional NMC Meeting, Waterloo, Ontario: 24-29.&#xD;
&#xD;
38. Menzies M. and Ingham A. (2006). Identification and expression of Toll-like receptors 1-10 in selected bovine and ovine tissues. Vet. Immunol. Immunopathol., 109:23-30.&#xD;
&#xD;
39. Miller R.H, Norman H.D., Wiggans G.R. and Wright J.R. (2004). Relationship of Test-Day Somatic Cell Score with Test-Day and Lactation Milk Yields. J. Dairy Sci., 87:2299- 2306.&#xD;
&#xD;
40. Moyes, K.M., Drackley, J.K., Morin, D.E., Bionaz, M., Rodriguez-Zas, S.L., Everts, R.E., Lewin, H.A., Loor, J.J. (2009). Gene Network And Pathway Analysis of Bovine Mammary Tissue Challenged With Streptococcus Uberis Reveals Induction of Cell Proliferation And Inhibition of Ppargamma Signaling As Potential Mechanism For The Negative Relationships Between Immune Response And Lipid Metabolism. Bmc Geno., 10, 542.&#xD;
&#xD;
41. Murata H., Shimada N. and Yoshioka M. (2004). Current research on acute phase proteins in veterinary diagnosis: an overview. The Vet. J., 168:28&#x2013;40.&#xD;
&#xD;
42. National Mastitis Control (1996 &amp; 2003): National Mastitis Council Publications.&#xD;
&#xD;
43. Oliver, S. P., and Sordillo, L. M. (1988). Udder Health in the Periparturient Period. J. of Dairy Sci., 71(9), 2584-606.&#xD;
&#xD;
44. Pereira U., Oliveira D., Mesquita L, Costa G. and Pereira L. (2011) Efficacy of Staphylococcus aureus vaccines for bovine mastitis: A systematic review Vet. Micro, 148:117-124.&#xD;
&#xD;
45. Petersen H., Nielsen J. and Heegaard P. (2004). Application of Acute Phase Protein Measurement in Veterinary Clinical Chemistry. Vet. Res., 35:163-187.&#xD;
&#xD;
46. Petrovski K.R., Trajcev M. and Buneski G. (2006). A review of the factors affecting the costs of bovine mastitis. J. of the South African Vet. Associat., 77(2): 52-60.&#xD;
&#xD;
47. Phuektes P., Browning G., Anderson G., Mansell P. (2003). Multiplex polymerase chain reaction as a mastitis screening test for Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae and Streptococcus uberisin bulk milk samples. J Dairy Res.,70 (2):149-55.&#xD;
&#xD;
48. Politis, I., X. Zhao, B. W. McBride and J. H. Burton (1992). Function of bovine mammary macrophages as antigen presenting cells. Vet. Immunol. Immunopathol., 30: 399.&#xD;
&#xD;
49. Pyorala S. (2002). New strategies to prevent mastitis. Reproduction in Domestic Animals 37: 211-216.&#xD;
&#xD;
50. Radostits, O.M., Blood, D.C., Gay, C.C., Blood, D.C. and Hinchkliff, K.W. (2000). Veterinary Medicine. 9th Edn, ELBS-Bailliere Tindal, London pp: 563-618.&#xD;
&#xD;
51. Rajala-Schultz P.J., Grohn Y.T. and McCulloch C.E. (1999). Effects of milk fever, ketosis, and lameness on milk yield in dairy cows. J. of Dairy Sci., 82: 288-294.&#xD;
&#xD;
52. Reneau J.K. (2001). Somatic cell counts: measures of farm management and milk quality. In: Proc., National Mastitis Council Ann. Mtg. p. 29-37.&#xD;
&#xD;
53. Schroeder J. (2010). Mastitis Control Programs: Bovine Mastitis and Milking Management. Extension Bulletin as- 1129: North Dakota State University.&#xD;
&#xD;
54. Schukken Y.H., Wilson D.J., Welcome F., Garrison-Tikofsky L. and Gonzales R.N. (2003). Monitoring udder health and milk quality using somatic cell counts. Vet. Res. (34): 579- 596.&#xD;
&#xD;
55. Seegers H., Fourichon C. &amp; Beaudeau F. (2003). Production effects related to mastitis and mastitis economics in dairy cattle herds. Vet. Res., 34(5):475-491.&#xD;
&#xD;
56. Selsted M. E., Y. Q. Tang, W. L. Morris, P. A. McGuire, M. J. Nonotny, W. Smith A. H. Henschen and H. S. Cullor (1993). Purification, primary structures, and antibacterial activities of the beta defenses, a new family of antibacterial peptides from bovine neutrophils. J. Biol. Chem., 268: 6641.&#xD;
&#xD;
57. Sharma N. (2007). Alternative Approach to Control Intramammary Infection in Dairy Cows: A Review. Asian J. Anim. Vet. Adv, 2: 50-62.&#xD;
&#xD;
58. Sharma N., A. Gautam, S. R. Upadhyay, K. Hussain, J. S. Soodan and S. K. Gupta. (2006). Role of Antioxidants in Udder Health: A Review. Indian J. Field Vet. 2(1):73-76.&#xD;
&#xD;
59. Sharma, Neelesh. (2003). Epidemiological study on sub clinical mastitis in dairy animals: Role of vit E and Selenium supplementation on its control in cattle. M.V.Sc. thesis, submitted to IG.KVV. Raipur (C.G.) India.&#xD;
&#xD;
60. Sheare, J. K. and B. Harris, Jr. (2003). Mastitis in dairy goats. Anim. Sci. Dept. Florida Coop. Ext. Serv. Inst. Food Agri. Sci; Univ. Fl. Gainesville, USA. pp:1-6.&#xD;
&#xD;
61. Shizuo A. (2001) Toll like receptors and innate immunity, Immunology. 78,1-11.&#xD;
&#xD;
62. Simojoki H., Orro T., Taponen S., Pyorala S. (2009). Host Response In Bovine Mastitis Experimentally Induced With Staphylococcus Chromogenes. Vet. Micro. 134: 95-99.&#xD;
&#xD;
63. Sordillo, L. M. and L. A. Babiuk (1991). Modulation of mammary neutrophil function during the periparturient period following in vitro exposure to recombinant bovine interferon gamma. Vet. Immunol. Immunopathol., 27: 3370.&#xD;
&#xD;
64. Sordillo, L. M. and S. C. Nickerson (1988). Morphometric changes in the bovine mammary gland during involution and lactogenesis. Amer. J. Vet. Res., 49: 1112.&#xD;
&#xD;
65. Sordillo, L. M., S. C. Nickerson, R. M. Akers and S. P. Oliver (1987). Secretion composition during bovine mammary involution and the relationship with mastitis. Intl. J. Biochem., 19: 1165.&#xD;
&#xD;
66. Sordillo, L.M., Streicher, K.L. (2002). Mammary gland immunity and mastitis susceptibility. J. Mammary Gland. Biol. Neoplasia 7, 135&#x2013; 146.&#xD;
&#xD;
67. Srivastava, A. K. (2000). Recent concepts on the use of antimicrobials in the treatment of mastitis. In: Mastitis. Verma, R. and Mamtani, A.P. (eds.), pp.62-83.&#xD;
&#xD;
68. Uematsu S., Jang M.H., Chevrier N., Guo Z., Kumagai Y., Yamamoto M. (2006). Detection of pathogenic intestinal bacteria by Toll-like receptor 5 on intestinal CD11c+ lamina propria cells. Nat Immunol. 7:868-74.&#xD;
&#xD;
69. Van Amersfoort, Edwin S, Theo J C, Van Berkel, and Johan Kuiper (2003).Receptors, Mediators, and Mechanisms Involved in Bacterial Sepsis and Septic Shock. Clin. Microbiol Rev, 16(3): 379-414.&#xD;
&#xD;
70. Varshney, J.P. and Mukherjee, R. (2002). Recent advances in management of bovine mastitis. Intas Polivet 3(1): 62- 65.&#xD;
&#xD;
71. Viguier, C., Arora, S., Gilmartin, N., Welbeck, K. and O&#x2019;Kennedy, R. (2009). Mastitis detection: current trends and future perspectives. Trends in Biotechnology. 27(8): 486-493.&#xD;
&#xD;
72. Waller, K.P., Mammary gland immunology around parturition. Influence of stress, nutrition and genetics. Adv Exp Med Biol, 2000. 480: p. 231-45.&#xD;
&#xD;
73. Wilson, D.J., Gonz&#xE1;lez, R.N., Hertl, J., Schulte, H.F, Bennett, G.J., Schukken, Y.H and Gr&#xF6;hn, Y.T. (2004). Effect of Clinical Mastitis on the Lactation Curve: A Mixed Model Estimation Using Daily Milk Weights. J. Dairy Sci., 87:2073- 2084.&#xD;
&#xD;
74. Zadoks R., Schukken Y.(2006). Use of molecular epidemiology in veterinary practice. Veterinary Clinics of North America: Food Ani. Pract. 22(1):229-261.&#xD;
&#xD;
75. Zecconi A., Piccinini R., Fiorina S., Cabrini L., Dapra V. and Amadori M. (2009). Evaluation of interleukin-2 treatment for prevention of intramammary infections in cows after calving Comparative Immunology Microbiology and Infectious Diseases, 32:439-451.&#xD;
&#xD;
76. Zhang F.H., Tanaka T., Kawato S., Kitami K., Nakai M., Motohashi N., Suzuki C.L., Wang K., Ochiai K., Isokawa and Maeno M. (2011). &#x201C;Interleukin-17A induces cathepsin K and MMP-9 expression in osteoclasts via celecoxib-blocked prostaglandin E2 in osteoblasts.&#x201D; Biochimie 93(2):296- 305.&#xD;
&#xD;
77. Zhou X., Brown C.J., Abdo Z., Davis C.C., Hansmann M.A. (2007). Differences in the composition of vaginal microbial communities found in healthy Caucasian and black women. ISME Journal, (1):121-133.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>7</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>A CONCISE ENTOMOLOGICAL EVALUATION OF ONCHOCERCIASIS TRANSMISSION IN AHANI-ACHI COMMUNITY IN OJI-RIVER LOCAL GOVERNMENT AREA OF ENUGU STATE, NIGERIA&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>56</FirstPage><LastPage>62</LastPage><AuthorList><Author>Chikezie F.M.</Author><AuthorLanguage>English</AuthorLanguage><Author> Ezihe E.K.</Author><AuthorLanguage>English</AuthorLanguage><Author> Uzoigwe N.R.</Author><AuthorLanguage>English</AuthorLanguage><Author> Opara K.N.</Author><AuthorLanguage>English</AuthorLanguage><Author> Igbe M.A.</Author><AuthorLanguage>English</AuthorLanguage><Author> Okonkwo N.J.</Author><AuthorLanguage>English</AuthorLanguage><Author> Nwankwo E.N.</Author><AuthorLanguage>English</AuthorLanguage><Author> Nwoke B.E.B.</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background and objectives: Onchocerciasis is an important threat to public health in Nigeria, which in turn contributes significantly to total world cases of the disease. This study determined the rate of transmission of onchocerciasis in Ahani-Achi, identified the principal vector groups of the disease in the study area and evaluated the relative abundance of black fly vectors and the various transmission indices.&#xD;
Methodology: Black flies were caught using human baits and were assessed for parity. Parous flies were further dissected to detect the presence of Onchocerca larvae. Biting rates and transmission potentials were calculated using standard methods.&#xD;
Results: A total of 836 adult female flies were caught in the community. These were identified as members of the forest species of the S. damnosum complex. The differences in relative abundance between the months were not significantly different (P &gt; 0.05). The monthly biting rate (MBR) was lowest in February but highest in October. There was no on-going transmission in the area studied as no infective fly was caught. Hourly variation in fly activities were observed and this was significantly different (P</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Onchocerciasis, Black flies, Onchocerca, Vectors</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Onchocerciasis is a tropical parasitic filarial disease posing serious public health challenges. It negatively affects socio-economic development especially in Africa[1], and other negative impacts on areas that are endemic. The clinical manifestations of the disease include total loss of vision, partial visual impairment, skin lesions, hanging groin, and hernia [2], among others. Results of recent epidemiological studies revealed that 37 million people are infected with onchocerciasis, and 90 million at risk in Africa [3]. Nigeria is one country with more people blinded by onchocerciasis compared to any other country of the world [4]. It was estimated that 100,000 cases of the 268,000 worldwide cases, as well as approximately 3.2 million infections with O. volvulus occur in Nigeria [5]. Nigeria therefore accounts for more than one third of the total global onchocerciasis infection [6]. The genus Simulium comprises many species and complexes. In West Africa, the most dorminant of such complexes is the S. damnosum complex, comprising S. dam&#xA0;nosum s.s., S. sirbanum, S. sanctipauli, S. soubrense, S. yahense, S. squamosum, S. leonense, S. konkourense and S. dieguerense [7] [8] [9] [10]. In Nigeria, 9 cytoforms of the Simulium damnosum complex have been reported from different parts of the country. These include: S. damnosum s.s, S. sirbanum, S. sudanense, S. squamosum Volta form [11], S. squamosum Enderlein, S. yahense, S. sanctipauli, S. soubrense and the Beffa form of S. soubrense [12]. [13] found the main vectors species in Nigeria to be S. damnosum s.s, S. sirbanum, S. sanctipauli, S. soubrense S. squamosum, S. yahense. However, a cytotaxonomic analysis of Simulium damnosum s.1 larvae collected from 23 sites across 4 bioclimatic zones in Nigeria carried out by [14] revealed the presence of 5 cytospecies namely: S. damnosum s.str., S. sirbanum, S. squamosum, S. yahense and S. soubrense (including the Beffa form); excluding S. sanctipauli as one of the species found. Assessment of potential onchocerciasis vectors and their infection levels through capture and dissection of adult flies is an advantageous and noninsidious means for assessing the need for and success of various control measures [15]. It does therefore serve the purpose of monitoring levels and magnitudes of parasite transmission [16]. Fly infectivity rates vary with location. It is recognized that different cytospecies of the S. damnosum complex living in different biotypes may carry different quantities and strains of Onchocerca volvulus [17] [18]. The Nigerian Federal Ministry of Health through the National Onchocerciasis Control Programme (NOCP) have continued the assessment of onchocerciasis burden and frequency. Elimination of the disease as a public health problem via annual distribution of ivermectin to communities with high incidences was the sole purpose for establishing the NOCP. Its advent has remained a significant stimulus to research into the epidemiology and transmission of onchocerciasis in Nigeria [19] [20] [21] [22] [23] [24] [25] [16]. Onchocerciasis is indeed a disease of serious public health significance in Nigeria. A recent and comprehensive data of all communities with ongoing onchocerciasis transmission in Enugu State, and the nation at large is not available. However it is necessary for monitoring the effectiveness of control efforts and successes especially that by the NOCP. The objective of this study therefore is to update this information and to supplement this paucity of data with entomological observations made during the study period. This study therefore was designed to determine the role of vector black flies in the transmission of onchocerciasis in Ahani-Achi, identify the principal vectors groups of the disease in the study area and to evaluate the relative abundance of black fly vectors and the various transmission indices.&#xD;
&#xD;
MATERIALS AND METHOD&#xD;
&#xD;
Study area&#xD;
&#xD;
The study was conducted in Ahani community (Lat 060 37&#x2019; N, Long 070 52&#x2019; E) of Achi town, Oji-River Local Government Area of Enugu State, Nigeria. This is an onchocerciasis meso-endemic community located along the Oji River basin [26]. It has an estimated population of 5,000 people according to the 2006 national census and comprises mainly of farmers, civil servants and petty business men and women. The community has two health facilities which include a Primary Health Care center and a private clinic. There are two seasons in the community namely: wet season (April to November) and dry season (December to March). The annual mean rainfall ranges between 1520-2030mm and the mean monthly temperature varies between 22.40 C and 30.8&#xB0;C [27], characteristic of a tropical rainforest area. Oji River is a relatively large river, covered by dense forest and supplied with very minimal sunlight particularly so around the collection sites for this study. The study area is approximately 45 km from Enugu, capital of Enugu State and it is a semi-urban settlement. All adult fly samples collected for the purpose of this study were taken to the laboratory for identification and dissection. At about one week before the commencement of the study, an advocacy visit was made to the study community, and the health facility in the community. This avenue was used to sensitize these stakeholders. For reasons of assessibility of the breeding sites during the main rains, the study was carried out during the late rains of October-November 2011 (representing the rainy season), and January-February, 2012 (representing dry season).&#xD;
&#xD;
Collection of man-biting adult black flies&#xD;
&#xD;
Adult flies were collected along the banks of the Oji River basin at the designated community. Collection tubes were used for this purpose. Two consented and trained fly collectors were used for the human landing collection of adult black flies between 6:00 and 18:00 hours GMT. Transmission parameters were determined from data generated from the fly catches. The collectors were dressed in knickers or trousers folded to the knee level to expose the legs. They were very vigilant enough as to see and capture the black flies before they could bloodfeed.&#xD;
&#xD;
Morphological identification &#xD;
&#xD;
Morphological identifications of adult female flies were carried out in a small field laboratory using dissecting microscope, and according to the morphological identification keys of [28]. Adult black flies were identified morphologically as savanna or forest species on the basis of&#xA0;the colour of the 9th abdominal tergite setae, antennae, fore-coxae, scutella setae, wing arculus, and wing tufts. Those with pale wing tuft and pale procoxa were considered as savanna flies, those with pale or dark wing tuft and dark procoxa were considered as forest flies. Simulium damnosum s.s and S. sirbanum are considered savanna while other members of the complex were considered forest species.&#xD;
&#xD;
Dissection of adult flies&#xD;
&#xD;
The flies collected were dissected after having been identified as savanna or forest species. The dissection was carried out under a drop of physiological saline to prevent drying up and for easy visibility of the internal organs. All adult female flies collected were anaesthetized with chloroform to immobilize them before dissection. The flies were placed dorso-ventrally on a microscope slide containing a drop of physiological saline and dissection was carried out beginning from the posterio-ventral end of the abdomen to assess the ovaries and other internal organs for parity testing. Flies were recorded as parous or nulliparous indicating that they had, or had not taken at least one blood meal and had, or had not completed at least one gonotrophic cycle. Nulliparous flies had smaller and more compact ovaries, tightly coiled ovary tracheal systems, absence of follicular relics, and absence of retained eggs as well as dark and unbroken malpighian tubules. Parous flies had larger and more flaccid ovaries which are less elastic, loosely stretched ovary tracheal system, follicular relics are present below the maturing oocytes. They also had broken malpighian tubules which progressively have the appearance of a pale colour, and may contain retained eggs [29] [30]. All parous flies were further dissected minutely to detect the presence of O. volvulus larvae. The number of sausage-shaped larvae (L1 ), pre-infective (L2 ) and infective (L3 ) of Onchocerca species found in the abdomen, thorax and head, respectively were counted and their stages of development at these sites recorded.&#xD;
&#xD;
Entomological indices&#xD;
&#xD;
The fly density and level of transmission of onchocerciasis were quantified using two entomological indices, the monthly biting rates and transmission potentials. The monthly biting rates (MBR) were measured as the theoretical black fly bites received by a person stationed at a catching site during the twelve hours of the daylight for one complete month in a given community. The monthly transmission potential (MTP) was established as the total number of infective larvae (third stage larvae found in these black flies) that would be received in one month by an individual stationed at a capture point for 12 hours of the daylight.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
RESULTS&#xD;
&#xD;
Relative abundance of adult female black flies A total of 836 adult female flies were collected in the study community during the entire study period. The highest number of flies (271) was caught during the month of October while February recorded the lowest number of 171 flies. A comparison of relative abundance of black flies caught during the entire study period showed that there was no significant difference between the monthly collections (P &gt; 0.05). Table 1 shows the Summary of transmission indices of S. damnosum in the four collection months. In both rainy and dry seasons, the percentage monthly black fly parity rates remained high throughout the study. In each case, parity was above 50 %.&#xD;
&#xD;
Diurnal biting rate &#xD;
&#xD;
Hourly variations in diurnal pattern of fly biting activities were observed across the study period. In general, the fly biting activities showed a characteristic bimodal pattern, with morning and evening peaks. However, during unsteady weather conditions, there were other irregular and smaller peaks observed during the late mornings and early afternoons. The diurnal biting activities of S. damnosum in the study community is shown in Figure 1. The month of October had three peaks of biting activities at 09:00, 11:00 GMT and 16:00 GMT; November had two peaks at between 10:00 - 11:00 and 17:00 GMT; January had another three peaks at 10:00, 13:00 and 17:00 GMT. Fly biting activities for February peaked at 11:00 and 17:00 GMT. The lowest number of flies was collected during the hour of 7:00 while the highest was collected during the hours of 16:00 and 17:00 GMT. The diurnal biting activities of black flies between the months were significantly different from each other (P &lt; 0.01). The total number caught by 6:00 GMT was significantly different from all other hours except 8:00 and 14:00 GMT. There were also differences between the other hours of collection.&#xD;
&#xD;
Monthly biting rates &#xD;
&#xD;
The monthly biting rates (MBR) of black flies in the study community were estimated for each month during&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
the study period as shown in Figure 2. Throughout this period, the month of October recorded the highest MBR of 2032.5 bites/person/month while the lowest MBR of 1197 bites/person/month was recorded in February. A comparison of the monthly biting rates showed that there was a significant difference between October and February MBRs (P &lt; 0.01). October had a significantly higher MBR than February. However, there was no significant difference in biting rates between the other months using LSD mean separation technique.&#xD;
&#xD;
&#xD;
&#xD;
Monthly Transmission Potential (MTP)&#xD;
&#xD;
All the 836 flies collected for the purpose of this study were dissected to assess the O. volvulus infection rate. Out of the total flies dissected, only 2 flies were infected with first and second larval stages of O. volvulus, all in the month of October. One of these flies had 2 L1 larvae in the abdomen and 1 L2 larva in the thoracic region while the other only had 1 L2 larva in the thorax. These represent 0.7 % of the total catches for that month. No infective fly (flies with L3 larvae) was found throughout the studies (See table 1). The monthly transmission potentials for the four months were zero.&#xD;
&#xD;
Morphological Identification of Adult Black&#xD;
&#xD;
Flies The result of morphological identification showed that all flies collected were of the forest origin, characterized by dark colour of the 9th abdominal tergite setae, antennae, fore-coxae, scutella setae, wing arculus, and wing tufts. However, there were variations observed in the colour of the wing tuft. Some flies had pale wing tufts while the rest of the features were dark.&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
It is usually difficult to estimate the population of adult black flies, but this is needed for any meaningful vector control studies. Abundance indices are therefore generally based on density of females as determined from their landing and biting rates on man [31]. This is usually based on results of human landing catches. This method not only helps in determining population estimates but it is also a tool for monitoring disease transmission. Climatic and hydrological factors are known to affect adult black flies populations resulting in diurnal and sea&#xA0;sonal variations in fly populations [32] [33]. The density and distribution of black flies in the study area were found to be influenced by the presence and number of breeding sites, vegetation and other supports for larval and pupal attachment. There were also variations in the relative abundance of flies caught during different months of the study. The higher fly numbers observed during the month of October may be attributable to some physical parameters of the breeding sites such as water levels, pH values, water speed, availability of suitable rapids which created the necessary environment needed for development and survival of the aquatic stages of members of the S. damnosum complex, among other reasons. The observed relationship between biting rates and water levels of breeding sites in the study area were similar to those observed by [34]. As the dry season approached, there were observed reductions in water level and suitable rapids for breeding of vectors and these may have contributed to observed relative abundance of black flies especially in February. In this study, diurnal fly biting activities observed did agree with the bimodal biting activity reported by [35] and [20]. The month of January however showed a trimodal biting pattern and this is consistent with another report by [36]. These differences could be due to illumination factors, temperature, humidity or other climatic factors. Two findings, one from Guatemala and the other from Jos plateau in Nigeria agree that these factors indeed influence fly biting activities[37] [38]. Diurnal fly activities peaked in the morning between 9:00 and 10:00 GMT and in the evening between 15:00 and 17:00 GMT. These are periods of daylight for host seeking activities of black fly vectors in the community, coinciding with working habits of the people in the community, who are predominantly farmers, working usually close to the Oji River. They are therefore exposed to high risks of fly bites and infection from black flies. [39] and [40] observed a similar trend in fly activities. The minimum monthly biting rate (MBR) of (1197 bites/ person/month) and the maximum of (2032.5 bites/person/month) black flies observed in this study were all greater than the World Health Organization tolerable value of 1000 bites/person/month for ABR. This goes to indicate the high level of biting nuisance residents of Ahani-Achi community are enduring. Sustained high level nuisance could translate to onchocerciasis transmission should that opportunity present itself. No on-going parasite transmission was observed in this study in the community. There was absence of infective larvae in the head of local black fly vectors. Assessment of fly infectivity rates was used as a tool for determining the level of transmission in the area. It is reassuring and noteworthy that transmission was low as no infective fly was found during the study period. However, there were two cases of non-infective but infected flies. This suggests a possible interruption of onchocerciasis transmission, and yet heightens the need for sustained mass Ivermectin distribution in these areas to achieve local elimination of onchocerciasis. It also serves as a reminder for the necessity for more concerted research efforts to further monitor fly infectivity in the area due to the presence of L1 and L2 larvae in some flies. Such research studies may actually prove further the transmission status of Ahani-Achi community. The remarkably high parity rate of black flies found in this study may further be suggestive of the success of onchocerciasis control efforts. This is because one would expect high transmission in a place with high parity rate as these parous flies may be harboring the infective larval O. volvulus. It also shows that vector populations had access to blood meal, the source of which however wasn&#x2019;t determined, and that they have high enough longevity to reproduce. Areas with high presence of migratory flies in line with the [5] report as well as that of [41] may as well show high parity rate. The WHO mass drug administration with Ivermectin has been a great boost to onchocerciasis control in Africa and the South and Central Americas [42]. For close to 25 years now, Ahani-Achi community has benefited immensely from this initiative through the Community Directed Treatment with Ivermectin (CDTI) [43]. As a good microfilaricide, the drug when administered clears approximately all the juvenile causative parasite. Ivermectin is administered annually in most parts of Nigeria where it is believed that adult female worms do not regain fully their maximum reproductive potential until about one year after treatment with ivermectin. With this treatment having lasted for close to two decades now in the study site, one will expect a significant decrease if not elimination of onchocerciasis in the area over time. There is a direct relationship between the presence and number of microfilariae on the subcutaneous tissues of the human host and parasite transmission by vector black flies. This is most likely an important factor that contributed to the low transmission status reported by the present study as vector black flies could not readily pick up microfilariae - infective stage of Onchocerca volvulus to the black flies, which eventually develop to the infective L3 stage to man. Onchocerca volvulus and Onchocerca ochengi can be co-endemic and both species cannot reliably be distinguished based on morphology alone. They are also vectored by the same black fly species. Interestingly however, no report of the co-endemicity of this two species has been documented in Ahani-Achi. The presence in this study of only members of the forest species of black flies is a good indicator of the strain of the parasite O. volvulus in that area and hence the form of onchocerciasis, recognizing strain differences in the parasite transmitted by local black fly species in West Africa. This, together with the forested nature of the study area, suggests that cutaneous (mild) onchocerciasis may&#xA0;&#xA0;be dominant in the area. Evidences were also found in some of the symptoms observed as well as reported during the course of this study. The presence of dark ninth abdominal tergite setae in all samples examined may be pointing towards S. yahense since the characteristics of the breeding sites here is not quite different from that known already for this species [14]. Again, the presence of flies with pale wing tuft may possibly be suggestive of S. squamosum as this species has been reported to occur in large rivers in the Eastern Nigeria [29], a region of Nigeria corresponding to the area of this study. Wing tufts however are somewhat less reliable feature for morphological identification (personal observation) because of variability tendencies from environmental effects. CONCLUSION The findings of this study signify that the forest black fly species are the major vectors of onchocerciasis in Ahani-Achi. Transmission in the area is reduced since the area had been mesoendemic to onchocerciasis [26] [44]. Presence however of non-infective larval stages of the causative parasite in some flies though not the infective stages, signifies the possibility of transmission. We have provided here a current baseline information on biting activities of the vectors in the area as well as the present nature of onchocerciasis transmission.&#xD;
&#xD;
COMPETING INTEREST&#xD;
&#xD;
The authors hereby declare that they do not have any competing interest associated with this paper&#xD;
&#xD;
ACKNOWLEDGEMENT&#xD;
&#xD;
The authors would like to thank all who contributed to the success of this work for their valuable comments and suggestions to improve the quality of the paper. Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=613</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=613</Fulltext></URLs><References>1. Burnham, G. M. D. Onchocerciasis. The Lancet 1998, 351(9112): 1341&#x2013;1346.&#xD;
&#xD;
2. WHO. Onchocerciasis (River blindness), WHO information fact sheets 2002.&#xD;
&#xD;
3. Basanez M-G, Pion SDS, Churcher TS. River blindness: a success story under threat? PLoS Medical journal 2006, 3: 1454&#x2013;60.&#xD;
&#xD;
4. Post RJ, Onyenwe E, Somiari SAE, Mafuyai HB, Crainey JL, Ubachukwu PO. A guide to the Simulium damnosum complex (Diptera: Simuliidae) in Nigeria, with a cytotaxonomic key for the identification of the sibling species. Annals of Tropical Medicine &amp; Parasitology 2011, 105(4): 277&#x2013;297.&#xD;
&#xD;
5. Report of a WHO Expert Committee on Onchocerciasis Control. WHO Technical Report Series WHO, Geneva 1995, p 852.&#xD;
&#xD;
6. WHO. Epidemiology of onchocerciasis. Report of WHO Expert Committee. Technical Report Series, No 752 Geneva 1987, 1 pp.&#xD;
&#xD;
7. Dunbar RW, Vajime CG. The Simulium (Edwardsellum) damnosum complex. A report of cytotaxonomic studies to April 1972. WHO mimeographed document WHO/ONCHO/72.100 1972, p 10&#x2013;23.&#xD;
&#xD;
8. Vajime CG, Dunbar RW. Chromosomal identification of eight species of the subgenus Edwardsellum near and including Simulium (Edwardsellum) damnosum Theobald (Diptera: Simuliidae). Tropenmedizin and Parasitologie 1975, 26: 11&#x2013;18.&#xD;
&#xD;
9. Boakye DA. A pictorial guide to the chromosomal identification of members of the Simulium damnosum Theobald complex in West Africa with particular reference to the Onchocerciasis Control Programme area during the decade of 1984-93, following intensive larviciding since 1974. Medical and Veterinary Entomology 1993, 12: 345&#x2013;358.&#xD;
&#xD;
10. Boakye DA, Post RJ, Mosha FW, Surtees DP, Baker RHA. Cytotaxonomic revision of the Simulium sanctipauli subcomplex including the description of two new species within the Simulium damnosum complex in Guinea and surrounding countries. Bulletin of Entomological Research 1993, 83: 171&#x2013;186.&#xD;
&#xD;
11. Vajime CG, Gregory WG. Onchocerciasis: Species complex of vectors and epidemiology. Acta Leidensia 1990, 59: 235- 252.&#xD;
&#xD;
12. Meredith SEO, Cheke RA, Garms R. Variation and distribution of forms of Simulium soubrense and S. sanctipauli in West Africa. Annals of Tropical Medicine and Parasitology 1983, 77: 627&#x2013;640.&#xD;
&#xD;
13. Nwoke BEB, Shiwaku K, Takahashi H. Nigeria onchocerciasis: Epidemiology perspective. The Nigerian Journal of Parasitology 1991, 22(1): 3&#x2013;10.&#xD;
&#xD;
14. Mafuyai HB, Post RJ, Vajime CG, Molyneux DH. Cytotaxonomic identification of the Simulium damnosum complex (Diptera: Simuliidae) from Nigeria. Trop Med Int Health 1996, 1: 779&#x2013;785.&#xD;
&#xD;
15. Ottesen EA, Ramachandran CP. Lymphatic filariasis infection and disease: control strategies. Parasitol Today 1995, 11: 129&#x2013;131.&#xD;
&#xD;
16. Opara KN, Fagbemi BO, Ekwe A, Okenu DMN. Status of forest onchocerciasis in the lower Cross River basin, Nigeria. Entomologic profile after five years of ivermectin intervention. Am J Trop Med Hyg 2005, 73(2): 371&#x2013;376.&#xD;
&#xD;
17. Philippon B. Etude de la Transmission d&#x2019;Onchocerca volvulus (Leuckart, 1893) (Nematoda, Onchocercidae) oar Samarium damnosum Theobald (1903) (Diptera-Simulidae) Afrique Tropicale. Paris: L&#x2019;Office de la RechercheScientifiqueet Technologiqued&#x2019;Outre Mer. Travaux et Documents deL&#x2019;ORSTOM 1977, 62&#x2013;64.&#xD;
&#xD;
18. Leveque C, Hougard JM, Resh V, Statzner B. Freshwater ecology and biodiversity in the tropics: what did we learn from 30 years of onchocerciasis control and the associatedbiomonitoring of west African rivers. Hydrobiologia 2003, 500: 23&#x2013;49.&#xD;
&#xD;
19. Okonkwo P, Akpa A, Ihekwaba A, Nwagbo D, Umeh R, Adibua S, et al. Studies on onchocerciasis in forest &#x2013; Savannah Mosaic areas of Nigeria. Investigation in Gbaragu Oji River. Ann Trop Med Parasitol 1991, 38: 153&#x2013;167.&#xD;
&#xD;
20. Adewale B, Mafe MA, Oyerinde JO. Infectivity and transmission dynamics of Simulium damnosum s.l. around Owena Dam (Ondo State). West Afri J Med 1999, 18(4): 257&#x2013;260.&#xD;
&#xD;
21. Nwoke BEB, Dozie INS. Operational research and its success in onchocerciasis control in Nigeria. Nigeria Journal of Parasitology 2001, 22: 3&#x2013;10.&#xD;
&#xD;
22. Ubachukwu PO, Anya AO. Studies on the diurnal biting activity pattern of Simulium damnosum complex (Dipteran: Simuliidae) in Uzo-Uwani local government area of Enugu state, Nigeria. Nigerian Journal of Parasitology 2001, 22163&#x2013;22168.&#xD;
&#xD;
23. Oyibo WA, Fagbenro-Beyioko AF. Effect of repeated community-based ivermectin treatment on the intensity of onchocerciasis in Nigeria. Rural and Remote Health 2003, 3211&#x2013;3216.&#xD;
&#xD;
24. Idowu ET, Adewale B, Mafe MA, Appelt B, Bamgbose A. Endemicity of onchocerciasis in some local government areas of Niger state. African Journal of Medical Sciences 2004, 3331&#x2013;3334.&#xD;
&#xD;
25. Ubachukwu PO. Human onchocerciasis: epidemiological status of Uzo-Uwani local government area of Enugu state, Nigeria. Nigerian Journal of Parasitology 2004, 2593&#x2013;2599.&#xD;
&#xD;
26. Umeh RE, Chijioke CP, Okonkwo PO. Eye disease in an onchocerciasis-endemic area of the forest-savanna mosaic region of Nigeria. Bulletin of the World Health Organization 1996, 74 (1): 95&#x2013;100.&#xD;
&#xD;
27. State Ministry of Health Enugu. Demographic Profile of Enugu State Nigeria 2000.&#xD;
&#xD;
28. Wilson MD, Post RJ, Gomulski LM. Multivirate morphotaxonomy in the identification of adult females of the Simulium damnosum Theobald complex (Diptera: Simuliidae) in the Onchocerciasis Control Programme area of West Africa. Annals of Tropical Medicine and Parasitology 1993, 87: 65&#x2013;82.&#xD;
&#xD;
29. WHO. Vector control series. Simulium. Advanced level training and information guide 1991, WHO/VBC/92.992. 1 pp.&#xD;
&#xD;
30. Lewis DJ. Observations on Simulium damnosum Theobald at Lokoja in Northern Nigeria. Ann Trop Med Parasitol. 1958, 52(2): 216&#x2013;231.&#xD;
&#xD;
31. Crosskey RW. An appraisal of current knowledge of Simulium damnosum S. L. in the Federal Republic of Nigeria in relation to the development of an Onchocerciasis Control Campaign 1979, 1&#x2013;11.&#xD;
&#xD;
32. Crosskey RW Observations on the bionomics of adult Simulium damnosum (Theobald) (Diptera : Simuliiadae) in Northern Nigeria. Ann Trop Med Parasitol 1955, 49: 142&#x2013; 153.&#xD;
&#xD;
33. Crosskey RW The Natural History of Blackflies. Chichester, UK: John Wiley &amp; Sons Ltd 1990, 5&#x2013;26.&#xD;
&#xD;
34. Le Berre R. Contribution &#xE0; l&#x2019; &#xE9;tude biologique et &#xE9;cologique de Simulium damnosum Theobald, 1903 (Diptera Simulate) Memoires. O.R.S.T.O.M Paris 1966, 1pp.&#xD;
&#xD;
35. Okolo CG, Akpa AU, Okonkwo PO. Studies on vectors of onchocerciasis and Simulium species in Achi, Oji River Local Government Area, Enugu State Nigeria. Nig J Ent 2004, 21: 84&#x2013;9&#xD;
&#xD;
36. Adeleke MA, Mafiana CF, Sam-Wobo SO, Olatunde GO, Ekpo UF, Akinwale OP, et al. biting behavior of Simulium damnosum complex and Onchocerca volvulus infection along the Osun River, Southwest Nigeria. Parasite and Vectors 2010, 3: 93&#x2013;99.&#xD;
&#xD;
37. Porter CH, Collins RC. Seasonality of adult black flies and Onchocerca volvulus transmission in Guatamala. Am J Trop Med Hyg 1988, 37: 153&#x2013;167.&#xD;
&#xD;
38. Nwoke BEB. Studies on the field epidemiology of human onchocerciasis on the Jos Plateau, Nigeria. The effects of climatic factors on the diurnal biting behaviour of Simulium damnosum (Theobald) (Diptera: Simuliiadae). Insect Sci Appl 1988, 91: 323&#x2013;328.&#xD;
&#xD;
39. Opara KN, Usip LP, Akpabio EE. Transmission dynamics of onchocerciasixs in rural communities of Akwa Ibom State, Nigeria. Journal of Vector Borne Disease 2008, 45: 225&#x2013;230.&#xD;
&#xD;
40. Renz A. Studies on the dynamics of transmission of onchocerciasis in a Sudan savanna area of North Cameroon III. Infection rate of the simulium vectors and Onchocerca volvulus transmission potentials. Ann Trop Med Parasitol 1987, 81: 239&#x2013;252.&#xD;
&#xD;
41. Henry MC, Meredith SEO. The onchocerciasis focus at Kinsuka/Kinshasa Republic of Zaire in 1985. Entomological aspects. Ann Trop Med Parasitol 1990, 84: 369&#x2013;379.&#xD;
&#xD;
42. WHO. Working to overcome the global impact of neglected tropical diseases: first WHO report on neglected tropical diseases. World Health Organization. Geneva, 2010. Available from: http://www.who.int/neglected_ diseases/2010report/NTD_2010report_ embargoed.pdf&#xD;
&#xD;
43. Onwujekwe EN, Shu EN, Nwagbo D, Akpala CO, Okonkwo PO. Willingness to pay for community-based ivermectin distribution: A study of three onchocerciasis endemic communities in Nigeria. Tropical Medicine and International Health 1998, 3(10): 802&#x2013;808.&#xD;
&#xD;
44. Nwaorgu OC, Ohaegbule A, Onweluzo IE, Alo ET, Nweke LN, Agu ML, et al. Results of a large scale onchocerciasis survey in Enugu State, Nigeria. J Helminthol. 1994, 68: 155&#x2013;159.&#xD;
</References></Article></ArticleSet></xml>
