Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcarePyrimidine Chalcones as Thymidylate Kinase Inhibitors for treating Tuberculosis: A Letter to the Editor
English0101Debarshi Kar MahapatraEnglishEnglishhttp://ijcrr.com/abstract.php?article_id=4060http://ijcrr.com/article_html.php?did=4060Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareCOVID-19 Pandemic Effect on Social Life of Human
English0203Harish Kumar BangaEnglishEnglishIntroduction
The coronavirus (COVID-19) started in Wuhan and has spread quickly over the globe. The World Health Organization has pronounced it to be a pandemic. Without an immunizer, social segregating has climbed as most all things considered got a handle on structure for its parity and control. The mask of social contact in working environments, schools and other open circles is the objective of such measures. Since social contacts have a solid assortative structure in age, the adequacy of these measures is subject to both the age structure of the individuals and the rehash of contacts between age packages over the majority. As these are geographically unequivocal, indistinguishable measures can have clashing results when applied to areas with on a fundamental level varying age and social contact structures. Quantitative appraisals of the effect of these measures in reducing foreboding, top contamination rates, and wealth mortality can be a colossal guide when everything is said in done flourishing engineering. This requires consistent models of sickness transmission that settle age and social contact structures. Other than its focusing concerning effects concerning ethnic life, the fresh pressure about coronavirus (COVID-19) may among an overall experience stoppage the Chinaman economy simply as much the common economy. China has end up the interior gathering area motive concerning various typical commercial enterprise exercises. Any unsettling affect about China's propagate is required in accordance with hold repercussions some other place via partial yet overall cost chains. The continual issues associated according to the extent over Covid-19 pollutions have celebrated specific methods by who the length about the illness is shortened and thwarted. permanency. These consolidate social isolating, washing hands a great part of the time with chemical and water or cleaning these with a hand sanitizer, usage of face covers by the people who have signs or are at serious risk, and avoidance of reaching face, nose, eyes with hands. Social isolating moreover fuses separate home or hospital and self disconnect and keeping up a key good ways from gigantic parties, working from home and similar systems.
The situation varies greatly from US. In many nations, the range of instances remains much less than ten. Some countries have declining epidemics, with no reported case in weeks. Of all of the cases stated globally, an enormous majority are from a handful of countries. The outbreak in Europe is accelerating. Countries which have taken competitive measures to incorporate the virus, consisting of China, Singapore and the Republic of Korea, have had achievements. Evidence indicates that COVID-19 can be contained. As of March 31, 2020, the South-East Asian Region has confirmed four, 215 instances and 166 deaths from 10 countries. The Asian international locations affected by Covid 19 maximum. We expect the quantity of instances and deaths to upward push within the coming weeks. All nations should be ready to aggressively include the virus and have to be organized for all scenarios, inclusive of network transmission. Our information of this virus is developing. The World Health Organization (WHO)-China Mission made numerous key findings. The great majority of instances in China arose from near contacts of symptomatic instances. Between one and five according to cent of close contacts evolved COVID-19.
A pandemic intensifies and increases every current disparity. These imbalances thusly shape who is influenced, the seriousness of that sway, and our endeavors at recuperation. The COVID-19 pandemic its social and financial effects have made a worldwide emergency unmatched throughout the entire existence of the United Nations and one which requires an entire of-society reaction to coordinate its sheer scale and multifaceted nature. However, this reaction, regardless of whether at the national or universal level, will be fundamentally debilitated in the event that it doesn't factor in the manners by which imbalances have made us all progressively defenseless against the effects of the emergency. Or on the other hand, in the event that we decide to just rehash past approaches and neglect to utilize this second to remake increasingly rise to, comprehensive and versatile social orders. Rather, every COVID-19 reaction plan, and each recuperation bundle and planning of assets, needs to address the sexual orientation effects of this pandemic.
Patients along suspected COVID-19, afterward triage at the reason of first medicinal purposes contact, be able stay overseen at domestic agreement grant a sweet stuff sickness, yet even is no worry regarding rapid weakening. Patients be able remain overseen interestingly together with oral paracetamol. Such sufferers need to stand put on among a very an awful lot ventilated odd room, with theirs trends confined intestinal the residence yet their frequent house limited.
While our evaluation bases at the tight financial fee with capacity COVID 19 pandemic and the extra broad social cost of such misplaced lifestyles must no longer be unnoticed. The coronavirus is upsetting human's lives, even earlier than its effect is simply felt on a gadget; fear; setting away of sustenance and scientific matters, and so on. We would like to see a in addition pass to virtual specific picks. In China, online vehicle bargains went up in the chief extended lengths of the crisis, paying little heed to all things considered vehicle bargains pummeling. We moreover watch various master social affairs and presentations proceeding onward the web; likewise a similar number of show corridors have started to make an online experience by making virtual rooms where craftsmanship is being showed up. Alibaba is masterminding no-meeting appears, where they live-stream new substance. It is fundamental to brace biomedical research, improve human administrations transport system, develop an enduring 'watch hound' body and make an improved correspondence and coordination segment for the various associations at risk for calming the more broad adversarial consequences of pandemics. This will require national undertakings just as an arranged overall response through worldwide workplaces and progression associates. This is a wonderful crisis and it presents remarkable threats to the rights and prosperity and progression of the world's youths. Those risks must be directed through incredible overall solidarity for children and mankind. We have to participate to make strides on these three fronts information, solidarity and action. We get a chance to defeat this pandemic, yet to change the way wherein we backing and put assets into the energetic age. Nevertheless, we have to act now, we have to act convincingly, and at very huge degree. This is positively not a persistent issue, it is a clarion require the world's youths, the world's future
Englishhttp://ijcrr.com/abstract.php?article_id=4061http://ijcrr.com/article_html.php?did=4061
M. B. Araujo, and N. Babak, "Spread of SARS-CoV-2 coronavirus likely to be constrained by climate." medRxiv, pp. 1-26, 2020.
R. Tosepu, J. Gunawan, D. S. Effendy, H. Lestari, H. Bahar, H. and P. Asfian, “Correlation between weather and Covid-19 pandemic in Jakarta, Indonesia”, Science of The Total Environment, pp.138436, 2020.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareEffect of Carbon Dioxide Fractional Laser on the Levels of Regulated Upon Activation Normal T-Cell Expressed and Secretedserum Chemokines and Vitiligo Clinical Scoring in Stable Non-Segmental Vitiligo: A Case-Control Study
English0409Shokeir HAEnglish Soliman MMEnglish Emam HMEnglish Abdel Latif YEnglish Abou Zeid OOEnglishIntroduction: Vitiligo is an acquired disorder that is recurrent with certain chemokines that were found to play a significant role in its complex pathology. Objective: This study aimed to evaluate carbon dioxide (CO2 )fractional laser efficacy on serum RANTES (regulated upon activation, normal T-cell expressed and secreted) and clinical scoring in vitiligo patients. Case Report: Sixty participants, selected from Kasr Al-Ainy teaching hospital dermatology outpatient clinic, Cairo University from August 2017 till March 2019 were assigned into a control group (A), including 30 age and gender-matched healthy volunteers and a study group (B) including 30 adult stable non-segmental vitiligo patients. All participants in group (A) were exposed to daily sunlight for 3 months, while patients in group (B) received 3 CO2 fractional laser monthly sessions with a wavelength of 10600nm along with sunlight exposure starting on the 5th day after every session for 3 months. Assessment of serum RANTES in all participants was done before and after interventions in both groups and vitiligo area severity index (VASI) score was taken before and after the intervention in all patients of the group (B). Discussion of Results: There was a significant difference (p < .001) in the serum RANTES levels when comparing pre to post-study results in the patients ‘group, while there was no significant difference (p = .72) in serum RANTES levels when comparing pre to post-study results in the control group. For the VASI score, there was a significant difference (p < .001) in scores when comparing pre to post-study results in the patients ‘group. Conclusion: Adding fractional CO2 laser to sun exposure surpasses sun exposure alone in improving stable non-segmental vitiligo patients’ outcomes.
EnglishVitiligo, RANTES, CO2 Laser, sunlight, Laser Ablation, Patient-Relevant OutcomeINTRODUCTION
Vitiligo is known as the most prevalent multi- dimensional depigmenting disorder that represents a global incidence of 0.8% reaching up to 8%, specially recorded in African females.1,2Being a visible skin condition, vitiligo could be a source of great psychological distress as it limits social interactions, resulting in affected quality of life and increased liability for more serious psychiatric disorders. However, it does not reflect a life-threatening case causing the case to be underestimated.3
Vitiligo has a complex aetiology where a variety of underlying genetic, autoimmune, autotoxicity, neural and environmental theories lead eventually to melanocytes’ destruction causing vitiligo in inherently susceptible persons.4
The hallmark of the pathogenesis is the oxidative stress produced that affects defected melanocytes causing them to release reactive oxygen species and chemokines especially, chemokine ligand 5 (CCL5) or regulated upon activation, normal T-cell expressed and secreted (RANTES), leading to a vast imbalance between pro-oxidants and antioxidants, which compromises cell functioning.1,5
As vitiligo is a multifaceted disorder, its management remains a challenge with the available options being inconclusive. The first treatment line, aside from topical ointments and oral medication, is phototherapy, a relatively effective but with a high rate of patient’s dissatisfaction.6
That fact raises the need for more efficient alternatives as laser therapy. Carbon dioxide (CO2) lasers are commonly known to be effective in managing some cutaneous lesions, mild scars, and photoaging.7 Treatment using fractional CO2involves dividing the single beam of laser into multiple microbeams, producing microscopic ablative zones encircled by normal intact skin, thus it gives the same benefits as a full ablative treatment but with fewer side effects. Skin normally contains an elevated percentage of water, making CO2 laser perfect for accurate and safe ablation in the dermatology field, as its energy is highly absorbed in water.8 Fractional CO2 laser has demonstrated better efficiency in treating vitiligo, especially stable non- segmental form when combining with conventional treatments than when using the latter alone.9
Nevertheless, there is a scarcity of research regarding the effect of fractional treatment using CO2 laser on serum RANTES levels and clinical vitiligo outcomes. Thus, the present study aimed to evaluate the efficacy of CO2 laser on serum RANTES levels and clinical outcomes in stable non-segmental vitiligo patients.
MATERIALS AND METHODS:
The present study was designed as a non-randomized, comparative study, using a non-probability, consecutive, sampling technique for recruiting participants. The trial was conducted at Kasr Al-Ainy teaching hospital dermatology outpatient clinic, Cairo University, including 60 participants equally assigned into two groups from August 2017 till March 2019. Thirty age and gender-matched healthy volunteers were included as a control group (A), while thirty vitiligo patients have been included in the group (B) when they met the eligibility criteria of having stable non-segmental vitiligo, with stable refractory lesions and no response to conventional treatments. Pregnant, breastfeeding women, individuals with an active infection, or other autoimmune diseases were excluded. A total of 60 participants was determined using Stats Direct statistical software version 2.7.2 for MS (Windows, Stats Direct Ltd., Cheshire, UK), and the effect size was obtained from Yang et al.10
Ethical approval was obtained from the local ethics and research committee of Dermatology, Venereology and Andrology Department, of the National Research Centre. The study ran in concordance with the Declaration of Helsinki principles and other ethical guidelines and written informed consent was taken from every participant before the study enrollment.
All healthy participants in the control group (A) were exposed to sunlight daily for three months, whereas vitiligo patients in the study group (B) received three sessions of CO2 fractional laser therapy (Microxel MX7000, Daeshin Enterprise, , Korea), with a wavelength of 10600nm, the power output of 15 Watts, 1 millisecond as pulse width, 0.5 density and 15 mJ energy/point, at a monthly basis, together with sun exposure to the affected areas starting at the 5th day after each session, with the intact areas protected by sunscreen. Before the laser session, each patient applied topical anaesthetic on the areas to be treated for pain reduction. For ocular safety, laser-protective goggles were required for both the patients and the operator.
For the procedure of data collection and before starting the interventions, demographic characteristics, and serum RANTES level of every participant in both groups, clinical types and/or patterns of vitiligo as well as Vitiligo Area Severity Index (VASI) were attained from every patient in the group (B). Assessment of both RANTES and VASI was repeated after three months for all participants of both groups and the patients’ group, respectively.
Measuring serum RANTES in all participants was done using enzyme-linked immunosorbent assay (ELISA) technique based on the manufacturer’s guidelines,11 through a kit supplied by Glory Science Co., Ltd, Del Rio, TX 78840, USA, in the medical Biochemistry department in the National Research Center. To detect serum RANTES level, venous serum samples of 3-5 cc were withdrawn from the anti-cubital fossa of each participant and were left to clot for 30 minutes at room temperature, then the samples were subjected to centrifugation for 10 minutes at 5000 rotation per minute (rpm). The supernatant serum was separated in Eppendorf tubes and stored at -80°c till the tie of analysis. Repeated freeze and thaw cycles were avoided.
To evaluate clinical vitiligo patients’ outcomes, VASI was selected as it is a well-defined performance metric used to detect the level of depigmentation and can be relied on as an indicator of disease incidence and patient management.12 The patient’s body is divided into five distinctive regions, while the face and neck are independently examined. VASI is determined for each body region according to the vitiligo area in the hand units (the palm plus the volar digit surface) and the depigmentation pattern within each hand-unit patch (no pigment=100%, specks of pigment=90%, vitiligo> pigment=75%, vitiligo=pigment=50%, vitiligo< pigment=25%, specks of vitiligo=10%). The whole body VASI score is then calculated using a specific formula.13
Data entry, processing, and statistical analysis were carried out using Microsoft Excel 2007 (Microsoft Corporation, NY, USA) and SPSS (Statistical Package for the Social Science; SPSS Inc., Chicago, IL, USA) version 22 for Microsoft Windows. Quantitative data were described in terms of mean ±standard deviation (±SD), while qualitative data were expressed as frequencies (number of cases) and relative frequencies (percentages). Comparison of numerical variables between the two groups was done using the Mann Whitney U test for independent samples when comparing the two groups of non-normal data. Correlation between various variables was done using the Spearman rank correlation equation. A probability value (p-value ≤ 0.05) was considered statistically significant.
RESULTS:
In the present study, 30 patients with vitiligo and 30 age and sex-matched controls were included. As shown in table 1of the participants’ demographic data, the mean age of the patients and the controls were 33.3 ±14.3 36 and 31.96 ±12.21 years, respectively, with 60% of patients were females. Almost 33% of the patients had a positive family history. There were no statistically significant differences between the patients’ group and the control group in terms of age (p=.75) and gender (p =.81). On contrary, there was a statistically significant difference between the patients’ group and the control group in terms of family history (pEnglishhttp://ijcrr.com/abstract.php?article_id=4062http://ijcrr.com/article_html.php?did=4062
Bergqvist C, Ezzedine K. Vitiligo: a focus on pathogenesis and its therapeutic implications. J Dermatol. 2021; 48(3): 252-70. doi:10.1111/1346-8138.15743
Zhang Y, Cai Y, Shi M, Jiang S, Cui S, Wu Y, et al.The prevalence of vitiligo: a meta-analysis. PLoS One. 2016; 11(9): e0163806.doi:10.1371/journal.pone.0163806
Bhandarkar SS, Kundu RV. Quality-of-life issues in vitiligo. Dermatol Clin. 2012; 30(2): 255-68. doi: 10.1016/j.det.2011.11.013.
Kundu RV, Mhlaba JM, Rangel SM, Le Poole IC. The convergence theory for vitiligo: a reappraisal. Exp Dermatol. 2019; 28(6): 647-55. doi: 10.1111/exd.13677
Said-Fernandez SL, Sanchez-Domínguez CN, Salinas-Santander MA, Martinez-Rodriguez HG, Kubelis-Lopez DE, Zapata-Salazar NA, et al. Novel immunological and genetic factors associated with vitiligo: a review. Exp Ther Med. 2021; 21(4): 312. doi:10.3892/etm.2021.9743
Kandaswamy S, Akhtar N, Ravindran S, Prabhu S, Shenoi SD. Phototherapy in vitiligo: assessing the compliance, response and patient's perception about disease and treatment. Indian J Dermatol. 2013; 58(4): 325. doi: 10.4103/0019-5154.113944
Yasmeen S, Khan T. Laser Carbon Dioxide Resurfacing. [Updated 2020 Aug 15]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2021.
Omi T, Numano K. The role of the CO2 laser and fractional co2 laser in dermatology. Laser Ther. 2014; 23(1): 49-60. doi: 10.5978/islsm.14-RE-01
Kim WI, Kim S, Lee SH, Cho MK. The efficacy of fractional carbon dioxide laser combined with narrow-band ultraviolet B phototherapy for non-segmental vitiligo: a systematic review and meta-analysis. Lasers Med Sci. 2021; 36(1): 165-73. doi: 10.1007/s10103-020-03069-0.
Yang L, Yang S, Lei J, Hu W, Chen R, Lin F, et al. Role of chemokines and the corresponding receptors in vitiligo: a pilot study. J Dermatol. 2018; 45(1): 31-8. doi: 10.1111/1346-8138.14004
Locati M, Bonecchi R, Corsi MM. Chemokines and their receptors: roles in specific clinical conditions and measurement in the clinical laboratory. Am J Clin Pathol. 2005; 123 (1): S82-95. doi: 10.1309/M6U4B8L6TNAK4G9L.
Vrijman C, Linthorst Homan MW, Limpens J, van der Veen W, Wolkerstorfer A, Terwee CB, et al. Measurement properties of outcome measures for vitiligo: a systematic review. Arch Dermatol. 2012; 148(11): 1302-9. doi: 10.1001/archdermatol.2012.3065.
Hamzavi I, Jain H, McLean D, Shapiro J, Zeng H, Lui H. Parametric modelling of narrowband UVB phototherapy for vitiligo using a novel quantitative tool: the vitiligo area scoring index. Arch Dermatol. 2004; 140(6): 677-83. doi: 10.1001/archderm.140.6.677.
El-Zawahry MB, Zaki NS, Wissa MY, Saleh MA. Effect of combination of fractional CO2 laser and narrow-band ultraviolet B versus narrow-band ultraviolet B in the treatment of non-segmental vitiligo. Lasers Med Sci. 2017; 32(9): 1953-8. doi: 10.1007/s10103-017-2290-y
Shin J, Lee JS, Hann SK, Oh SH. Combination treatment by 10 600 nm ablative fractional carbon dioxide laser and narrowband ultraviolet B in refractory nonsegmental vitiligo: a prospective, randomized half-body comparative study. Br J Dermatol. 2012; 166(3): 658-61. doi: 10.1111/j.1365-2133.2011.10723.x.
Ghasemloo S, Gauthier Y, Ghalamkarpour F. Evaluation of using fractional CO2 laser plus NB-UVB versus NB-UVB alone in inducing marginal repigmentation of vitiligo lesions. J Dermatolo Treat. 2019; 30(7): 697-700. 10.1080/09546634.2018.1564232
Liu L, Wu Y, Zhang J, Gu H, Luan Q, Qian L, et al. Ablative fractional Co2 laser aided delivery of long-acting glucocorticoid in the treatment of acral vitiligo: a multicenter, prospective, self-bilateral controlled study. J Dermatolog Treat. 2019; 30(4): 320-7. doi: 10.1080/09546634.2018.1509048.
Doghaim NN, Gheida SF, El-Tatawy RA, Mohammed Ali DA. Combination of fractional carbon dioxide laser with narrowband ultraviolet B to induce repigmentation in stable vitiligo: a comparative study. J Cosmet Dermatol. 2019; 18(1): 142-9. doi: 10.1111/jocd.12553
E?me P, Gür Aksoy G, Elçin G. No additional benefit of combining fractional carbon dioxide laser with narrow-band ultraviolet b phototherapy for vitiligo: a randomized prospective study with half-body side comparison. Dermatol Surg. 2019; 45(12): 1627-34. doi: 10.1097/DSS.0000000000001890.
Helou J, Maatouk I, Obeid G, Moutran R, Stéphan F, Tomb R. Fractional laser for vitiligo treated by 10,600 nm ablative fractional carbon dioxide laser followed by sun exposure. Lasers Surg Med. 2014; 46(6): 443-8. doi: 10.1002/lsm.22260
De Oliveira HA, Antonio EL, Arsa G, Santana ET, Silva FA, Júnior DA, et al. Photobiomodulation leads to reduced oxidative stress in rats submitted to high-intensity resistive exercise. Oxid Med Cell Longev. 2018; 2018: 5763256. doi: 10.1155/2018/5763256.
Chen W, Zhou Y, Huang FR, Luo D, Wang DG. Preliminary study on the treatment of vitiligo with carbon dioxide fractional laser together with tacrolimus. Lasers Surg Med. 2018; 50(8): 829-36. doi: 10.1002/lsm.22821
Abu Zeid OM, Omar N, El Sharkawy D. The efficacy of combining fractional CO2 laser and tacrolimus ointment in the treatment of vitiligo. J Egypt Women's Dermatologic Soc. 2020; 17(1): 25-30. doi:10.4103/JEWD.JEWD_41_19
Mahmoud ES, Abd el-baky AM, Said OM, Hussein HG. Low-level diode laser therapy on wound healing post gingivectomy. J Life Sci Biomed. 2020; 10(6): 80-6. doi:10.51145/jlsb.2020.10
Kim HJ, Hong ES, Cho SH, Lee JD, Kim HS. Fractional carbon dioxide laser as an "add-on" treatment for Vitiligo: a meta-analysis with systematic review. Acta Derm Venereol. 2018; 98(2): 180-4. doi: 10.2340/00015555-2836.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareClinician’s Choice of Health Related Quality of Life Index in Maxillectomy Patients with Obturator Prostheses: A Systematic Review
English1015Raut AEnglish Hota SEnglish Bhusan PEnglish Mohanty A KEnglish Padmanaban AEnglishIntroduction: Patients suffering from maxillary defects generally encounter difficulty in mastication, speech and postoperative depression. Such clinical cases can be rehabilitated with reconstructive surgery or obturator prostheses with or without implants to improve the quality of life(QOL). Study Selection: A systematic search of PubMed and web of science databases for articles published before 2020 December was performed by reviewers (reviewed). A manual search of articles published from January 2000 to December 2020 was also conducted. The present study identifies the most preferred QOL assessment index in patients with head and neck cancers who had undergone rehabilitation with obturator prostheses. Result: Most of the studies were cross-sectional and the most preferred HRQOL index used was OFS and UWQOL scale version 4. The result of the study also showed that meaningful quality of life can be achieved in patients who have undergone reconstruction with obturator prosthesis following maxillectomy. The study provides relevant information in selecting HRQOL measures as well as planning future studies and developing treatment protocols. Conclusion: The limited data indicate that fabrication of the obturator prostheses significantly contributes to improved psycho-logical well-being and the quality of life for maxillectomy patients. Well-designed clinical studies are necessary to draw definitive conclusions about how the fabrication of obturator prostheses affects the quality of life of maxillectomy patients.
EnglishHealth-related quality of life, Maxillectomy, Obturator functioning, Mastication, Swallowing, CancerINTRODUCTION
Maxillofacial Prosthetics is the art and science of anatomic, functional or cosmetic reconstruction using non-living substitutes of those regions in the maxilla, mandible, face and even other body parts that are missing or defective because of surgical intervention, trauma, pathology or developmental or congenital malformation.
The WHO defines the quality of life as the individual’s perception of their position in life in the context of the culture and value systems in which they live and concerning their goals, expectations, standards and concerns.2
Maxillary cancer represents a rare form of head and neck malignancy that can have a profound impact on the quality of life. The direct effect of cancer required therapeutic interventions and it can result in significant facial disfigurement as well as functional disability involving both swallowing and speech.4,16
Studies on the quality of life of patients with head and neck cancer have shown high levels of emotional anguish, physical constraints and disturbances in body image and damage in social relations.12 However, studies on changes perceived in quality of life after prosthetic rehabilitation are limited.
Traditionally, obturator prostheses have been used to occlude areas of the palate that have been resected. Reconstruction with obturator prostheses (with or without implants) diminishes difficulties associated with mastication and swallowing and has been shown to result in significant improvement in speech intelligibility and communication performance.16,17
Studies in the literature on quality of life in patients with maxillectomy and rehabilitation with obturators have shown that the correlation between obturator function and quality of life can be influenced by clinical factors, such as type of tumours and stage of disease, the extent of the ablative defect, postoperative radiation therapy, number and condition of remaining maxillary teeth and demographic and other social variables.1,14
Also, there are various types of scales/ indices available to assess the quality of life after prosthetic rehabilitation that increases randomness to draw a significant conclusion.
AIM
The study aims to identify
most frequently used index for assessment of the quality of life with obturator prosthesis in maxillectomy patients and
Factors/determinants that can influence overall QoL.
MATERIALS AND METHOD
A systematic literature review was performed following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) statement. The PRISMA Statement consists of a 27-item checklist and a four-phase flow diagram. The checklist includes items deemed essential for transparent reporting of a systematic review.11
Focused question patient intervention comparison and outcome (PICO format)
The review is focused on:” What is the efficacy of obturator prosthesis on quality of life of maxillectomy patients?”
Search strategy
A MEDLINE electronic search on PubMed from January 2000 to December 2020 was conducted for articles published in the dental literature, and limited to human trials, using the search terms 'maxillofacial prosthesis', 'patient satisfaction, 'palatal obturators', 'positive life evaluation', 'head & neck cancer', 'health-related quality of life, 'maxillary obturator', 'facial prostheses'. (Table 1)
Moreover, a manual search of the following journals was also conducted: Journal of Prosthetic Dentistry, Journal of Oral Maxillofacial Surgery, and the International Journal of Oral and Maxillofacial Surgery, Journal of Plastic, Reconstructive & Aesthetic Surgery, Journal of Archives of Otolaryngology-Head and Neck Surgery, Journal of Head & Neck, Journal of Advanced prosthodontics.
Study exclusion criteria: Duplicate studies, in vitro and in vivo, obtained from the search results, case reports or case series, and studies based on interviews or commentaries were excluded to eliminate bias in the results. Studies of patients other than non-neoplastic origin were also excluded.
Two independent reviewers selected the studies for the systematic reviewing through each phasing of review screening, eligibility criteria and inclusion criteria. The Cohen kappa method was used to calculate inter-reviewer agreement. The selected studies were classified according to the Jadad scale. Studies classified as “low quality” had a score between 0 and 2, and those between 3and 5 were classified as “high quality.”
RESULTS
A total of 15 articles from the electronic and manual search of the PUBMED database were included in the study (Table 1). Out of 15 articles, twelve studies have used the OFS assessment index as it is the most common tool for such a study. The mean age was 55 years. Of the 15 articles, eleven were cross-sectional and four were longitudinal.
Results of the study can be summarized as
No significant correlation between the extent of the defect or maxillary defect classification and QOL or obturator functioning.
No significant correlation between various age groups and QOL.
Maxillectomy patients who receive additional radiation and chemotherapy rate score low on the QOL scale. Otherwise no significant difference between QOL of patients with prosthetic obturator prostheses or free flap reconstruction.
No complications related to obturator prostheses were reported.
The use of dental implants in combination with CAD/CAM results in the best functional outcome and least morbidity.
Further research such as the application of stem cells may help to overcome associated problems of obturator prostheses or free flap reconstruction and improve overall QOL.
DISCUSSION
The systematic review shortlisted a limited number of studies that evaluated the QOL of patients with maxillary defects who underwent prosthetic rehabilitation with obturator prostheses. A direct comparison of the QOL scores was a challenge as most of the studies included were not randomized or double-blind studies. Most of the articles are based on cross-sectional study design tending to adapt to most treatments over time and thus differences among groups may be identified only in a longitudinal study.
UWQOL score
The questionnaire consists of 15 questions. The first 12 domains concern areas of daily living that are often affected by treatment of head and neck cancer, such as pain, disfigurement, activity, recreation and entertainment, chewing, swallowing, speech, shoulder disability, taste, saliva, and 2 new emotional domains of mood and anxiety. To describe current functional status, each domain has a maximum score of 100 points, indicating the highest level of function, and a minimum score of 0, indicating the poorest level of function.
OFS score
The OFS was developed at Memorial Sloan-Kettering Cancer Center as a means of assessing the self-reported functioning of an obturator. TheOFS score gives information about the degree of patient satisfaction and qualitative assessment of obturator prosthesis. The questionnaire is very intelligently framed to give relevant information regarding eating and speech. Dryness of mouth, an effect of radiotherapy on major and possibly minor salivary glands, was included as an item in the scale because poor lubrication of the mouth is a possible contributor to poorer fit or functioning of the prosthesis. Another item, “difficulty talking on the phone,” was added to the scale to assess communication difficulties in the absence of visual cues. The answer to each question is rated in a numerical value from 0 to 100.
Most of the studies used more than one index to measure HRQOL. The most frequently used scale is OFS, however, more studies are needed for establishing the clinical utility of OFS as a screening measure. Different retention mechanisms like the addition of attachments, zygomatic implants and rapid prototyping or CAD/CAM techniques score high on the scale.
Other Variables
Brown et al. attempted a practical classification of maxillectomy defects that describes the defect and indicates the likely functional and aesthetic outcome.8In this study most commonly reported defects were 2A or 2B. Leakage when swallowing food was the most commonly reported problem however adaptation develops to maintain QOL.
Age was considered an influential factor to decide the type of reconstruction by the patient. One study based on the rehabilitation of hemipalato maxillectomy defects using a prosthetic obturator or a vascularized bone containing free flap highlighted the advantage of a permanent tissue closure of the palatal defect to reduce morbidity.5The study revealed young patients prefer surgical closure despite the additional cost and procedure involved. Prosthetic rehabilitation is better when it follows reconstruction. However, no statistically significant differences were seen between obturators and free flap groups. Reconstruction complications are more evident in patients with malignant tumours resulting in relapse, dehiscence of the grafted tissue, fistula development and necrosis.
The quality and quantity of supporting tissue and remaining natural teeth influence the relationship and position of the prosthesis to the implant. A retained implant obturator prosthesis is indicated as long as the supporting bone is adequate for the fixation of implants.
Postoperative radiotherapy negatively influences mean maximal mouth opening. The limited mouth opening profoundly diminishes the quality of life due to the inability of speech, mastication and deglutition. Post radiation trismus compromises the prognosis. Open defects were more compromised because of both radiotherapy and chemotherapy leading to elevated response on the total OFS score which would suggest overall dissatisfaction with the obturator scale.6,10,20,23
Reduced salivation and susceptibility to frequent soft tissue injury and frail nature of oral mucosa following radiation therapy is a significant limiting aspect. The absence of clinically significant xerostomia does not preclude the possibility of dry mouth. Silicone-lined obturators were well anchored and comfortable exhibiting greater efficiency towards QoL. Dryness of mouth is also associated with lower speech intelligibility scores. Another study revealed participants found moist and softer foodstuff easier to masticate; hard and dry foods presented the greatest difficulty. This was attributed to the greater likelihood of reduced salivation post maxillectomies.22
One of the studies added a question specifically related to difficulty talking on the phone in the OFS scale as an adaptation measure.4Poor aeromechanical speech results were associated with patient-reported avoidance of social events, whereas lower speech intelligibility outcomes were related to the overall poorer perception of speech function on the OFS.9
Two studies emphasized specialists emphasizing regular care and follow up visits for obturators as an appropriate treatment option to identify tumour recurrence, discomfort and adaptation failure before treatment failure.12,21
One study claimed that patients who underwent a facial approach reported on lower quality of life than those who underwent a transoral approach. Female patients showed a higher level of depression than male patients, although this did not reach significance.4Also better ratings were found for patients who received a higher level of education.
Implants offer more promising and predictable treatment options by supporting an obturator prosthesis in place and improving mastication and tissue adaptation.24However, limited residual bone after a maxillectomy is a large problem for the implant approach. The use of zygomatic implants with magnets and bar attachments has changed the treatment modality and offered retention force to enhance support and improve the stability of the obturator prosthesis. A treatment approach consisting of multiple zygomatic implants was considered to create a source of vertical resistance and retention. The advent of zygomatic implants has drastically enhanced treatment and potentially revolutionized maxillary reconstruction following extensive ablative tumour resection.3
As the selected articles are suggestive of low quality on the Jadad scale no robust inference can be drawn. The free tissue transfer reconstruction eliminates physiologic distress to the patients and provide excellent management of maxillectomy defects but on the contrary obturator prostheses provide immediate reestablishment of facial morphology and oral functioning. There is a significant improvement in speech, swallowing and overall quality of life with operators under regular follow up period.
Health-related quality of life (HRQOL) is an important outcome parameter following treatment of head and neck cancer. Two national bodies, the British Association of Head and Neck Oncologists and the British Association of Otorhinolaryngologists Head and Neck Surgeons http:/www.bahno.org.uk/bulletin.htm#quality, both recommend that HRQOL should be longitudinally recorded. Questionnaires give a structured insight into the patients’ opinions. They facilitate multidisciplinary teams working with the recognition of poor outcome groups and the opportunity to identify problem areas and target support/intervention.
Limitations of the study:
The most important limitation in the included studies was that there was significant clinical heterogeneity between the studies which makes it difficult to conclude. Statistically, significant improvement cannot be calculated due to the inability to perform the meta-analysis. Prospective, blinded, randomized, multicenter studies with standardized methodology need to be performed. According to the Jadad scale, all selected studies showed low quality. Direct comparison of the results are not possible as in different studies, different tests and scales were used to evaluate the QoL.
Small sample size: As maxillary cancer is a rare tumour with increased mortality small sample sizes are typically found in studies of maxillectomy patients.
Despite intensive research related to the quality of life post-cancer therapy, only a few studies evaluate the quality of life of maxillectomy patients rehabilitated with an obturator.
Because of the low incidence of maxillofacial tumors, it is not possible to organize prospective studies.
CONCLUSION
This systematic review reveals good obturator function is strongly correlated with the improved quality of life. Patients who undergo maxillectomy often enquire about the quality of life post-surgery. The present study data can be used to reassure patients following maxillectomy and prosthetic reconstruction to have an acceptable quality of life. However, the presence of family members, socioeconomic status and valued activities and interests all help people with cancer to overcome functional disability. Stem cell regeneration and advanced future research can modify the approach to obturator prosthesis or free flap reconstruction and will help to improve patients' QoL after maxillectomy in the future. Future research objective also includes the need for meta-analysis.
Acknowledgment: Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.
Source of Funding: self
Conflict of Interest: Nil
Englishhttp://ijcrr.com/abstract.php?article_id=4063http://ijcrr.com/article_html.php?did=40631. Kumar P, Alvi HA, Rao J, Singh BP, Jurel SK, Kumar L, et al. Assessment of the quality of life in maxillectomy patients: A longitudinal study. J Adv Prosthodont. 2013;5:29-35.
2. What quality of life? The WHOQOL Group. World Health Organization Quality of Life Assessment. World Health Forum. 1996;17:354-6.
3. Wang F, Huang W, Zhang C, Sun J, Qu X, Wu Y.Functional outcome and quality of life after a maxillectomy: a comparison between an implant-supported obturator and implant-supported ?xed prostheses in a free vascularized flap.Clin. Oral Impl. Res. 2017 Feb;28(2):137-143.
4. Irish J, Sandhu N, Simpson C, Wood R, Gilbert R, Gullane P, et al. Quality of life in patients with maxillectomy prostheses. Head Neck. 2009;31:813-21.
5. Genden EM, Okay D, Stepp MT, Rezaee RP, Mojica JS, Buchbinder D, et al. Comparison of functional and quality-of-life outcomes in patients with and without palatomaxillary reconstruction: a preliminary report. Arch OtolaryngolHead Neck Surg 2003;129:775-80.
6..Kreeft AM, Krap M, Wismeijer D, Speksnijder CM, Smeele LE, Bosch SD, et al. Oral function after maxillectomy and reconstruction with an obturator. Int J Oral Maxillofac Surg 2012;41:1387-92.
7..Borlase G. Use of obturators in rehabilitation of maxillectomy defects. Ann R AustralasColl Dent Surg. 2000 Oct;15:75-9.
8. Brown JS, Rogers SN, McNally DN, Boyle M. A modified classification for the maxillectomy defect. Head Neck. 2000;22:17-26.
9. Rieger JM, Wolfaardt JF, Jha N, Seikaly H. Maxillary obturators: the relationship between patient satisfaction and speech outcome. Head Neck. 2003;25:895-903.
10. Rogers SN, Lowe D, McNally D, Brown JS, Vaughan ED. Health-related quality of life after maxillectomy: a comparison between prosthetic obturation and free flap. J Oral Maxillofac Surg. 2003;61:174-81.
11 Brandao TB, Filho A, Batista V, Oliveira M, Silva A. Obturator prostheses versus free tissue transfers: A systematic review of the optimal approach to improving the quality of life for patients with maxillary defects. J Prosthet Dent. 2016;115:247-253
12. Goiato MC, Pesqueira AA, Silva CR, Filho HG, Santos DMD. Patient satisfaction with maxillofacial prosthesis. Literature review. JPlas Recons Aes Surg. 2009;62:175-180.
13. Ali MM, Khalifa N, Alhajj MN. Quality of life and problems associated with obturators of patients with maxillectomies. Head Med. 2018 14:2:1-9
14. Seignemartin CP, Miranda ME,Luz JGC,Teixeira RG. Understandability of speech predicts quality of life among maxillectomy patients restored with obturator prosthesis. J Oral Maxillofac Surg 2015;73:2040-2048.
15. Chen C, Ren WH, Huang RZ, Gao L, Hu ZP, Zhang LM, et al.Quality of Life in Patients After Maxillectomy and Placement of Prosthetic Obturator.Int J Prosthodont. Jul-Aug 2016;29(4):363-8.
16. Arigbede AO, Dosumu OO, Shaba OP, Esan TA. Evaluation of speech in patients with partial surgically acquired defects: pre and post prosthetic obturation. J Contemp Dent Pract. 2006;7:89–96.
17. Sullivan M, Gaebler C, Beukelman D, Mahanna G, Marshall J, Lydiatt D et al. Impact of palatal prosthodontic intervention on communication performance of patient’s maxillectomy defects: a multilevel outcome study. Head Neck. 2002;24:530–538.
18. Riaz N, Warriach RA.Quality of life in patients with obturator prostheses. J Ayub Med Coll Abbottabad. Apr-Jun 2010;22(2):121-5.
19. Artopoulo LL, Karademas EC, Papadogeorgakis N, PapathanasiouI, Plyzois G. Effects of sociodemographic, treatment variables and medical characteristics on quality of life of patients with maxillectomy restored with obturator prostheses. J Prosthet Dent. 2017
20. Chigurupati R, Aloor N, Salas R, Schmidt BL. Quality of life after maxillectomy and prosthetic obturator rehabilitation. J Oral Maxillofac Surg. 2013;71:1471-8.
21. Santos DMD, Caxias FP, Bitencourt SB, Turcio KH, Pesqueira AA, Goiato MC. Oral rehabilitation of patients after maxillectomy. A systematic review.Br J Oral Maxillofac Surg. 2017.
22. Ikusika OF, Dosumu OO, Ajayi DM, Ogurinde TJ. Effect of the resilient lining of obturator bulbs on patients with maxillectomies. J Prosthet Dent. 2016 Dec;116(6):932-936.
23. Said M, Otomaru T, Yeerken Y, Taniguchi H. Masticatory function and oral health-related quality of life in patients after partial maxillectomies with closed or open defects. J Prosthet Dent. 2017 Jul;118(1):108-112
24. Buurman DJM, Speksnijder CM, Engelen BHBT, Kessler P Peter Kessler, Masticatory performance and oral health-related quality of life in edentulous maxillectomy patients: A cross-sectional study to compare implant-supported obturators and conventional obturators. Clin Oral Impl Res. 2020;31:405–416.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareLow-level Laser Therapy Versus Pelvic Exercise on Female Pelvic Girdle Pain
English2630Shehata SaadEnglish Sabbour AdleyEnglish Morsy MonaEnglish Hegazy SamyaEnglish El Noury AmrEnglishIntroduction: Girdle pain represents one of the important health issues affecting pregnant women. The exact cause and the prognostic factors of girdle pain are not known. An individualized Exercises program is recommended during and after pregnancy to promote pain outcomes. Lower-level laser therapy is expected to promote girdle pain prognosis. Aim: Comparing the effects of low-level laser therapy versus pelvic exercises therapy in female pelvic girdle pain in reducing pain and improving function. Methodology: Experimental study design, Comparative study type, sixty females were selected and divided into 2 groups, Exercises group(A) consisted of 30 females and Laser group(B)consisted of 30 females, assessed with pain, serum cortisol level, Faber test and posterior pelvic pain provocation test. Results: Statistical analysis was done by using paired’ test which showed significant improvement in both groups. Therefore, there is a significant difference between Group-A and Group-B, showing that LLLT group(B) is more effective than group(A) on pain, cortisol level and PPPPT, pelvic girdle pain women’s (p English Pregnancy, Pelvic girdle pain, Low-level laser therapy, Pelvic Exercise, Cortisol level
Introduction
the pain of the pelvic affects one out of every five pregnant women, causes physical impairment, and is a leading cause of maternity leave. 1,2 consequently, it should be considered a significant women's health problem. After delivery, the rate of recovery has been reported to be better. 3 Pelvic girdle pain (PGP), on the other hand, may develop into a condition of chronic pain and disability in some women, with serious personal and social consequences.4 The diagnosis is a subjective health complaint since it is founded on the woman's subjective perception rather than empirical results. However, (PGP)usually appears in the beginning half of pregnancy and disappears immediately after delivery,3 suggesting that reproductive factors are likely to play a role. 5,6,7,8 Despite that the causes of pelvic girdle may differ from the causes of other pain conditions, however, the factors that affect the recovery process can be the same. The number of pain sites and the severity of the pain have been considered as important factors in the progression from acute to subacute pain to chronic pain and disability. 8 In cases of (PGP), these factors are also related to a poor prognosis. Little is known about prognostic factors (PGP), except for pain intensity during pregnancy, and most studies suffer from methodological flaws such as insufficient research samples and/or improper design. Low-level laser therapy (LLLT) is a bio stimulatory physical modality that aids in tissue regeneration and pain relief by inducing collagen formation and enhancing tissue tensile strength, proving LLLT's effectiveness in tissue repair and pain management. This study aims comparing the effects of pelvic exercises and low-level laser therapy (LLLT) in the treatment of PGP on pain and pelvic flower structure. 9 exercise programs for after delivery pelvic pain stabilization, enhanced functional capacity, and pain reduction. Segmental muscles are strengthened, the neutral spine is stabilized, and the prime movers are reinforced in the stabilizing series. Stabilization exercises aim to concentrate training on specific muscles that are necessary for stability, to reflect the full spectrum of possible difficulty levels, and to increase moment to the muscles that stabilize the lumbar spine. Stabilization of timber. Lumbar stabilization exercises mainly act through transverses abdominis and multifidus, which mainly stabilize the spine. 10,11,12
Subjects, Materials and methods
Study design: It is Experimental design and Comparative study type. It was carried out between March 2019 and May 2020.it followed the Guideline of the Declaration of Helsinki on the conduct of human research.
Participants: Sixty women with pelvic girdle pain were included in this study and randomly assigned into two equal groups. These works were piloted in the physical therapy sector of Imbaba general Hospital, Cairo University.
Inclusion Criteria:
Participants' age is at least ≥20 years old. Group, (A): composed of 30 patients, treated with low-level laser therapy only. Group(B) include 30 women's, treated with pelvic exercises only, for twelve sessions over four week's period; three sessions per week. The ethical committee clearance and informed consent of the subjects were taken. patients have all rights to withdraw from the study at any time without any responsibility.
Study methods Instrumentation
Laser machine stricture: Laser medium: Semiconductor - Gallium Aluminum- Arsenide (Ga Al As), Model & manufacture: Sundom Laser-(Taiwan) RG - 300IB, Wavelength: 810 nm, Output power: 500mw±20mw, Mode: Continuous Wave (CW), Spot diameter: ≤ 10mm.
Assessment procedures: complete medical history will be checked including age, weight, and height and body mass index (BMI). All patients will be assessed before and after the treatment program.
Outcome Measure:
Pain: Visual analogue scale (VAS) is assessing pain that is a 10 mm calibrated line with zero representing no pain and10 representing worst pain. [Time Surround: Baseline to six weeks after treatment].13
Serum cortisol level: is a hormone excreted by the adrenal gland. It is the major corticosteroid. It accounts for around 95% of all glucocorticoid production in the body.14 It is released during stress. Cortisol levels are higher during pain relative to non-pain. A blood sample will be taken to determine plasma cortisol levels since there is a positive correlation between pain severity and cortisol level.5 1ml blood samples from cubital vein two times. One sample baseline and at 4 weeks after treatment.15
Posterior pelvic pain provocation test (PPPPT): This test is used to differentiate between pelvic girdle pain and LBP (especially in postpartum women). It assesses the presence of sacroiliac dysfunction. One measure will be done at baseline and 4 weeks after.16
FABER Test: Flexion, Abduction and External Rotation. These three movements combined result in a clinical pain provocation test to find pathologies at the hip, lumbar and sacroiliac region. Time Frame: Baseline to 4 weeks after treatment.17
Intervention
Treatment procedures: sixteen women's randomly classified into two groups.
A) Laser machine stricture: Laser medium: Semiconductor - Gallium Aluminum- Arsenide (Ga Al As), Model & manufacture: Sundom Laser-(Taiwan) RG - 300IB, Wavelength: 810 nm, Output power: 500mw±20mw, Mode: Continuous Wave (CW), Spot diameter: ≤ 10mm. Procedures: A) the laser therapy is applied to the sacral region by laser probe at the top, and the anterior pelvis. During all therapy sessions, the physiotherapist wears protective glasses, and the treatment area is locked, with limited access and no reflective surfaces. The standard probe moved 1cm/second from a starting point to an end-point repeatedly during the treatment period at sacral points, bilaterally. Energy density 288 J/cm2 Fluency of irradiation of 36 J/cm2 per point, exposure of 120 seconds per point, eight points of irradiation on the pelvic area 4 point sacral region and 4 points on the pubic area the typical probe held perpendicular to the body surface and pressed to the skin.11,18
B) Pelvic exercises: The stress was on bridging the transverse abdominal muscles, posterior pelvic rocking exercise, bilateral hip abduction and adduction exercise, hip shrugging, and bilateral knee elevation. The participants were asked to lie on their sides, kneel, sit, and stand. The participants were encouraged to use their transversely focused abdominal muscles regularly during their everyday activities. They performed two sets of exercises about 10-15 times each (initially 10 times in the six sessions after that15 times, for the other twelve sessions).Respite for 30-second to one minute between each exercise. Home program session achieved for 10 minutes twice a day. Each session lasted 45 minutes.19
Statistical analysis
The scores of VAS, PPPPT, and Faber test and cortisol levels in each group before and after the treatment were compared with paired-sample t-test. The change between the two groups measured before and after physiotherapy was analyzed. A statistical significance was known as p-value Englishhttp://ijcrr.com/abstract.php?article_id=4065http://ijcrr.com/article_html.php?did=40651. Vleeming A, Albert HB, Ostgaard HC, Sturesson B, Stuge B. European guidelines for the diagnosis and treatment of pelvic girdle pain. Eur Spine J. 2008;17(6):794-819.
2. Robinson HS, Mengshoel AM, Veierød MB, Vøllestad N. Pelvic girdle pain: potential risk factors in pregnancy concerning disability and pain intensity three months postpartum. Manual therapy. 2010;15(6):522-8.
3. Albert HB, Godskesen M, Westergaard JG. Incidence of four syndromes of pregnancy-related pelvic joint pain. Spine. 2002;27(24):2831-4.
4. Larsen E, Wilken-Jensen C, Hansen A, Jensen D, Johansen S, Minck H, et al. Symptom-giving pelvic girdle relaxation in pregnancy, I: prevalence and risk factors. J Acta obstetricia et Gynecologica Scandinavica. 1999;78(2):105-10.
5. Kristiansson P, Svärdsudd K, von Schoultz B. Serum relaxin, symphyseal pain, and back pain during pregnancy. Am J of obstet and gynecol. 1996;175(5):1342-7.
6. Bjelland EK, Stuge B, Vangen S, Stray-Pedersen B, Eberhard-Gran M. Mode of delivery and persistence of pelvic girdle syndrome 6 months postpartum. Am J Obstet Gynecol. 2013;208(4):298 e1-7.
7. Bjelland E, Stuge B, Engdahl B, Eberhard?Gran M. The effect of emotional distress on persistent pelvic girdle pain after delivery: a longitudinal population study. BJOG: An Inter J of Obstet & Gynae. 2013;120(1):32-40.
8. Yuko U, Toshiyuki Y, Kimiyo H, Kazuhisa M, Hirokazu U, Mari H, et al. Factors related with low back pain and pelvic pain at the early stage of pregnancy in Japanese women. Inter Jof Nurs and Mid. 2017;9(1):1-9.
9. Vallone F, Benedicenti S, Sorrenti E, Schiavetti I, Angiero F. Effect of diode laser in the treatment of patients with nonspecific chronic low back pain: a randomized controlled trial. Photomed Laser Surg. 2014;32(9):490-4.
10. Stuge B. Evidence of stabilizing exercises for low back- and pelvic girdle pain - a critical review. Braz J Phys Ther. 2019;23(2):181-6.
11. Mr. Prashant B. Mukkannavar DBRD. “Effectiveness of specific stabilization exercises for pelvic girdle pain following caesarean section delivery: a randomized controlled trial”. The KLE Academy of Higher Education and Research, Belgaum KLE Deemed University; November - 2013.
12. Simões LCF, Teixeira-Salmela LF, Wanderley ELS, Barros RRd, Laurentino GEC, Lemos A. Cross-cultural adaptation of "Pelvic Girdle Questionnaire" (PGQ) to Brazil.J Acta Fisiátrica. 2016;23(4).
13. Crichton N. Visual analogue scale (VAS). J Clin Nurs. 2001;10(5):706-6.
14. Tennant F. The physiologic effects of pain on the endocrine system. J Pain Ther. 2013;2(2):75-86.
15. Suliman S, Ericksen T, Labuschgne P, de Wit R, Stein DJ, Seedat S. Comparison of pain, cortisol levels, and psychological distress in women undergoing surgical termination of pregnancy under local anaesthesia versus intravenous sedation. J BMC Psychiatry. 2007;7:24.
16. Thabet AA, Hanfy HM, Ali TAR. Effect of low-level laser therapy and pelvic rocking exercise in the relief of primary dysmenorrhoea. Bull Fac Phys Ther. 2008;13(1).
17. Hilde G, Gutke A, Slade SC, Stuge B. Physical therapy interventions for pelvic girdle pain (PGP) after pregnancy. Cochrane Database of Systematic Rev. 2016.
18. Monticone M, Barbarino A, Testi C, Arzano S, Moschi A, Negrini S. Symptomatic efficacy of stabilizing treatment versus laser therapy for sub-acute low back pain with positive tests for sacroiliac dysfunction: a randomised clinical controlled trial with 1 year follow-up. J Europa Medico Physica. 2004;40(4):263-8.
19. Elden H, Ladfors L, Olsen MF, Ostgaard H-C, Hagberg H. Effects of acupuncture and stabilizing exercises as adjunct to standard treatment in pregnant women with pelvic girdle pain: a randomised single-blind controlled trial. Bri Med J. 2005;330(7494).
20. Gam AN, Thorsen H, Lønnberg F. The effect of low-level laser therapy on musculoskeletal pain: a meta-analysis. Pain. 1993;52(1):63-6.
21. Ferreira D, Zângaro R, Villaverde AB, Cury Y, Frigo L, Picolo G, et al. Analgesic effect of He-Ne (632.8 nm) low-level laser therapy on acute inflammatory pain.J Photo and laser Surg. 2005;23(2):177-81.
22. Yamany AA, Sayed HM. Effect of low-level laser therapy on the neurovascular function of diabetic peripheral neuropathy. J of Advan Rese. 2012;3(1):21-8.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareEvaluation of Oxidative Stress Parameters and Lipid Profile in Diabetic Nephropathy Patients
English3136Yadav BhuneshwarEnglish Kurpad Nagaraj ShashidharEnglish Anjanappa RaveeshaEnglish Chandrappa MuninarayanaEnglishIntroduction: Oxidative stress is responsible for endothelial dysfunction and one of the important factors contributing to pathogenesis of DN. Aim of the study was to evaluate extended diabetic profile and oxidative stress parameters in type 2 diabetes with and without nephropathy. Methods: Hospital based cross-sectional analytical study includes 150 study subjects in the age group of 35-70 years were grouped into three groups; Group I- Healthy Controls; Group II- Clinically proven type 2 diabetes mellitus and Group III- Type 2 diabetes mellitus with nephropathy. Anthropometric and biochemical parameters were analysed by standard methods. Results: Among the oxidative stress parameters Vitamin C, Nitric Oxide and Glutathione peroxidase showed a significant decline in Group III when compared with group I and II with a p-value EnglishDiabetic Nephropathy, Oxidative Stress, Malondialdehyde, Lipid Profile, Glutathione peroxidase, Type 2 Diabetes MellitusINTRODUCTION:
Diabetes Mellitus (DM) is a metabolic disorder resulting from either from deficiency of insulin or resistance to its action causing increased blood glucose levels (Hyperglycaemia) which leads to several systemic complications.1 The classical symptoms of diabetes include polydypsia, polyuria, polyphagia and weight loss. As the disease progress, patients are at high risk for the development of complications, such as retinopathy leading to blindness, nephropathy ending with renal failure, neuropathy resulting in nerve damage and atherosclerosis.2 Prevalence of diabetes is increasing day on day worldwide. International Diabetes Federation (IDF) in year 2013, estimated that around 382 million people had diabetes. The prevalence of diabetes is increasing exponentially and by 2030 it is estimated that the chance of diabetes may be almost doubled.3
Diabetic Nephropathy (DN)is a clinical syndrome characterized by albuminuria (>300 mg/day or >200 mcg/min) confirmed at least on two occasions 3-6 months apart with permanent and irreversible decrease in glomerular filtration rate (GFR) and arterial hypertension. It is a progressive kidney disease caused by glomerular as well as tubular structural and functional alteration which is induced by glucose homeostasis disturbance accounting to 30-40% of diabetic patients and is one of the major causes of end stage renal disease (ESRD).4,5
Hyperglycaemia being a crucial factor in the development of diabetic nephropathy induces hemodynamic and metabolic factors which are thought to be the main mediators of renal injury. Increased glucose concentration enhances oxidant production and impairs antioxidant defence by multiple interacting pathways including increased production of advanced glycation end products (AGEs), enhance reactive oxygen species generation and activation of protein kinase (PKC), polyol and renin-angiotensin system (RAS).6
Persistent hyperglycaemic state activates aldose reductase activity and the polyol pathway, which decreases NADPH/NADP+ ratio.7 Further intracellular glucose activates PKC through de novo synthesis of diacylglycerol (DAG)8 and has been associated with processes increasing mesangial expansion, thickening basement membrane, endothelial dysfunction, smooth muscle cell contraction and activation of cytokines and transforming growth factor β (TGF-β).9 PKC induces oxidative stress by activating mitochondrial NADPH oxidase and been recognized as contribution of oxidant production as NADPH oxidase stimulate ROS generation and contributing to the development and progression of DN.6
Dyslipidaemias which is characterized by high plasma triglyceride concentration, low HDL cholesterol concentration and increased concentration of small dense LDL cholesterol particle is being one of the major risk factor for vascular disease in DM. These changes in lipid concentration are attributed to increase free fatty acids flux secondary to insulin resistance in DM.10 Altered lipid profile is common in patient with kidney disease. Dyslipidaemias in DM may cause kidney damage and contributing to a progressive decline in kidney function leading to development and progression of DN.11Thus, this study aimed to evaluate oxidative stress parameter in type 2 diabetes with and without nephropathy compared with clinically healthy controls. Extended diabetic profile and oxidative stress parameters are compared between three groups.
MATERIALS AND METHODS:
This Hospital-based cross-sectional analytical study was conducted in R L Jalappa Hospital and Research Centre attached to Sri DevarajUrs Medical College, constituent of Sri DevarajUrs Academy of Higher Education and Research, Tamaka, Kolar, Karnataka India. Study was approved by the Institutional Ethical Committee (SDUMC/KLR/IEC/17/2019-20) and informed consent was obtained from all study subjects participating in this study.
A total of 150 study subjects in the age group of 35-70 years of males and females were included. These study subjects were grouped into: Group I- Healthy Controls; Group II- Clinically proven T2DM; Group III- Type 2 DM with nephropathy. Patients with active urinary tract infection, renal disease other than diabetic nephropathy, chronic liver or heart diseases, cancer, gestational diabetes mellitus, Acute kidney injury Type 1 DM along with patient on dialysis were excluded from the study.
Clinical details such as anthropometric measurement of all the study subjects enrolled in the study were obtained from the hospital medical records. A minimum of 8 hours of fasting blood sample was collected and divided into parts with specified sample requirements per the investigations into serum (plain tubes), whole blood and plasma (EDTA&NaF tubes) for parameters as mentioned in measurement methods.2 hours post- prandial blood sample was also collected for Post-prandial blood sugar estimation.
Fasting and post-prandial blood glucose, urea, Creatinine, Uric acid, total cholesterol, triglyceride and HDL-cholesterol were analyzed using Vitros 5.1 FS dry chemistry auto analyzer from Ortho Clinical Diagnosis (OCD) United States, based on the principle of Reflectance Photometry. HbA1C was determined by HPLC method. Malondialdehyde (MDA) by Thiobarbituric acid reactive substance (TBARS) method, Vitamin C by 2,4-dinitrophenylhydrazine method, Nitric oxide by Modified Griess method were measured spectrophotometrically using Perkin Elmer UV/VIS spectrophotometer. Glutathione peroxidase was determined by using ELISA kit from 2018 Geno Technology Inc., USA. LDL-C was calculated using Friedwald Equation as well as VLDL and Non-HDL-C was also calculated.
Statistical analysis was performed using IBM-SPSS statistical package 20. An Independent sample t-test was used to compare the means of different parameters. The difference between the three groups was assessed using analysis of variance (ANOVA). Pearson correlation coefficient was used to demonstrate a correlation between oxidative stress parameter & lipid profile. p-valueEnglishhttp://ijcrr.com/abstract.php?article_id=4066http://ijcrr.com/article_html.php?did=4066
Sacks D B.Teitz Textbook of clinical chemistry and molecular diagnostics. In: Carl A. Burtis, Edward R. Ashwood, David E. Bruns, editors. Diabetes mellitus. 5th ed. Elsevier publisher; 2014. p. 1415-56.
Kirti S. API Textbook of Medicine. In: YP Munjal, editors. Disease Mellitus: Microvascular Disease: pathogenesis of chronic complications. 10th ed. Jaypee Brothers Medical Publisher; 2015. p. 524-27.
International Diabetes Federation. IDF Diabetes atlas. 6th ed. Brussels, Belgium; 2013.
International Diabetes Federation. IDF Diabetes Atlas 2015, 7th edition; 2017.
Sharma RK. API Textbook of Medicine. In: YP Munjal, editors. Diabetes and kidney disease. 10th ed. Jaypee Brothers Medical Publisher; 2015. p. 528-33.
Yamagishi S, Imaizumi T. Diabetic vascular complications: pathophysiology, biochemical basis and potential therapeutic strategy. Curr Pharm Des 2005; 11:2279-99.
Tesfamariam B. Free radicals in diabetic endothelial cell dysfunction.Free RadicBiol Med1994; 16(3): 383–91.
Ishii H, Jirousek MR, Koya D, Takagi C, Xia P, Clermont A,et al. Amelioration of vascular dysfunctions in diabetic rats by an oral PKC ? inhibitor. Science 1996; 272(5262): 728–31.
Koya D, King GL. Protein kinase C activation and the development of diabetic complications. Diabetes 1998; 47(6): 859–66.
Mooradian AD. Dyslipidemia in type 2 diabetes mellitus. Nat Rev Endocrinol2009; 5(3): 150–59.
Nosadini R, Tonolo G. Blood glucose and lipid control as risk factors in the progression of renal damage in type 2 diabetes. J Nephrol 2003; 16(7): 42-7.
Tuttle KR, Bakris GL, Bilous RW, Chiang JL, de Boer IH, Goldstein-Fuchs J, et al. Diabetic kidney disease: a report from an ADA Consensus Conference. Diabetes Care 2014;37: 2864-83.
Nakai S, Iseki K, Itami N, Ogata S, Kazama JJ, Kimata N, et al. An overview of regular dialysis treatment in Japan (as of 31 December 2010). TherApher Dial 2012;16: 483-521.
Patel DN, Kaila K. Characterization of low molecular weight urinary proteins at varying time intervals in type 2 diabetes mellitus and diabetic nephropathy patients. DiabetolMetabSyndr 2019; 11(39): 1-11.
Elsayed MS, El Badawy A, Ahmed A, Omar R, Mohamed A. Serum cystatin C as an indicator for early detection of diabetic nephropathy in type 2 diabetes mellitus. Diabetes MetabSyndr2019;13(1):374-81.
Tanaka K, Hara S, Hattori M, Sakai K, Onishi Y, Yoshida Y, et al.Role of elevated serum uric acid levels at the onset of overt nephropathy in the risk for renal function decline in patients with type 2 diabetes. J Diabetes Investig2014; 6(1): 98–104.
Kutzing MK,Firestein BL. Altered Uric Acid Levels and the Disease States. J PharmacolExpTher2007; 324(1):1–7.
Rai S, Prajna K, Rai T. Lipid profile in Type 2 diabetes mellitus and in diabetic nephropathy. Int J ClinBiochem Res2017;4(4): 379-82.
Trovati M, Cavalot F. Optimization of hypolipidemic and antiplatelet treatment in the diabetic patients with renal disease. J Am SocNephrol 2004;15:12-20.
Ishii N, Patel K, Lane PH, Taylor T, Bian K, Murad F, et al. Nitric oxide synthesis and oxidative stress in the renal cortex of rats with diabetes mellitus. J Am SocNephrol2001;12: 1630?39.
Munilakshmi U, Shashidhar K N, Muninarayana C, Madhavi R, Lakhsmaiah V. Expediency of markers for early detection of acute kidney injury sequelae to type 2 diabetes mellitus. Asian J Pharm Clin Res 2016; 9(4): 1-5.
Elfar MA, Bakr MA, Farahat SE, Afattah EA. Glutathione peroxidase activity in patients with renal disorders. Clin Exp Nephrol 2005; 9: 127-31.
Zagrodzki P, Barton H, Walas S. Selenium status indices, laboratory data and selected biochemical parameters in end-stage renal disease patients. Biol Trace Elem Res 2007; 116: 29-41.
Ceballos P, Witko SV, Merad BM. Glutathione antioxidant system as a marker of oxidative stress in chronic renal failure. Free RadicBiol Med 1996; 21: 845-53.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcarePerceptions of University Students of the Challenges Faced by Children Whose Fathers are Unable to Participate in Their Early Education: A Quantitative Evaluation
English3743Okeke CharityEnglish Ugwuanyi ChristianEnglish Okeke ChineduEnglishIntroduction: Despite empirical evidence on the positive correlation of parents’ involvement and early education of children, research shows that there is a lack of parental involvement in South Africa. Objective: This study sought the perceptions of university students on the challenges faced by children whose fathers are unable to participate in their early education. Method: A descriptive survey research design was adopted for the study with a sample of 300 university students in Eastern Cape-based University. A 16-item questionnaire titled “Challenges Faced by Children Questionnaire” was used for data collection. An internal consistency reliability index of the items of the instrument is 0.86. Data collected were analysed using mean and analysis of variance. Results: The findings of the study revealed that the challenges faced by children whose fathers are uninvolved in their early education include poor intellectual, behavioural and social development among others. Conclusion: South African children whose fathers do not participate in their early education face a lot of difficulties which hinder that their educational development.
EnglishChildren, Early childcare, Education, Participation, Perception, University studentsIntroduction
There have been problems surrounding the issue of parental involvement in school which is a very important factor on children’s academic development.1 In line with the above claim, previous research findings revealed that parental involvement in education correlates very positively with academic achievement 2, self-esteem of children 3 and school retention.4 Moreover, home learning environment that children experience early from their parents is highly predictive of their later academic competencies.5 Fathers’ parenting practices likely play an important role in promoting healthy behavior in children, but the evidence base is limited.6 One of the beneficial factors in young children’s learning is the active involvement of family in Early Childhood Special Education (ECSE).7 Despite the above empirical evidence on the positive correlation of parents’ involvement and early education of children, research shows that there is a lack of parental involvement in South Africa.
In South Africa, most children experience their early beginning without ever knowing who the father is.8-11 An abundance of evidence suggests a scenario where men who desire to be good fathers often find themselves not knowing how to be the fathers they want to be.12 Moreover, fathers, irrespective of their ages, are confronted with uncertainty about what it means to be an involved father, let alone how to participate in their children’s lives.13,14Makusha and Richter 15 as cited by Mathwasa and Maphosa 16 found that father-absence has caused many social ills and psychological damage due to situations such as divorce or death which are more permanent. Besides, another situation in this phenomenon is where the father is absent due to lackadaisical attitude of neglect, yet they may be physically present.17,16 Despite that parent involvement is fundamental for school functioning, the nature and extent of such involvement in South Africa are debatable and contested amongst stakeholders.18 Majority of the South African parents are not actively involved in the schoolwork of their children and that it adversely affects the functioning of the school, according to the teachers.19This situation in South Africa coupled with the fact that no research has been conducted to explore the perceptions of university students on the challenges faced by children of the uninvolved fathers necessitated this research.
Children in the United Kingdom who do not enjoy parents’ participation in their early education have a deficiency in attitudes, behaviour and mental health development.20 It is only when parents are involved in the early education of their children that the academic, social, and emotional needs of the latter are bound to happen naturally otherwise such development will be hampered.21 Parents’ failure to engage in educationally supportive activities is associated with children’s poorer academic and behavioral outcomes.22 Spanish children whose parents exhibited more family involvement tended to demonstrate better results than those from homes with non-participatory parents.23 Chinese parents who compete for high-quality educational opportunities for their children, enable the children to cultivate good learning habits and achieve better academic performance than the children whose parents are uninvolved in the early education.24 There are differences in Chile children’s academic achievement between the parental involvement profiles, indicating children whose parents have a low involvement have lower academic achievement.1 Children of parents that volunteer, attend meetings, help with homework, and set high expectations, tend to do better at school than those whose parents are uninvolved.25
Research has clearly shown that most South African fathers are not actively involved in the early education of their children. Lack of parental involvement especially fathers’ involvement has been an issue that has attracted the attention of several researchers in other countries as shown in the reviewed literature. Even though children whose parents do not actively participate in their early education encounter difficulties in their early education, no research has looked for the perceptions of university students on the challenges such children face. On this premise, this study sought the perceptions of university students on the challenges faced by children whose fathers are not involved in their early education at Eastern Cape-based University.
Research Questions
Whatare the challenges faced by children whose fathers are uninvolved in their early education as perceived by the University students?
What is the influence of race on the university students’ perceptions of the challenges faced by children whose fathers are uninvolved in their early education?
What is the influence of age on the university students’ perceptions of the challenges faced by children whose fathers are uninvolved in their early education?
Methods
The design of the study was descriptive survey research. Survey design provides a quantitative description of attitudes or opinions of a population by studying a sample of that population.26This design has been adopted by 27-33 in similar studies.
The target population for this study was all the university students in the Faculty of Education of one Eastern Cape-based University. A sample size of 300 University students was selected for the study. Using a simple random sampling technique, a sample of 300 students from the Faculty of Education of the participating University was drawn across the different levels of study.
An instrument titled Challenges Faced by Children Questionnaire was used to obtain quantitative data from the 300 University students. The instrument is a 16-item questionnaire structured on a 5-point response option of strongly agree (SA), agree (A), undecided (U), disagree (D) and strongly disagree (SD). The minimum score on the questionnaire is 16 while the maximum score is 80.
To ensure the face validity of the instruments, copies of the instrument were given to experts for their constructive criticisms. The comments of the validators were used to arrive at the final version of the instrument which was later subjected to trial testing. To ensure the reliability of the instrument, the field test of the instrument was conducted. The internal consistency reliability index of the items of the instrument was obtained to be 0.86 using Cronbach’s alpha method.
Data were analyzed using mean and analysis of variance. Mean was used to answer the research questions while analysis of variance was used to test the null hypotheses at 0.05 level of significance.
Results
Research Question One: What are the challenges faced by children whose fathers are uninvolved in their early education as perceived by the University students?
Table 1 shows the mean ratings of the university students on the challenges faced by children whose fathers are uninvolved in their early education. It shows that the mean ratings of the students on items 1 to 16 are more than the criterion mean of 3.00 for decision rule. This indicates that the university students agree to the statements of items 1 to 16 as the challenges faced by children whose fathers are uninvolved in their early education. Thus, the challenges faced by children whose fathers are uninvolved in their early education include seeking support elsewhere when fathers are unable to support them, exposure to serious dangers outside, suffering of child abuse when their fathers are unable to participate in their early development, missing the guidance they need from fathers among other.
Research Question Two: What is the influence of race on the university students’ perceptions of the challenges faced by children whose fathers are uninvolved in their early education?
Table 2 shows that the Black university students had mean perception rating of 58.13 with a standard deviation of 10.51, White university students had mean perception rating of 58.02 with a standard deviation of 10.58, Coloured university students had mean perception rating of 48.55 with a standard deviation of 8.40 while the Indian university students had mean perception rating of 58.80 with a standard deviation of 12.39. This implies that there are variations in the mean perception rating of the university students of different races on the challenges faced by children whose fathers are uninvolved in their early education.
Ho1: Race has no significant influence on the university students’ perceptions of the challenges faced by children whose fathers are uninvolved in their early education.
Table 3 shows that there is a significant difference in the mean ratings of students of different races on the challenges faced by children whose fathers are uninvolved in their early education, F (3, 296) = 5.257, p = .002. Thus, the null hypothesis was rejected since the probability value of 0.002 is less than the 0.05 level of significance.
Table 4 shows the pair-wise comparison test for the significant difference in mean ratings of students of different races on the challenges faced by children whose fathers are uninvolved in their early education. It shows that the mean difference between Black and Coloured university students had a significant positive mean difference (MB-C = 9.58) at p = .002 and thus contributed most to the significant influence of race on the university students’ perceptions on the challenges faced by children whose fathers are uninvolved in their early education followed by the mean difference of White and Coloured university students (MW-C = 9.47, p = .012).
Research Question Three: What is the influence of age on the university students’ perceptions of the challenges faced by children whose fathers are uninvolved in their early education?
Table 5 shows that the university students within the age range of 28-25 years had mean perception rating of 55.57 with a standard deviation of 11.05, university students within the age range of 26-30 years had mean perception rating of 58.55 with a standard deviation of 11.13, university students within the age range of 31-35 years had mean perception rating of 60.83 with a standard deviation of 8.21 while the university students who are above 35 years of age had mean perception rating of 59.49 with a standard deviation of 10.65. This implies that there are variations in the mean perception rating of the university students of different age ranges on the challenges faced by children whose fathers are uninvolved in their early education.
Ho2: Age has no significant influence on the university students’ perceptions of the challenges faced by children whose fathers are uninvolved in their early education.
Table 6 shows that there is a significant difference in the mean ratings of students of different age ranges on the challenges faced by children whose fathers are uninvolved in their early education, F (3, 296) = 3.785, p = .011. Thus, the null hypothesis was rejected since the probability value of 0.002 is less than the 0.05 level of significance.
Table 7 shows the pair-wise comparison test for the significant difference in mean ratings of students of different age ranges on the challenges faced by children whose fathers are uninvolved in their early education. It shows that the mean difference between university students within the age range of 31-35 years and those within the age range of 28-25 years had a significant positive mean difference (M = 5.26) at p = .002 and thus contributed most to the significant influence of age on the university students’ perceptions on the challenges faced by children whose fathers are uninvolved in their early education.
Discussion of the Findings
The findings of the study revealed that the challenges faced by children whose fathers are uninvolved in their early education include seeking support elsewhere when fathers are unable to support them, exposure to serious dangers outside, suffering of child abuse when their fathers are unable to participate in their early development, missing the guidance they need from fathers, poor academic achievement, poor social skills and behavioural development among other. Further analysis showed that race and age of the students had a significant influence on their perceptions of the challenges faced by children of uninvolved fathers. These findings are in tandem with the findings of. 22,34,35,23,20,21,25,26
Fathers’ failure to engage in educationally supportive activities is associated with children’s poorer academic and behavioral outcomes.22 Leidy, Schofield and Parke34, as cited in McMunnet al.35 found that decreased interaction with fathers deprives children of the opportunity to learn social skills and enjoy emotional as well as instrumental support from their fathers. According to Lang et al.36 as cited in McMunnet al.35, fathers’ lack of participation in child-related activities leads to poor children’s cognitive, linguistic, and socioemotional development across early childhood independent of mothers’ involvement.
Spanish children whose fathers exhibited more family involvement tended to demonstrate better results than those from homes with non-participatory fathers.23Children in the United Kingdom who do not enjoy fathers’ participation in their early education have a deficiency in attitudes, behaviour, and mental health development.20 It is only when fathers are involved in the early education of their children that the academic, social, and emotional needs of the latter are bound to happen naturally otherwise such development will be hampered.21 There are differences in Chile children’s academic achievement between the parental involvement profiles, indicating children whose fathers have a low involvement have lower academic achievement.25 Children of fathers who volunteer, attend meetings, help with homework, and set high expectations, tend to do better at school than those whose fathers are uninvolved.26 From the discussions above, the findings of the study have validated the findings of the previous studies in other countries other than South Africa on the challenges faced by children of uninvolved fathers in their early education. These findings have contributed to the body of knowledge in the area of early childhood care and education in South Africa particularly since no such study has been conducted in the past. This finding implicates children’s physics education career choice in that their career choices in physics education will be marred at the face of the numerous challenges they encounter at early education.
Conclusion and recommendations
The researchers concluded based on the findings of the study that South African children whose fathers do not participate in their early education face a lot of difficulties paramount among others are poor intellectual, behavioural and social development which will culminate in their poor early childhood education. However, there exist variations in the perceptions of the university students of different races and age ranges on the challenges faced by children of uninvolved fathers with the black and coloured students affirming strongly those challenges the children face. This is a serious situation because South African studies have shown that the majority of the fathers do not participate in the education provisioning of their children.
Based on this, the researchers recommend that:
Adequate strategies should be put in place by the education ministry and other relevant bodies to sensitize fathers on the need for adequate participation in the early education of their children.
Seminar in form of enlightenment programs should be organised at university levels to enable the male university students who are fathers already or fathers to be to understand the educational implications of fathers’ active participation in the early education of their children.
Acknowledgement
The researchers appreciate all the parents who participated in this study for their active and honest participation.
Authors’ contribution
This research was initiated by Prof Chinedu Okeke while Dr Christian Ugwuanyi and Mrs. Charity Okeke joined him to actualize the aims of the research. All the authors contributed substantively towards the success of the research.
Conflict of interest
NIL
Source of funding
NIL
Englishhttp://ijcrr.com/abstract.php?article_id=4067http://ijcrr.com/article_html.php?did=4067
Lara L, Saracostti M. Effect of Parental Involvement on Children’s Academic Achievement in Chile. Front Psychol. 2019; 10:1464. https://doi.org/10.3389/fpsyg.2019.01464
Tárraga V, García B, Reyes J. Home-based family involvement and academic achievement: a case study in primary education. Educ. Stud. 2017; 44: 361–375. https://doi.org/10.1080/03055698.2017.1373636
Garbacz SA, Herman KC, Thompson AM, Reinke WM. Family engagement in education and intervention: implementation and evaluation to maximize family, school, and student outcomes. J Sch Psychol. 2017; 62:1–10
Ross T. The differential effects of parental involvement on high school completion and postsecondary attendance. Educ. Policy Anal Arch. 2016; 24: 1–38. doi: 10.14507/epaa.v24.2030
Foster TD, Froyen LC, Skibbe LE, Bowles RP, Decker KB. Fathers’ and mothers’ home learning environments and children’s early academic outcomes. Read Writ, 2016; 29:1845–1863, https://doi.org/10.1007/s11145-016-9655-7
Morgan PJ, Young MD. The Influence of Fathers on Children’s Physical Activity and Dietary Behaviors: Insights, Recommendations and Future Directions. Curr Obes Rep. 2017; 6:324–333. https://doi.org/10.1007/s13679-017-0275-6
Ancell KS, Bruns DA, Chitiyo J. The Importance of Father Involvement in Early Childhood Programs. Young Exceptional Children. 2018; 21(1). https://doi.org/10.1177/1096250615621355 http://yec.sagepub.com
Adams CGG. Fathers’ involvement in the social development of children under six years: A social capital perspective and implications for early childhood development in the East London Education District. (Unpublished doctoral thesis). University of Fort Hare, East London, South Africa. 2016.
Makusha T, Richter L. Non-resident Black fathers in South Africa. In Roopnarine, J. L. (Ed.), Father – paternity (pp. 30–33). 2016. Syracuse, NY: UNICEF.
Mathwasa J, Okeke CIO. Barriers educators face in involving fathers in the education of their children in the foundation phase. J Soc Sci. 2016; 46:229–240.
Mncanca M, Okeke CIO. Positive fatherhood: A key synergy for functional early. Childhood education in South Africa. J Soc Social Anthrop. 2016; 7:221–232.
Okeke CIO. Crises impacting South African men’s participation in early socio-education development of children and possible useful interventions. South African Journal of Psychology. 2017; 1–12. https://doi.org/10.1177/0081246317729572 journals.sagepub.com/home/sap.
Mncanca M, Okeke CIO, Fletcher R. Black fathers’ participation in early childhood development in South Africa: What do we know? J Soc Sci. 2016; 46:202–213.
Mercer GD. Do fathers care? Measuring mothers’ and fathers’ perceptions of fathers’ involvement in caring for young children in South Africa. (Unpublished doctoral thesis). The University of British Columbia, Vancouver, Canada. 2015.
Nduna M. Growing up without a father and a pursuit for the right surname. The Open Fam Stud J. 2014; 6:31–38.
Makusha T, Richter L. Gatekeeping and its impact on father involvement among Black South Africans in rural KwaZulu-Natal. Culture, Health & Sexuality. 2015; 18(3):308-320.
Mathwasa J, Maphosa C. Factors Hindering Men’s Capabilities to Actively Participate in the Early Social Development of Children: A Qualitative Approach. Anthropologist. 2018; 32(1-3):58-69. https://doi.org/10.31901/24566802.2018/32.1-3.2000
Spruijt E, Degoede M, Vandervalk I. The wellbeing of youngsters coming from six different family types. Patient Educ Couns. 2001; 45(4):285-294.
Segoe BA, Bisschoff T. Parental Involvement as Part of curriculum Reform in South African Schools: Does It contribute to Quality Education? Africa Education Review. 2019; 16(6): 165-182, https://doi.org/10.1080/18146627.2018.1464692
Munje PN, Mncube V. The lack of parent involvement as hindrance in selected public primary schools in South Africa: The voices of educators.Perspect Educ. 2018;36(1):80-93. http://dx.doi.org/10.18820/2519593X/pie.v36i1.6
Garry H, Ian B. Barriers to parental involvement in education: an update. Educ Rev. 2018; 70(1):109-119. https://doi.org/10.1080/00131911.2018.1388612
Epstein JL. School, family, and community partnerships: Preparing educators and improving schools, 2nd ed. New York: Routledge. 2018. https://doi.org/10.4324/9780429494673
Morsy L, Rothstein R. Five social disadvantages that depress student performance: Why schools alone can’t close achievement gaps. Report. 2015.
Fernández-Alonso R, Álvarez-Díaz M, Woitschach P, Suárez-Álvarez J, Cuesta M. Parental involvement and academic performance: Less control and more communication.Psicothema. 2017; 29(4):453-461. https://doi.org/10.7334/psicothema2017.181
Li Z, Qiu Z. How does family background affect children’s educational achievement? Evidence from Contemporary China. J Chin Soci. 2018; 5(13). https://doi.org/10.1186/s40711-018-0083-8
Mbusi S.Opinion: We need to step up parental involvement in schools. 2020.
Creswell JW. Qualitative Inquiry & Research Design: Choosing among Five Approaches (4 ed.). Thousand Oaks CA: Sage. 2014
Eze KO, Ugwuanyi CS, Okeke CIO. Extent of the Upper Basic Education French Language Curriculum Content-Delivery with Technologies in Nigerian Secondary Schools. Int J Mech Prod Engg Res Devp (IJMPERD). 2020; 10(4): 311-318. https://doi.org/10.24247/ijmperdaug202027
Okeke CIO, Ugwuanyi CS, Mufutau MA. Stakeholders’ Views on Engaging Fathers in Early Childhood Care and Education. J Human Eco. 2020; 71(1-3): 177-186.https://doi.org/10.31901/24566608.2020/71.1-3.3233
Okeke CIO, Okeke CC, Ugwuanyi CS. Intervention strategies that can support young adults’ transition into positive fatherhood: implications for Science, Technology, Engineering and Mathematics Education. Int J Mech Prod Engg Res Development (IJMPERD). 2020; 10(3): 8585–8596. https://doi.org/10.24247/ijmperdjun2020816
Okenyi EC, Ngwoke AN, Ezema VS, Aneke AO, Asogwa HE, Ugwuanyi CS. Assessment of the perceived impact of home information and communication technology on pupils’ social skills development. International Journal of Mechanical and Production Engineering Research and Development. 2021; 10 (1):67-78. URL:http://www.tjprc.org/publishpapers/2-67-1611120431-6IJMPERDFEB20216.pdf
Ugwuanyi CC, Nwachukwu WC, Ugwuanyi CS, Okeke CIO, Nworgu BG, Nwoye MN, et al. Perceived Impact of the Use of Internet Resources on Undergraduate Students’ Academic Achievement in Mathematics: Implication for Physics and Engineering Teaching. Int J Mech Production Engg Res Devp (IJMPERD). 2020; 10(4):359-368. http://dx.doi.org/10.24247/ijmperdaug202031
Ezema VS, Okenyi EC, Ugwuanyi CS. Assessment of the extent of community involvement in the funding of primary schools in Enugu state, Nigeria: Implications for further research. Int J Mech Production Engg Res Devp. 2021; 10 (1):91-98. http://www.tjprc.org/publishpapers/2-67-1611554947-8IJMPERDFEB20218.pdf
Leidy MS, Schofield TJ, Parke RD. Fathers’ contribution to children’s social development. In Canbrera NJ, Tamis-LeMonda CS (Eds.). Handbook of father involvement: Multidisciplinary perspectives (pp. 151-167). New York, NY: Routledge. 2013
McMunn A, Martin P, Kelly Y, Sacker A. Fathers’ Involvement: Correlates and Consequences for Child Socioemotional Behavior in the United Kingdom. J Fam Issues. 2017; 38(8): 1109–1131. https://doi.org/10.1177/0192513X15622415
Lang SN, Schoppe-Sullivan SJ, Kotila LE, Feng X, Kamp Dush CM, Johnson SC. Relations between fathers’ and mothers’ infant engagement patterns in dual-earner families and toddler competence. J Fam Issues. 2014; 35:1107-1127.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareApplication of Short-Duration and High-Intensity Voltage Pulses for Food Processing and Storage Studies in Different Packaging Materials
English4450Sujatha GEnglish Sivakumar TEnglish Murali DEnglishIntroduction: The focus of food scientists and engineers is towards non-thermal technologies for food processing and preservation for retaining the fresh attributes of the product without compromising safety and quality. In this research work, one of the non-thermal approaches called the pulsed electric field (PEF) method has been employed for shelf-life studies of raw milk processing and preservation. Objective: The main aim of this study is to investigate the shelf life studies of raw milk processing based on intense electric pulses of short duration and its packaging using various materials viz., glass bottles, lacquered tins, polyethene pouches and retort pouches. Methods: To analyze the shelf life studies of raw milk processing, a non-thermal approach called the pulsed electric field method, which uses high voltage electric pulses for food processing, has been employed. Results: The raw milk procured from nearby villages was processed using a pulsed electric field system and its shelf life was investigated using four different packaging materials. A voltage level of 35 kV/cm and 600 square pulses of pulse width 2.5 µsec enhanced the shelf-life to 28 days when stored in glass bottles. Conclusion: The study suggests that the shelf life of processed milk samples is good in glass bottles followed by tins, retort pouches and polyethene pouches.
English Digital storage oscilloscope, Packaging materials, PEF processing, Raw cow milk, Shelf lifeINTRODUCTION
Recently, the non-thermal approach for processing and preservation of food is preferred in food industries. This technique employs short duration pulses, of width in the range of microseconds, applied to the raw food placed between a set of electrodes. There is no significant heating of the food subjected to the high voltage pulses. The applied high voltage causes an intense electric field thereby inactivating microbial organisms.1,2 After the food processing, the packaging is important as it avoids post contamination. Certain foods are more sensitive to oxygen present in the air medium. The oxidization of fatty foods may produce off-flavours. Similarly, the loss of Vitamin C or discolouring of fruit juices may occur due to oxidization. The material used for packaging these kinds of foods that are exposed to oxygen should be able to prevent the transmission of oxygen into the food. The selection of packaging material depends upon technical suitability, availability and cost. In this proposed research work, high voltage (HV) electrical pulses of short duration are used for processing raw cow milk placed in the space between a set of electrodes. The presented work explains how the raw milk is processed using HV electric pulses of short width and how it is effectively stored in packages of different materials. The raw milk samples were collected from six different villages in and around Koduvalli village near Redhills, Chennai. The raw milk was processed through the lab-scale HV electric pulse based processing parallel plate batch treatment chamber and the milk so processed was effectively preserved in packages made of different materials.
The remaining part of the paper is planned into various sections. Section 2 explains the concept of the Pulsed Electric Field (PEF) system employed for raw milk processing. Section 3 describes the packaging of PEF processed milk. The shelf-life studies of milk collected from different sources are described in section 4. Finally, the conclusions of the proposed work are given in section 5.
MATERIALS AND METHODS
Concept of food processing using Non-thermal method
The non-thermal method uses high voltage (HV) electric pulses for raw food processing. These HV electric pulses in turn produce a high-intensity electric field. This simple system of pulsed electric field (PEF) incorporates various essential components such as a scheme for producing an HV power supply, a bank of capacitors for energy storage, and HV resistor, a switch, processing chamber(s), voltage probes, current probes and temperature probes, and a cooling scheme. The overall PEF system is monitored by a control panel. The liquid food can be conducted through the processing equipment using a pump in the case of a continuous monitoring system.2 The concept and application of PEF technology have been explained by many authors in the literature.3-9
In the system of HV electric pulses, a bank of capacitors is charged using the energy obtained from an HV power supply scheme. The charged capacitor bank is allowed to discharge through the food material to be processed for generating the required high-intensity electric field in the space (containing food) between the electrodes.4
Each energy storage capacitor in the capacitor bank has the capacitance C (F) as defined by equation (1):
where denotes the width of the HV electric pulse (s), represents the electrical conductivity of the food material to be processed (Sm-1), A represents the area of cross-section of each electrode surface (m2), d is the distance between the parallel electrodes (m). The following equation (2) is used to calculate the magnitude of electric field intensity in kV/m produced in the food material to be processed.10
The energy stored per unit volume (w) in J/m3 of the capacitor is denoted as equation (3), where denotes the permittivity of food material placed between the electrodes (F/m).
The HV switch is closed in response to a trigger signal. The charged capacitors discharge at a very fast rate through the food material placed in between a pair of electrodes kept in a processing chamber where the food is treated.11
PEF system
A pulsed electric field (PEF) supply unit also called a pulse power source is designed for 40 kV using high dielectric constant capacitors. It is made to charge in parallel and discharged in series through a very low inductance. The heart of the unit is the Pulse Forming Network (PFN) which has a HV power supply unit, a pulse forming unit, a filtering network and a main spark gap switch. The control unit is designed to have a trigger generator that generates a trigger pulse in response to a +5V command which initiates the spark gap discharge automatically. The system is designed to have a minimum load of 50 ?. The 50 ? resistor is selected to avoid loading problems when high concentration juices or salt solutions are processed. A kilovolt meter (analogue) is inbuilt to record the voltage and a digital storage oscilloscope is used to record the pulse shape. An energy meter is also incorporated into the system to record the energy consumed after each trial. The schematic arrangement of the PEF system is shown in figure 1.
PEF chamber
A lab-scale PEF chamber is designed using an acrylic sheet embedded with two circular food-grade stainless steel electrodes. The PEF chamber consists of a fill valve, drain valve and adjustable electrodes. The active PEF region can be varied by adjusting the distance between the electrodes. The diameter of the electrodes is designed as 9.5 cm. The PEF chamber is designed for batch processing which can hold approximately 100 ml of liquid food.
The raw milk is treated at different pulse rates and different voltage levels. The parameters (voltage, distance between electrodes, and the number of pulses) are standardized by conducting many trials and by undergoing platform tests, chemical analysis, microbial analysis and nutrient analysis. The raw milk is treated with standardized parameters and packed using different packaging materials.
Packaging materials
Food packaging plays an important role in extending the period during which the processed food will remain safe. The shelf-life of the PEF processed food product can be extended using packaging materials that are less sensitive to oxygen exposure. Some authors have reported that the headspace has higher oxygen concentration with more diminished Vitamin C levels.12 A technique called Modified Atmosphere Packaging (MAP) is used to regulate oxygen concentration in the headspace.
The factors which influence the degradation of flavour compounds are (i). oxidation, (ii). susceptibility of materials used for packaging to permeate through and absorb flavour compounds. The rate of absorption is more if both the flavour compound and the materials used for packaging have similar chemical structural configuration or similar polarity.13 For example, the volatile flavour compounds such as d-limonene and α-pinene of orange juice are more easily absorbed by low-density polyethene (LDPE) due to the strong affinity of the non-polar hydrocarbon of LDPE to the non-polar terpene hydrocarbons present in the juice.14 However, the packaging materials can be so designed with low diffusivity and solubility to reduce the absorption of the fresh volatile flavour compounds of HV electric pulses treated food. The other polymer elements like polyvinylidene chloride (PVDC), polyethene terephthalate (PET), and ethylene vinyl alcohol (EVOH) do not easily absorb the volatile flavour compounds. The EVOH is commonly used in food packaging to help keep the air out and the flavour compounds in. However, the period during which the processed orange juice will remain safe is reduced due to the presence of oxygen in the package headspace.15 The oxygen concentration can be limited in headspace using the Modified Atmosphere Packaging technique for extending the shelf-life of foods treated by short-duration HV electric pulses.
Another effective technology used for the preservation of high voltage treated foods in the liquid state is Aseptic food packaging which can extend the shelf-life of HV treated foods compared to that of the conventionally processed food products.16,17 The aseptic food packaging technique employs plastics and laminated paper as packaging materials. However, the extension of the initial high quality of flavour, colour, and nutrients of HV electric pulses treated food products depends on the proper selection of packaging materials. Some authors have proposed Polyethylene as a packaging material that can provide a low barrier to oxygen.18-20 But this low barrier property of polyethene may cause instability of vitamins and the flavour compounds in the processed food products.18
Some authors reported that vitamin C, colour, and flavour compounds of HV treated food can be effectively maintained at 40C for 112 days if the HV treated food is preserved in glass bottles and polyethene terephthalate (PET) bottles in which the concentrations of vitamins are higher than that in high-density polyethene (HDPE) or LDPE bottles.12
Packaging materials used for the study
The packaging materials used for the study are glass bottles, metal tins, Poly Ethylene pouches and Retort pouches respectively. The glass bottles of 200 ml capacity are sterilized in a hot air oven at 1600C for half an hour. The processed samples are aseptically collected in sterile glass bottles, corked and stored in 40C cold rooms as shown in figure 2(i).
The lacquered tins (pull open type) of 80 mm diameter and 70 mm height are kept in a hot air oven for half an hour and the processed samples are filled aseptically and sealed using a canning machine and stored in a 40C cold room as shown in figure 2(ii). The LDPE plastic is the first grade of polyethene produced using a high-pressure process. Polyethene pouches of 200 ml capacity with 50-micron thickness are sterilized in ultraviolet (UV) light and the processed milk samples are collected aseptically and sealed using a band sealer and stored in 40C cold room as shown in figure 2(iii). Another type of food packaging called reportable pouch is made from a pre-fabricated multilayer laminate of flexible plastic and Aluminum metal foil. Here in this work, the dimension of the retort pouch consisting of Aluminium metal foil is 15 cm × 20 cm. Retort pouches of 200 ml capacity are sterilized under UV light and the processed milk samples are collected aseptically and sealed using a band sealer and stored in a 40C cold room as shown in figure 2(iv). The processed food products placed in retort packaging are sterile and shelf-stable.
Quality control tests conducted for PEF processed milk preserved in different packages
The temperature was recorded after each trial using a high sensitive thermocouple to check the rise in temperature after processing. The colour and odour were determined using 9 points Hedonic scale rating by 10 selected untrained panellists. A sample volume of 100 ml of processed milk sample was given to the panellists to give their ratings in comparison with the control. In five minutes of exposure of 5 ml of the processed milk sample in a test tube to a boiling water environment, the flakes/clots appeared on the inside of the test tube and they indicated positive for the test. A digital pH meter standardized using a pH buffer of 4.0, 7.0 and 9.2 was used to determine the pH value of the processed food at room temperature. The acidity in the milk was estimated by titration method using 0.1N NaOH solution. The titratable acidity which is the sum of natural acidity and developed acidity can be expressed in terms of percentage of lactic acid and was calculated using the values of ml 0.1 NaOH used, normality of 0.1N NaOH and ml milk solution used in this work.
A 10 ml of milk was pipetted out using a sterile pipette into a sterile Methylene Blue Dye Reduction Test (MBRT) test tube to which 1ml of methylene blue was added and closed with a sterile rubber cork. The test tubes were kept in the water bath at a temperature of 37±0.50C. Time taken for the reduction of methylene blue dye was observed. The time at which the blue colour disappeared was noted as MBR time. Total plate count was assessed for the processed and control samples of milk in different packaging materials during storage daily for 30 days. The samples were analyzed in triplicate following the methods of ISO 4833 for total plate count. Coliform was assessed for the processed and control samples of milk in different packaging materials during 30 days period of storage. The analysis of the milk samples was carried out in triplicate following the methods of ISO 16649 – 2 for coliform. The nutrients such as fat, protein, Solids-not-fat (SNF) contents and lactose were assessed in the PEF processed milk during its storage period using a milco scanner.
A 9 point Hedonic scale rating was used to measure the food acceptability. For sensory evaluation, colour, odour, and overall acceptability were assessed by selecting 10 untrained panellists. The 100 ml samples of all the processed milk samples were presented to the panellists. The preferred samples in comparison with untreated samples were rated by the panellists. The data were analyzed by a nonparametric test called Mann – Whitney U test for comparing the median of two populations that come from the same population. The test statistic is given by equation (4):
Where, U = Mann – Whitney U test statistic
n2 = first sample size; n2= second sample size
Ri = Rank for the observation from ith sample size
Packaging of PEF processed milk
The PEF processed milk is stored at 40C in packages of different materials as shown in figure 2. The stored samples were subjected to sensory, chemical and microbial analysis at regular intervals. As glass bottles are impervious to microorganisms, pests, moisture, oxygen and odours, they did not migrate and react with milk. Sensory attributes, chemical and microbial analysis revealed a shelf life of 27 days. The tins used were double seam with push-on lids which are used to make canned foods. As the tins are impermeable to moisture, odours, light and microorganisms, the shelf life extended to 25 days. A retort pouch is made from a laminate of flexible plastic and metal foils.19 The pouches were kept under UV light before packing. Its shelf life extended to 22 days. Polyethene pouches were relatively permeable to oxygen and the shelf life of the PEF processed milk stored in polyethene pouches extended to 22 days.20-21
RESULTS AND DISCUSSION
Shelf-life studies of milk collected from different sources and stored in different packages
The following figure 3 shows the comparison between different packaging materials for milk samples collected from six different places around Alamathy Redhills village. The horizontal axis represents packaging materials and the vertical axis represents the storage period in days. The processed milk samples are compared with untreated milk samples.
Statistical analysis
In the statistical analysis of the milk sample, the distance between the electrodes, the voltage level, the number of pulses, and pulse frequency are taken as independent variables. The microbial load and shelf-life of milk samples are considered as dependent variables. The impact of packaging materials during shelf life studies is analyzed using a Two-way Analysis of variance (ANOVA) that tests the effect of two independent variables (control and processed samples) on a dependent variable (days). Table I shows the comparison of different packaging materials concerning the storage period for untreated and processed milk samples. Table II gives the data generated by the ANOVA test. Table III shows the comparison between the packaging materials based on the Tukey HSD test. Table IV illustrates the homogeneous subsets ‘a’ and ‘be for different packaging materials based on Tukey HSD and Duncan’s multiple range test with a 5% level of significance.
Table II: Data generated by ANOVA test
‘a’- Correlation coefficient = 0.936 (Adjusted value of Correlation coefficient = 0.924).
‘df’- degrees of freedom, ‘Sig.’- Significance
The error in Mean Square is calculated as 8.058 based on observed means.
Table III: Comparison between the different packaging materials based on Tukey HSD test
Dependent variable: days
Statistical analysis was carried through average and percentage analysis. Two-way ANOVA test was carried out by keeping the days as dependent variables and all the other facts as independent variables. Duncan’s multiple range test was conducted to find the homogenous subsets.
Statistical analysis demonstrates that the packaging materials differ significantly between them. The shelf-life of milk in glass bottles showed a significant difference when compared to tins, polyethene sachets and retort pouches. But, the retort and polyethene sachets do not differ significantly. Glass bottles attained a maximum shelf-life followed by tins. The fitness of the model is reflected through the ‘F’ value which is significant at the 1% level. The independent variable (control sample and processed samples) also show significant variations across the four different groups which are also reflected through the ‘F’ values at a 1% level of significance. From homogenous subsets, Polyethylene, Retort and tins do not differ significantly at a 5% level of significance. Group 1 (Glass bottles) has a significant difference when compared to the other packaging materials such as Polyethylene, Retort and Tin.
CONCLUSION
The raw milk procured from nearby villages was processed using a pulsed electric field system and its shelf life was investigated using four different packaging materials. A voltage level of 35 kV/cm and 600 square pulses of pulse width 2.5 µsec enhanced the shelf-life to 28 days when stored in glass bottles. During the shelf-life studies in different packaging materials, it was observed that there was a significant difference between glass bottles and the other packaging materials. Among the four packaging materials, glass bottles exhibited a greater shelf-life followed by tins, retort pouches and polyethene sachets.
ACKNOWLEDGEMENT
The authors acknowledge the help provided by Kwality milk foods, Kanchipuram for microbiology work and quality control lab, Aavin, Ambattur for nutrient analysis for the processed milk samples. The authors acknowledge the help provided by Dr. Z. H. Sholapurwala, Managing Director, Zeonics Systech Defence and Aerospace Engineers in carrying out the work in Pulsed Electric field Processing. Authors acknowledge the help provided by Dr. D. Ramasamy, Professor and Head, Department of Food Science and Technology, College of Food and Dairy Technology, Koduvalli, Chennai 600 052 in rendering the information about packaging materials.
Conflict of Interest: The authors declare no conflict of interest associated with this work.
Source of Funding: There is no external funding agency associated with this article.
Ethical Clearance: No experiment was done on humans or animals.
Authors Contribution: Dr. G. Sujatha, Dr. T. Sivakumar, and Dr. D. Murali contributed to the design and implementation of the research work.
Englishhttp://ijcrr.com/abstract.php?article_id=4068http://ijcrr.com/article_html.php?did=4068[1] Barbosa-Canovas GV, Swanson BG, Pothakamury UR, Gongora-Nieto MM, Canovas. Preservation of Foods with Pulsed Electric Fields. Chapter 6. Academic Press. London. 1999;156–171.
[2] Min S, Evrendilek GA, Zhang HQ. Pulsed Electric Fields: Processing System, Microbial and Enzyme Inhibition, and Shelf-life Extension of Foods. IEEE Trans on Plasma Sci. 2007;35(1):59-73.
[3] Kumar Y, Patel KK, Kumar V. Pulsed Electric Field Processing in Food Technology. Int J Engg Studies and Tech Appr. 2015;1(2):6-16.
[4] Syed QA, Ishaq A, Ur Rahman U, Aslam S, Shukat R. Pulsed Electric Field Technology in Food Preservation: A Review, J Nutri Health & Food Engg. 2017;6(5):168-172.
[5] Siemer C, Aganovic K, Toepfl S, Heinz V. Application of Pulsed Electric Fields in Food, Conventional and Advanced Food Processing Technologies. 2014;645-672.
[6] Toepfl S, Siemer C, Saldana-Navarro G, Heinz V. Overview of Pulsed Electric Fields Processing for Food. Chapter 6, Emerging Technologies for Food Processing (2nd Edi.), 2014;93-114.
[7] Mohamed ME, Amer Eiss AH. Pulsed Electric Fields for Food Processing Technology. Structure and Function of Food Engineering, Eiss AA. Ed. IntechOpen. London. 2012;11:275-306.
[8] Nowosad K, Sujka M, Pankiewicz U, Kowalski R. The Application of PEF Technology in Food Processing and Human Nutrition. J Food Sci. and Tech, 2020;1-15.
[9] Prihatini R, Saleh NM. The Stimulated Growth of Tissue Cultured Banana and Slipper Orchid as Exposed to Extremely Low Frequency Electromagnetic Field. Int J Design & Nature and Ecodyn. 2020;15(4):491-497.
[10] Pizzichemi M. Application of Pulsed Electric Fields to Food Treatment. Nuclear Physics B – Procs. Supplements. 2007;172: 314-316.
[11] Qin BL, Pothakamury UR, Barbosa-Canovas GV, Swanson BG. Nonthermal Pasteurization of Liquid Foods using High-intensity Pulsed Electric Fields. Crit Rev Food Sci and Nutri. 1996;36(6): 603-627.
[12] Ayhan Z, Yeom HW, Zhang QH, Min DB. Flavour, Color, and Vitamin C Retention of Pulsed Electric Field Processed Orange Juice in Different Packaging Materials. J Agri Food Chemis. 2001;49(2):669-674.
[13] Landois-Garza J, Hotchkiss JH. Plastic Packaging can cause Aroma Sorption. Food Engg. 1987;4: 39-42.
[14] Islam MA, Ahmad SA, Sarkar A. Biochemical Composition and Shelf Life Study of Mixed Fruit Juice from Orange and Pineapple. J Envir Sci and Natural Res. 2014;7(1): 227-232.
[15] Balasubramanian S, Sharma R. Aseptic Packaging of Food and Food Products. Processed Food Industry, 2009;1-7.
[16] Piringer OG, Baner AL. Plastic Packaging Materials for Food: Barrier Function, Mass Transport, Quality Assurance, and Legislation. Wiley, 2008;79-95.
[17] Van Willige RWG, Linssen JPH, Voragen AGJ. Influence of Food Matrix on Absorption of Flavour Compounds by Linear Low-density Polyethylene: Proteins and Carbohydrates. J Sci of Food and Agri. 2000;80(12):1779-1789.
[18] Indian Standard Polyethylene Pouches for Packaging Liquid Milk - Specification (Second Revision). BIS 2007, 1-4.
[19] Ahvenainen R. Novel Food Packaging Techniques, A Volume in Woodhead Publishing Series in Food Science, Techn Nut. 2003.
[20] Botina ABL, Garzia MMC, Romero BY. Pre- and Post-harvest Factors that Affect the Quality and Commercialization of the Tahiti Lime. Scientia Horticulturae, 2019;257:1-10.
[21] Lu J, Xiao J, Da-Jin Y, Zhu-Tian W, Jiang D, Fang CR, Yang J. Study on Migration of Melamine from Food Packaging Materials on Markets. Biomed Envt Sci. 2009;22(2):104–108.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareChronic Fluorosis: A Disease of Concern
English5155Mendez DCEnglish Shashidhar KNEnglishIntroduction: Chronic fluorosis is a widespread disease caused by ingestion of high levels of fluoride through drinking water and food. Fluoride content in food depends on its concentration in water, soil and air. Aim: This review article is aimed at providing information about fluorosis and its ill effects. Objective: The objective is to address the adverse effect of fluoride on several organ systems besides the more commonly known skeletal and dental manifestations. Methodology: A detailed search of related literature has been carried out with the help of search engines. Pub Med and Research gate have been used for obtaining authentic information. Discussion and Conclusion: This review article summarizes the major deleterious health problems caused by fluoride and emphasizes that fluoride mitigation needs to be practised widely since fluorosis is a preventable disorder.
EnglishFluoride, Fluorosis, Toxic effects, Diabetes, Thyroid abnormalities, Cardiovascular systemIntroduction
The 13th most abundant element in the earth’s crust is Fluorine.1It is only a microelement for human health but is one of the most significant endotoxins which appear in the environment.2 Fluoride is one of the few elements that have been shown to cause significant effects by various means such as through drinking water, air, dental products, food and beverages. Excessive fluoride in water and soil is mostly of geological origin which can be further compounded by over-exploitation of groundwater resources and Industrial pollutants.
After absorption from the gastrointestinal tract (GIT), the ability of fluoride ions to easily penetrate the cells through the membrane results in affecting various functions by altering the activity of enzymes and hormones.3,4Fluoride not only accumulates in the bones and teeth but also gets deposited in the soft tissues.5 The level of fluoride, considered safe for humans is 1-1.5 mg/L while, prolonged ingestion is associated with dental fluorosis, skeletal fluorosis and several other disorders due to its ability to inhibit the proliferation of cells. It should be noted, however, that whileMicromolar Fluoride ion concentrations promote the growth and proliferation of cells, millimolar concentrations suppress cell proliferation and induce apoptosis in the hard tissues.6-9]. Many metals such as lead, copper and manganese can interact with Fluoride ion and contribute to increased accumulation of toxic elements and micronutrient deficiency in mammals.10,11
Effect on bones and teeth
Fluoride has proved to be highly effective in the prevention of dental caries. It gives long-lasting protection against dental decay. Regular fluoride exposure at the time of teeth development contributes to protection against dental decay. Plaque bacteria form organic acids, which dissociate releasing H+ ions and lower the pH in areas surrounding the tooth and finally leads to the release of calcium from the tooth.12Fluoride inhibits this demineralization and thus has a dental caries protection potential. Fluoride also has an antimicrobial effect as it inhibits carbohydrate metabolism in oral streptococci and lactobacilli as it inhibits the enzymes enolase and adenosine triphosphatase.13,14Though, it has beneficial effects on teeth and bones when present in low concentrations, excessive intake gives rise to adverse effects from dental fluorosis to the crippling skeletal fluorosis depending on the level of fluoride and the period of exposure. As the fluoride ion is strongly electronegative, it is attracted to the positively charged Ca ions in the teeth and bones.15 Fluoride alters the resorption of bone tissue and affects the homeostasis of bone mineral metabolism. Fluoride ion reacts with crystals of hydroxyapatite and forms a scaffold for the bones. A combination of osteosclerosis, osteomalacia and osteoporosis in varying degrees characterizes the bone lesions.16
The high affinity of Fluoride ion to mineralized tissues results in the high Fluoride ion concentrations in bones and teeth and so these materials are used as a bioindication of long term exposure to Fluoride.17,18 the earliest sign of chronic fluoride exposure is the characteristic mottling of dental enamel.
Effect on Thyroid Function
Excessive amounts of Fluoride interfere with the functioning of the thyroid gland. The thyroid gland is the most sensitive organ to the effect of fluoride.19
Since fluoride is more electronegative than iodine, it easily displaces iodine and thus affects the functioning of the thyroid gland. It is regulated by a negative feedback mechanism i.e. when the pituitary gland senses a drop in F T3levels in circulations; it releases more TSH which stimulates the thyroid gland to accelerate the production of T4. The Source of T3 is from peripheral deiodination of T4. The enzymes which bring about deiodination are known asiodothyroninedeiodinases and fluoride interfere with the activity of the deiodinases.20,21Thus, Fluoride increases the concentration of TSH and decreases the concentration of T3 and T4 hormones.
Effect on thyroid function was associated with a fluoride exposure level of 0.05 – 0.13 mg/kg/day when iodine intake was adequate and 0.01 – 0.03 mg/kg/day when iodine intake was inadequate.22
Effect on melatonin production
Animal studies on the effect of fluoride exposure to pineal glands show that it results in altered melatonin production and acceleration of sexual maturity. The reduced Melatonin production can impair the sleep-wake cycle. However, no studies on humans have been demonstrated.23, 24
Effects on Insulin secretion and Diabetes
Various studies have shown that insulin resistance in humans develops due to chronic fluoride exposure.23,24 Impaired glucose metabolism is associated with a serum fluoride concentration of 0.1 ppm or greater.25,26 Hyperglycemia induced by fluoride is mainly due to an increase in hepatic glycogenolysis.27 Fluoride inhibits the glycolytic pathway by inhibiting enolase resulting in increased accumulation of two phosphoglycerates which is equilibrated by three phosphoglycerate enzymes being phosphoglucomutase. As a result, blood glucose levels increase.28 Moreover, diabetic patients tend to consume larger quantities of water and this further leads to fluoride accumulation.29 This in turn leads to impaired renal function, increased capillary permeability and microcirculatory defects.30,31Invitro experiments on isolated Islets of Langerhans cells showed that the basal, as well as glucose-stimulated insulin, was found to be repressed as the fluoride concentration was increased.31
Fetal defects
Fluoride can cross the placental barrier into fetal tissue. It can affect the fetal brain tissue and this can cause neurological damage, neuronal degeneration and reduced secretion of norepinephrine. Fluoride also disrupts nerve cell receptors which can result in neural dysplasia.32 Fluoride has been found in the amniotic fluid in pregnant women living in areas of high fluoride concentrations and this result in fetuses being exposed to elevated fluoride levels.33
In mammalian cells, fluoride causes genetic damage through chromosomal aberrations at cytotoxic concentrations (≥10 mg/L) which may be due to the interaction of enzymes responsible for DNA synthesis or repair.34
Effect on brain
A few epidemiological studies have shown lowered IQ levels in children exposed to 2.5 to 4 mg/L of fluoride in drinking water.35 Fluoride also tends to increase free radical production in the brain which may have a bearing in increasing the risk of developing Alzheimer’s disease and dementia.22,36 Experiments on mice have shown that chronic exposure to Fluoride brings about changes in learning, memory as well as neuropathological injury. It also raised the number of senile plaque, decreased levels of synaptic proteins and caused inflammation in the brain. This in turn could lead to an increased risk.37
Effect on Reproductive health
Lowered fertility rates have been implicated with increased fluoride levels as prolonged fluoride exposure is associated with increased levels of follicle-stimulating hormone (FSH) and luteinizing hormone (LH) and brings about decreased estrogen levels.38-40
Prolonged exposure to fluoride also leads to decreased testosterone levels and delay in its conversion to potent metabolites, disturbed androgen to estrogen rations as well as estrogen receptor to androgen receptor ratios.40 This effect on reproductive health is further compounded due to reduced thyroid hormones.41,42
Haematological effects
Chronic fluoride exposure brings about haematological effects such as anaemia, eosinophilia and dysplastic changes on granulocytes in the bone marrow.43Fluoride is also known to destroy probiotics in the gut, resulting in decreased production of Vitamin B12 which is required for Hemoglobin synthesis.44
Effect on Renal system
The kidney has a major role to play in the excretion of fluoride and the kidney tubules are also damaged due to uptake of fluoride.45 Prolonged exposure to high levels of fluoride increases the probability of developing renal diseases due to the structural and functional changes in the kidney such as swelling, degeneration of tubular epithelium, fibrosis and tubular necrosis. This in turn leads to increased serum creatinine and urea nitrogen.46
Effects on Gastrointestinal tract (GIT)
High concentrations of fluoride react with hydrochloric acid in the stomach to form hydrogen fluoride. The excessive formation of hydrofluoric acid results in irritation of the gastric mucosa.47As, Fluoride also stimulates secretion of gastric acid this, will diminish the blood supply in the stomach lining, resulting in death of epithelial cells in the GIT. Though, this observation has not been well documented in humans, adverse GIT symptoms are seen in areas of endemic fluorosis especially when the quality of nutrition is poor.48
Central Nervous System
Fluoride can cross the blood-brain barrier before birth and is believed to affect mental development. This can result in learning disorders and decreased intelligence in children. Reports of decreased levels of neurotransmitters have been seen in fluoride endemic areas.49
Fluoride brings about degenerative changes in the neural tissue which can lead to decreased memory and learning ability.46 The effect may be further compounded by deficiency of some elements such as iodine or the presence of other neurotoxic compounds as pollutants.49
Effect on Immunity
Chronic fluoride exposure affects cell-mediated and humoral immunity as it destroys white blood cell energy reservoirs thus affecting phagocytosis and inhibition of antibody formation.46
Effect on Reproductive system
The effect of fluoride on the reproduction system has not been investigated in detail though fluoride was indicted for decreased birth rates.50In one study, an interesting observation was that organic farmers who avoided pesticides were found to have double the average sperm density when compared to other farmers who used pesticides treated with fluoride.51High Fluoride levels are also known to be associated with reduced Testosterone levels.52
Effect on Cardiovascular system
Chronic fluoride exposure promotes inflammatory mechanisms. This in turn can lead to atherosclerosis and myocardial cell damage as oxidative stress, along with inflammation are important mechanisms involved in ischemic stroke. Fluoride also interferes with numerous enzymes resulting in elevating the risk factors for cardiovascular diseases besides, causing degeneration of the heart muscle.53-55 ECG of patients with dental fluorosis showed that a significant percentage of them had abnormal heart rhythms.56,57
Anaesthetic concerns in chronic fluorosis
In patients with fluorosis, there may be difficulty in intubation during anaesthesia due to the rigid cervical spine which is compounded with the limitation of movements of the intervertebral joints.58,59 There is also a greater degree of risk for postoperative respiratory complications due to restricted chest movement.58-60
Conclusion
Though fluorosis is a preventable disorder, it is unfortunately linked to several abnormalities which require attention. The various linked disorders of fluorosis need to be addressed. Combating fluorosis can be achieved by bringing about awareness, motivating and disseminating knowledge to the public on the avoidance of fluoride contaminated drinking water, arrangements of alternate sources of water, provision of fluoride-free drinking water, improving nutritional status and health education. Though some progress has been made, there is still a lot left to do. This review article is an attempt to disseminate information among medical practitioners and public health specialists.
Acknowledgements –
We gratefully acknowledge the scholars and scientists who have worked in the field of fluoride research and whose articles we have cited and included as references.
Conflict of interest –
The authors declare that there is no conflict of interest.
Source of funding - Nil
Englishhttp://ijcrr.com/abstract.php?article_id=4069http://ijcrr.com/article_html.php?did=40691) Paasivarta J. Long-term effects of bioaccumulation in ecosystems. In: Beck B editor.The handbook of Environment Chemistry.Berlin: Springer Publication;2000.p201-33.
2) Arlappa N, Aatif IQ, Srinivas R. Fluorosis in India: An overview. Int J Res Dev Health. 2013; 1: 97-102.
3) Birknew E, Mamczar EG, Kasperczyk S, Kasperczyk A, Pieta BS, Fiolka JZ et al. The influence of fluoride ions upon selected enzymes of protein metabolism in the blood plasma of rabbits with hypercholesterolemia.Biological Trace Elements Research2008; 124: 118-28.
4) Wu C, Gu X, Wu Y and Wang J. Effects of fluoride and arsenic on serum thyroid hormones in rats. J Herbal Med Toxic. 2008; 2: 39-43.
5) Cinar A, Selcuk M. Effects of chronic fluorosis on Thyroxine, triiodothyronine and protein-bound iodine in cows. Fluor. 2005; 38: 65-68.
6) Fawell J, Bailey K, Chilton J, Dahi E, Pewtrell L, Magara Y editors. WHO Drinking Water Quality Series, Fluoride in drinking water; 2006 Nov 21, Geneva Switzerland: IWA Publishers London UK; 2006.
7) Fordyce FM, Vrana K, Zhovinsley E, Povoroznuk V, Toth G, Hope BC et al.A health risk assessment for fluoride in Central Europe. Envt Geochem Heal. 2007; 29: 83-102.
8) Teotia SPS, Teotia M. Secondary hyperparathyroidism in patients with endemic skeletal fluorosis. Br Med J. 1973; 1: 637-40.
9) Agalakova NI, Gusev GP. Molecular mechanisms of cytotoxicity and apoptosis induced by inorganic fluoride. ISRN Cell Biology 2012; 1: 1-16.
10) Sawan RM, Leite GA, Saraiva MC, Barbosa F, Tanus-Santos JE, Gevlach RF. Fluoride increases lead concentrations in whole blood and in calcified tissues from lead-exposed rats. Toxic. 2010; 271: 221-226.
11) Singh M, Kanwar KC. Effect of fluoride on copper, manganese and zinc in bone and kidney. Bull Envt Contam Toxic. 1981; 26: 428-31.
12) Dawes C. What is the critical pH and why does a tooth dissolve in acid. J. Can Dent Assoc. 2003; 69: 722-24.
13) Balzar ES, Linder LE, Sund ML, Lonnies H. Effect of fluoride on glucose incorporation and metabolism in biofilm cults of Streptococcus mutans. Eur J Oral Su. 2001; 109: 182-86.
14) Sulton SV, Bender GR, Marques RE. Fluoride inhibition of proton – trans locating AT Pases of oral bacteria. Infect Immun. 1987; 55: 2597-2603.
15) Teotia SPS, Teotia M, Singh KP. Highlights of forty years of research in endemic skeletal fluorosis in India.Proceedings of 4th International Workshop on Fluorosis Prevention and Defluoridation of Water;2004 Mar 2-6; Colombo, Sri Lanka.p107-125.
16)Tamer MN, Koroglu KB, Arslan C. Osteoscleorosis due to endemic fluorosis. Sci Total Envt. 2007; 373: 43-8.
17) Kay CE, Tourangean PC, Gordon CC. Fluoride levels in indigenous animals and plants collected from uncontaminated ecosystems. Fluoride 1975; 8: 125-33.
18) Bezerra de Menezes LM, Volpato MC, Rosalen PL, Curry JA. Bone as a biomarker of acute fluoride toxicity.For Sci Int.2003; 137: 209-214.
19) Shashi A. Biochemical effects of fluoride on thyroid gland during experimental fluorosis. Fluoride 1988; 21: 127-130.
20) McLaren JR. Possible effects of fluoride on the Thyroid. Fluoride 1976; 9: 105-116.
21)Visser JT, Peeters RP. Clinical summary. Proceedings of Annual Meeting of Endocrine Society; 2012 27 Apr-May 01; Boston Massachusetts USA: 2012; 9(4); 734-43.
22) Pratap D, Singh D. Impact of fluoride on the environment and human health.Int J science, Spirit, Bus Tech. 2013; 1(2): 56-61.
23) Rasmussen DP, Boldt BM, Wilkinson CW, Yellon SM, Matsumoto AM. Daily Melatonin administration at middle age suppresses male rat visceral fat, plasma leptin and plasma insulin to youthful levels. Endocrin. 1999; 140: 1009-12.
24) Bharti VK, Srivastava RS, Kumar H, Baig S, Majumdar AC, Singh G et al. Effects of Melatonin and Epiphyseal Proteins on Fluoride - Induced Adverse Changes in Antioxidantstatus of Heart, Liver and Kidney of Rats. Adv Pharmac Sci [Internet] 2014 Mar 26 [cited 2017 Dec 01]; Available from: https://doi.org/10.1155/2014/532969
25) National Research Council.Fluoride in drinking water.A scientific review of EPA’s standards.2006 Mar. Washington DC National Academies Press US; 2006 [Internet] Available from: https://doi.org/10.17226/11571 [Accessed on 09.11.2020].
26) Anticaries drug products for over the counter human use. Code of Federal Regulations 21 CFR Part 355. 1999 Mar 01; 282-85.
27) Varadacharijulu NC, Rao PR. Gluconeogenesis and glycogenolysis in fluoride-treated rats. Indian J. Exp. Biol 1997; 35: 906-908.
28) Qin J, Chai G, Brewer JM, Lovelace LL, Lebioda L. Fluoride inhibition of Enolase: crystal structure and thermodynamics. Biochemistry 2006; 45: 793-800.
29) Prystupa J. An NRC and AT SDR-based review of safety standards for exposure to fluorine and fluorides. Toxicology Mechanisms and MethodsFluorine2011; 21: 103-70.
30) Banupriya CAY, Anita K, Muralimohan E, Pillai KS, Murthy PB. Toxicity of fluoride to diabetic rats.Fluoride. 1997; 30: 43-50
31) Rigalli A, Ballina JC, Puche RC. Bone mass increase and glucose tolerance in rats chronically treated with sodium fluoride. Bone Miner 1992; 16: 101-108.
32) Yu Y, Yang W, Dong Z, Wan C, Zhang J, Liu J et al. Neurotransmitter and receptor changes in the brain of fetuses from areas of endemic fluorosis. Fluor. 2008; 41: 134-38.
33)Uyghurturk DA, Goin DS, Den Besten PK. Maternal and Foetal exposure to Fluoride during mid-gestation among pregnant women in Northern California. Envt Health. 2020; 19 (38): 1- 22
34) Pawar AC, Naik JK, AnithaKumari S. Cytogenetic analysis of Human Lymphocytes of Fluorosis affected men from Endemic Fluorosis region in Nalgonda District of Andhra Pradesh. Fluoride 2014; 47 (1): 78-84.
35) Shivaprakash PK, Ohri K, Noorani H. Relation between dental fluorosis and intelligence quotient in school children of Bagalkot district. J. Indian SocPedodPrev Dent 2011; 29: 117-20.
36) Choi AL, Sun G, Zhang Y, Grandjean P. Developmental fluoride neurotoxicity; a systematic review and meta-analysis. Environ Health Perspect 2012; 120: 1362-68.
37) Cao K, Xiang J, Dong YT, Xu Y, Li Y, Song H et al. Exposure to Fluoride aggravates the impairment in learning and memory and Neuropathological lesions in mice carrying the APP/PSI double transgenic mutation. Alzheimer’s Res Ther. [Internet]. 2019 Apr [cited 2020 Jan 30]; 11(35): Available from :https://doi.org/10.1186/s13195-012-0490-3.
38) Ortez – Perez D, Rodriguez – Martinez M, Martinez F, Borja – Aburto VH, Castelo J. Fluoride induced disruption of reproductive hormones. Environ Res. 2003; 93: 20-30.
39) Tokar V, Savchenko ON. Effect of inorganic fluorine compounds on the functional state of the pituitary testis system.Probi.Endokinol1977; 23: 104-07.
40) Jiang CX, Fan QT, Cheng XM, Cui LX. Relationship between spermatogenic cell apoptosis and serum estradiol level in rats exposed to fluoride. Wei Sheng Yan Jiu. 2005; 34: 32-4.
41) Ando S, Sirrianni R, Forastieri P, Casaburi I, Lanzino M. Aromatic expression in prepubertal Sertoli cells: effect of thyroid hormone. Mol cell Endoc. 2001; 178: 11-21.
42) Pezzi V, Panno ML, Sirianni R, Forastieri P, Casaburi I. Effect of tri-iodothyronine or alternative splicing events in the coding region of cytochrome P450 aromatase in immature rat Sertoli cells. J Endocrinol 2001; 170: 381-393.
43) Eren E, Ozturk M, Mumcu EF, Canatan D. Fluorosis and its haematological effects. Toxicol and Health 2009; 21(10): 255-8.
44) Susheela AK, Toteja GS. Prevention and control of fluorosis and linked disorders: Developments in 21st century – Reaching out to patients in the community and hospital settings for recovery. Indian Journal of Medical Research2018; 148: 539-47.
45) Jha SK, Mishra VK, Sharma DK, Damodaran T. Fluoride in the environment and its metabolism in humans. Rev Envt Contam Toxic. 2011; 211: 121-42.
46) Ranjan R, Ranjan A. Fluoride toxicity in animals. In: Toxic effects: New York: Springer Publications;2015.35-51. Available from https://doi.org/10.1007/978-3-319-17512-6 [Accessed on 09.11.2020].
47) Akuy S, Yarat A, Alturfan EE, Kaya S. Fluoride in saliva and its impact on health.In:Preedy VR, editor. Fluorine London: Royal Soc Chem. 2015. 173- 85.
48) Ozsvath DL. Fluoride and environmental health: a review. Rev. Environ Sci Bio Technol. 2009; 8: 59-79.
49) Valdez – Jimenez L, Fregozi CS, Beltran MM, Coronado OG, Vega MP. Effects of fluoride on the Central Nervous system.Neurologia. 2011; 26: 297-300.
50) Freni SC. Exposure to high fluoride concentrations in drinking water is associated with decreased birth rates. J Toxic Envt Health. 1994; 42: 109 – 121.
51) Stannard JG, Shim YS, Kritsineli M, Labropoulou P, Tsmatsouris A. Fluoride levels and fluoride contamination of fruit juices. J Clinical Pediatric Dent. 1991; 16 (1): 38- 40.
52) Liu Y, Tellez Rojo M, Hu H, Sanchez BN, Martinez-Mier EA, Basu N et al. Fluoride exposure and pubertal development in children living in Mexico City.Environmental Health [Internet].2019 Mar 29 [cited 2019 Aug]; 18(26):Available from: https://doi.org/10.1180/s12940-019-04657
53) Lakhan SE, Kirchgessner A, Hofer M. Inflammatory mechanisms in ischemic stroke: Therapeutic approaches. J. Translational Med. 2009: 17(7): 97.
54) Profumo E, Button B, Rigano R. Oxidative stress in cardiovascular inflammation: Its involvement in autoimmune responses. Int. J. Inflam [Internet]. 2011 Jun 28 [cited 2014 Apr 11];Available from:https://doi.org/10.4061/2011/295705
55) Pain G. Fluoride causes Heart disease, Stroke and Sudden Death. Exposing corruption in the Fluoridation Industry [Internet].2016 Sep 09 [cited 2017 Jan 10]; Available from: https://doi.org/10.13140/RG.2.1.3973.88647
56) Zhou QH, Zhang DC.Electrocardiogram analysis of 271 dental Fluorosis cases. Chen J Epidemiol. 1988; 5: 296-7.
57) Karademir S, Akcam M, Kuyubulu AE, Olgar S, Oktem F. Effects of Fluorosis on QT dispersion, Heart rate variability and Echocardiographic parameters in Children. Anatolian Journal of Cardiology 2011; 11: 150- 5
58) Saxena HN, Mehta Y, Trehan N. Anaesthesia and fluorosis. Anaesthesia 1999; 54: 96-7.
59) Rao M, Menon K. Anaesthetic management for cervical laminectomy in patients of skeletal fluorosis. J Anaesthesiol Clin Pharmacol.1987; 3: 207-10.
60) Reddy DR. Neurology of endemic Skeletal Fluorosis. Neurology Ind. 2009; 57(1): 7- 12.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareDevelopment of Novel Technique to Detect and Validate Pulmo Malignancy during Early Stages
English5660Dhanalakshmi REnglish Shree Harini REnglish Pravallika MEnglish Sankar SEnglishIntroduction: Lung carcinoma – Pulmonary disorders causes cancer-related death all over the world and in which majority due to cigarette smoking. With an increase in awareness about smoking being the major cause, other significant factors that play a vital role in causing the disease is unclear. There is no proper information among the public regarding the other symptoms which leads to identifying lung cancer in a later stage where it becomes incurable. Aims: The proposed system helps in early diagnosis, effective treatment and helps in creating awareness about the danger of lung cancer in occasional or non-smokers too. This system is to predict Lung Cancer at an early stage and validate the results using a CT scan. Methodology: An application that obtains user symptoms as input and prompts the user to upload a CT scan report of the lungs will be an efficient solution for early detection. This will aid in the early prognosis of the disease and effective treatment can be given. This application uses MATLAB to achieve its goal. Results: Among the various methods analyzed, Naive Bayes achieved an accuracy of 95.24% which proves to be a better solution for detecting Lung Cancer Conclusion: Thus, the proposed system has all the necessary features to detect lung cancer at an early stage thereby reducing the mortality rate and creating awareness among the public, of other parameters that are responsible for causing cancer.
EnglishPulmo Malignancy, Lung Cancer, Support Vector Machines, Prediction, Classification, Naive Bayes
INTRODUCTION
Modern medicine generates a great deal of information stored in medical databases. In today’s world, every individual is facing growing health issues that need to be cured quickly. The useful information which is generated by using current medicine is stored in a medical database. With continually increasing lung cancer in patients due to the high intake of tobacco and puff, predicting cancer in patients at an early stage is a huge issue for clinicians to make decisions. Since it is considered a taboo in some countries people fear coming forward to diagnose the disease, the best place to find the occurrence of the disease is by applying machine learning concept to create the predictive model by using the data collected in the hospital regarding the patients affected by lung cancer to predict lung cancer.
In the 21st century, the most important cause of death and a hurdle in the longevity of the human race are NCDs. Non-communicable diseases(NCDs) are responsible for cancer and death worldwide. Lung cancer is an extensive reason for deaths globally. Lung cancer: 2,093,876 cases and death caused by lung cancer: 1,761,007 cases. Epidemiological progression in India is been huge in the past decades. In India, there is a sharp increase in chronic diseases and cancer cases have a steady impact on the illness. The outlook of the ancient and religious Indian medical system has only a few known facts about cancer which is changing fast and varied too.6 In India, 70,000 new lung cancer cases are reported each year. A web-based application is developed to efficiently predict lung cancer using machine learning, acquire the factors that directly contribute to the disease and validate the results using a CT scan. This helps in early prognosis and effective treatment.
2. RELATED WORK
Predictive models are developed for cancer research which is effective and helps in making decisions precisely using techniques such as Bayesian networks, decision trees, artificial neural networks and support vector machines. Machine learning methods are proved to be effective in analyzing the progressive nature of cancer cells but a clear level of affirmation is needed to get implemented in regular clinical trials.
Kourou K et al. 10 presented an analysis report of the machine learning models in the field of cancer advancement. The different data samples and input features are used for different supervised machine learning techniques for the predictive models are reviewed. Krishnaiah et al. 9 suggested that naïve Bayes is the best model in predicting lung cancer in patients. If-then rule, decision trees and neural networks are later in the effectiveness of models. The results produced by decision trees are easy to read and understand. Decision trees are the only way to have a detailed analysis of patient profiles through the drill feature. But naïve bayes is the best as it can find all the important medical predictors compared to decision trees. To understand the relationship between attributes is very complex in neural networks. In order to enhance further, the prediction models can also be incorporated with other techniques such as association rules, clustering etc. Instead of categorical data, continuous data may be used. A large amount of unstructured data available in the health care industry can be mined. But the task is to define how to integrate text mining and data mining.
J Alam et al.6 proposed a contrasting technique to recognize and predict lung cancer which gives better outcomes. SVM classifies a set of textural features derived from separated ROIs. The input image is used to find the tumour cells and their likely growth by this algorithm. Results are encouraging wherein cancer identification stands at 97% and prediction stands at 87% with the help of the results, doctors can identify whether the lung is carcinogenic or not. by using a genetic algorithm and deep neural network, the accuracy of the system can be improvised by having a huge image set and arrangement in LIGHT.
Hafan Yang et al.7 explained that to have a lung cancer pathology report, a tissue sample is from the lung has to be taken through surgical biopsy. Replacing the pathology report with the clinical information of the patient will not put the health of a patient at risk. A correlation between pathology reports and the clinical information is derived using data mining techniques to give complete details on lung cancer pathologic staging diagnosis.
Kadir et al.8 proposed a model to achieve performance in classification, CNN skilled with deep learning. The performance of AUC produced well and gave excellent accuracy with given data, but with independent data, it produced poor results. The following steps are involved to classify are segmentation, feature extraction, risk score regression and threshold. This algorithm dominates pattern recognition, segmentation and classification in considering medical and non-medical fields. Convolution Neural Network out-based Support Vector Machine method and previous state-of-art texture (radiomics) analysis of KAGGLE – which permits users to obtain and publish data sets.
Data science competition winners who used CNN-trained data set using deep learning was done. Unlike AUC, the log loss function was used.11 Therefore, the likelihood of cancer using the ct images was predicted. However, no nodules were found in acceptance and data for testing, so the automated reliable nodule finding step is challenging and complex for classification. Good results are generated in prediction based on size but the concern is size bias. In CADx (Computer-Aided Detection and Diagnosis system), nodule size will be enclosed as a part of nodule implicitly or explicitly. Therefore the efficiency of the CADx system is based on unmatched data and size-matched. Since a small data set is used, an SVM algorithm is applied. The AUC resulted in 0.70 when all benign images were included and when all malignant images and randomly selected benign images were included. In conclusion, if evaluation of system performance is after awareness whether the data contains smoker or non-smoker and current or prior history of malignancy is included CNN performs with high accuracy. From the present works that have been carried out, it is inferred that the recent trend involved in the prognosis of cancer is using machine learning. Naive Bayes is observed to give good accuracy. Using these algorithms efficient prediction of the people who are prone to be affected by lung cancer is done. The above researches give insight into the early prognosis of lung cancer. Using image processing, CT images of patients can be used to validate the presence of lung cancer in the individual. This will create awareness and helps to obtain the factors other than smoking that has a major effect of causing lung cancer in the population.
3. MATERIAL AND METHOD
The major cause of lung cancer is smoking but there is no rule that nonsmokers may never develop. Cancer cells can spread to any section of the body, metastasize to the lymph nodes. When the cells in the lung grow irregularly and are completely out of control and affects the nearby section and form a lump is referred to as lung cancer.1
Lung cancer may involve any section of the respiratory system and could start in any part of the lungs. Two types of cancer cells in lungs as follows small cell lung cancers (SCLC) which has the nature to develop very fast and non-small cell lung cancers (SCLC) which is less likely to spread in other section. The main cause of lung cancer is with the environment such as exposure to second-hand smoke, arsenic, asbestos, radioactive dust, or radon.6 The chance of lung cancer increases with exposure to radiation at the workplace or anywhere. lung carcinogenic is greatly determined by the environment and genetic factors. the heritable contribution to the various histological subtypes is not known.4 the indications are very general such as coughing, shortness of breath, wheezing, pain in chest and mucus in red colour when you cough. so people do not go for further examination to doctor in suspecting lung cancer. When cancer is detected, it would have invaded other sections already and few symptoms as in Fig 1. The preliminary identification of lung cancer is done by ct scan or x-ray. Furthermore, evaluation is needed to find the type of cancer cells and to the extent, it has spread3. The doctor can verify the reports and find the stage which is a mechanism to specify the size of cancer its spread.
Data extraction
In data mining algorithms, the accuracy of prediction is improved with the help of an accurate and specific dataset. Therefore in this investigation, understanding information on Lung malignancy infection is utilized. The data is collected from the website Online Lung Cancer prediction System that gets feedback from the user. In this database, 16 highlights of 310 individuals 207 of whom are not beneficial), which are considered as the fundamental benefactors of the illness, in the process of correlations and groupings are performed with lung. The precise outcome of the data mining process depends on the attributes which are considered in the investigation of disease. attribute considered are gender, age, yellow finger, anxiety, peer pressure, chronic disease, fatigue, allergy, alcohol consumption, smoking, pain in the chest, blood when coughing, shortness of breath, difficulty in swallowing, wheezing is taken to consider for identifying the lung cancer.
MATLAB[Matrix Laboratory] has the facility to perform data preprocessing, classification of data set using Naive Bayes.5 The performance of this algorithm is analyzed using a confusion matrix. The presence or potentially the estimations of these parameters are firmly identified with the Lung malignancy data. feature reduction, class Currently available lung cancer CT image scans are obtained from an online resource: The Cancer Imaging Archive (TCIA). The images are preprocessed using feature selection and fine tuning13. Furthermore, a convoluted neural network algorithm is applied to the images and trained to classify benign and malignant tumours. The proposed workflow is given in Fig 2
Currently, available lung cancer CT image scans are obtained from an online resource: The Cancer Imaging Archive (TCIA). The images are preprocessed using feature selection and fine tuning13. Furthermore, a convoluted neural network algorithm is applied to the images and trained to classify benign and malignant tumours. The proposed workflow is given below in Fig 2
MODULE DESCRIPTION
The proposed workflow in Fig 1 consists of two important modules as Lung Cancer Prediction and Image Classification.
Lung Cancer Prediction
In this phase, the obtained information from the user is first processed and the Naive Bayes algorithm is applied. Based on it, the trained system gives out the result which is either positive or negative. If it is positive, the patient is likely to be affected by lung cancer, else fortunate with the absence of tumour.
Image Classification
The primary steps involved in image classification is image preprocessing, feature extraction, selection of training samples, identifying the appropriate classification algorithm, the processing involved after classification and accuracy estimation. The client data in regards to the symptoms of lung cancer will be the initial step. The application accumulates the information and is passed to the prediction module. The prediction module comprises four steps such as information preparing, assessment, testing with model and foreseeing results. The outcome is then displayed to the client. The user is given an option to submit the CT image of the lungs. The image is then fed into the classifier which processes the image and applies a classification algorithm to segregate the tumour either as benign or cancerous. The classified outcome is produced as an answer to the client.
EXPERIMENTAL ANALYSIS
The below table describes the performance analysis of the algorithm analyzes the accuracy score of the algorithms.
The typical efficiency of the current system is 90.2% and for the proposed framework, the higher precision accomplished is 95.24% utilizing Naive Bayes and practically 88% for the other algorithms. The performance is analyzed and gives the outcome for higher accuracy in the prediction of Lung Cancer.7
CONCLUSION
In this paper, an ingenious multi-layered way to combine prediction and classification methods to develop a cancer risk prediction is suggested. malignant growth has turned into the main cause of death all over the world. The best method to diminish cancer deaths is to detect it earlier. Individuals maintain a strategic distance from malignant growth screening because of the cost associated with stepping through a few examinations for determination. This forecast framework may give a simple and practical route for screening disease and may assume an essential job in the prior finding process for various kinds of malignant growth and give a compelling preventive system. Furthermore, the validation technique confirms the predicted results. This system gives direction for the specialists to target specific treatment for patients depending on the detailed historical record of the patients available in the medical clinics.
ACKNOWLEDGEMENT
We thank our colleagues and Physicians who provided insight and expertise that greatly assisted the research, although they may not agree with all of the interpretations/conclusions of this paper. We are also grateful to authors/ editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed
CONFLICT OF INTEREST AND FUNDING
There is no conflict of interest
CONTRIBUTION OF AUTHORS
R Dhanalakshmi for the idea and structuring this paper
M Thenmozhi for literature review
M Pravellika and Shree Harini for Implementation and Results
Englishhttp://ijcrr.com/abstract.php?article_id=4070http://ijcrr.com/article_html.php?did=4070
Broom A, Kenny K, Bowden V, Muppavaram N, Chittem M. Cultural ontologies of cancer in India. Critical Public Health. 2018 Jan 1;28(1):48-58.
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: Cancer J. Clin. 2018 Nov;68(6):394-424.
Carr SR, Akerley W, Cannon-Albright LA. Genetic Contribution to Nonsquamous, Non–Small Cell Lung Cancer in Nonsmokers. J Thorac Oncol. 2018 Jul 1;13(7):938-45.
Gnagnarella P, Caini S, Maisonneuve P, Gandini S. Carcinogenicity of high consumption of meat and lung cancer risk among non-smokers: a comprehensive meta-analysis. Nutrit Canc. 2018 Jan 2;70(1):1-3.
Alam J, Alam S, Hossan A. Multi-stage lung cancer detection and prediction using multi-class svm classified. In2018 International Conference on Computer, Communication, Chemical, Material and Electronic Engineering (IC4ME2) 2018 Feb 8 (pp. 1-4). IEEE.
Yang H, Chen YP. Data mining in lung cancer pathologic staging diagnosis: Correlation between clinical and pathology information. Expert Syst Applications. 2015 Sep 1;42(15-16):6168-76.
Kadir T, Gleeson F. Lung cancer prediction using machine learning and advanced imaging techniques. Translational lung cancer research. 2018 Jun;7(3):304.
Krishnaiah V, Narsimha G, Chandra DN. Diagnosis of lung cancer prediction system using data mining classification techniques. Int J Sus The. 2013 Apr;4(1):39-45.
Kourou K, Exarchos TP, Exarchos KP, Karamouzis MV, Fotiadis DI. Machine learning applications in cancer prognosis and prediction. CSBJ. 2015 Jan 1;13:8-17.
Sumathipala Y, Shafiq M, Bongen E, Brinton C, Paik D. Machine learning to predict lung nodule biopsy method using CT image features: A pilot study. Computerized Medical Imaging and Graphics. 2019 Jan 1;71:1-8.
Wakelee HA, Chang ET, Gomez SL, Keegan TH, Feskanich D, Clarke CA, Holmberg L, Yong LC, Kolonel LN, Gould MK, West DW. Lung cancer incidence in never-smokers. J Clin Oncol. 2007 Feb 10;25(5):472.
Johnson, M., Dhanalakshmi, R. Predictive Analysis based Efficient Routing of Smart Garbage Bins for Effective Waste Management.
Booma, P. M., Prabhakaran, S., & Dhanalakshmi, R. (2014). An Improved Pearson’s Correlation Proximity-Based Hierarchical Clustering for Mining Biological Association between Genes. The Scientific World Journal, 2014.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareClinical and Microbiological Profile of Diabetic Foot Infections in Inpatients at a Tertiary Care Hospital
English6164Dhanaleha PEnglish Anand MREnglish Jayapradha SEnglish Abarna VEnglishIntroduction: Chronic foot infections in patients with diabetes mellitus are a common and difficult problem. The optimal management of these diabetic foot infections requires isolation and identification of the various pathogens and selection of appropriate antibiotic therapy according to the sensitivity patterns. Aims and Objectives: To determine the prevalence of various bacterial pathogens in diabetic foot infections (DFIs). Materials and Methods: A retrospective analysis of the culture of bacterial isolates of pus, pus swabs and tissue samples obtained from diabetic patients admitted in surgical wards at SLIMS, were carried out over 4 years from August 2016 to September 2020. Results: Total growth constituted 131(95%) monomicrobial growth was 107 (78%) and polymicrobial growth was 24(17.5%). In our study, Gram-negative isolates were 77 (79%) with Pseudomonas spp being the most predominant. Most of the Gram-negative bacteria were found to be sensitive to amikacin (56.9%), imipenem (66.6%) and piperacillin-tazobactam (47.1%). Gram-positive isolates were 11 (11.3%) with Staphylococcus aureus being the most predominant. In our study Gram, positive isolates were sensitive to erythromycin (81.8%), ciprofloxacin (81.8%) and cotrimoxazole (54.5%). 100% sensitivity was observed with linezolid, teicoplanin and vancomycin. A total of 21 (27.3%) patients who presented with gangrene were amputated. Conclusion: There is an increase in the prevalence of organisms as Wagner’s grade increased with Gram-negative growth being more predominant. Frequent surveillance of antibiotic-resistant patterns would be useful for deciding empiric antibiotic therapy.
English Clinical and microbiological profile, Diabetic foot infections (DFI), Polymicrobial, Retrospective study, Sensitivity pattern, Wagner’s GradingIntroduction: Chronic foot infections in patients with diabetes mellitus are common and difficult to treat. Diabetic individuals have at least a 10-fold greater risk of being hospitalized for soft tissue infections of the foot than normal individuals. The diabetic population in India will be expected to increase to 57 million in 2025. 1The subcutaneous wounds have a likely chance of spreading into deeper tissues thus resulting in complications like gangrenous changes and amputations.3They usually complicate the initially uninfected ulcerations that follow minor trauma in patients with neuropathy resulting in chronic neuropathic ulcers and tissue necrosis or osteomyelitis with draining sinus.
Infection plays a major role in the development of moist gangrene. Pseudomonas spp, Enterococcus spp and Proteus spp are organisms that are responsible for extensive tissue destruction as there is poor blood circulation of the foot.
The optimal management of these diabetic foot infections requires isolation and identification of the various pathogens and selection of appropriate antibiotic therapy according to the sensitivity patterns. A retrospective study is carried out to find out the various bacterial pathogens in diabetic foot infections and their impact on the outcome of the patients.
Aims and Objectives: To determine the prevalence of various bacterial pathogens in diabetic foot infections (DFIs) and their susceptibility to antimicrobial agents. To investigate the microbiological profiles of DFIs concerning different grades of Wagner classification and outcome for DFIs.
Materials and Methods: A retrospective analysis of bacterial isolates from pus, pus swabs and tissue samples from diabetic patients admitted for surgical care was done covering a period of 4 years from August 2016 to September 2020. Processing of the samples for culture, bacterial identification and antimicrobial susceptibility pattern was done as per standard procedures.2A record of all samples received, details of the organism isolated along with its antibiotic sensitivity pattern for the first line and second-line agents are being maintained in the Microbiology laboratory analysis of grading of ulcers, risk factors and outcome of patients will be done from the records maintained in Medical Records Department. The results are represented in percentages.
Results: In this study among 137patients with DFI, 108 were male and 29 were female, the mean age distribution is 61-70 years. Total growth constituted 131(95%) monomicrobial growth was 107 (78%) and polymicrobial growth was 24(17.5%). The distribution of bacterial isolates according to Wagner’s grades were 10.3% in me, 14.4% in II, 25.7% in III,24.7% in IV and 24.7% in V(Table1, Fig1). In our study, Gram-negative isolates were 77 (79%) with Pseudomonas spp being the most predominant. Most of the Gram-negative bacteria were found to be sensitive to amikacin (56.9%), imipenem (66.6%) and piperacillin-tazobactam (47.1%)(Fig 2,3). Gram-positive isolates were 11 (11.3%) with Staphylococccus aureus being the most predominant. MRSAbeing 5.1%. In our study Gram-positive isolates were sensitive to erythromycin (81.8%), ciprofloxacin (81.8%) and cotrimoxazole (54.5%) (Fig 4).100%sensitivity was observed with linezolid, teicoplanin and vancomycin. A total of 21 (27.3%) patients who presented with gangrene were amputated. The level of amputation ranged from toes (n=16) to below-knee (n=5). Empirical antibiotics used in these patients were third-generation cephalosporins.
Discussion:
In this study, males were more predominant than females, with the mean age distribution being 61-70 years which corresponds to a retrospective study in DFI patients conducted by Mc Donald et al.3
In the present study among 137 patients with DFI, monomicrobial growth was 107(78%) and polymicrobial growth was 24(17.5%), which is similar to the study conducted by Hadadi.4
Mohd Zubai,5Anandi,6Ramakant,7 Pappu K,8 and Citron,9have reported 56.6%, 19%, 23 %, 92% and 16.2 % monomicrobial infections and 33%, 67%, 66%, 7.7% and 83 % of polymicrobial infections respectively.
The distribution of bacterial isolates according to Wagner’s grades were 10.3% in me, 14.4% in II, 25.7% in III,24.7% in IV and 24.7% in V, which coincides with the study conducted by Mahmoud B.Ahmedwhere bacterial growth was predominant in grade IV and V.10
In our study, Gram-negative isolates were 77(79%) with Pseudomonas spp being the most predominant (26.8%), followed by Escherichia coli (12.3%), which is in concordance with findings of Bansal and Jayashree Kona which is 76% and 72.36% respectively with Pseudomonas aeruginosa being predominant.11,12Zubair and Hadadireported Escherichia coli (26.6%) and 28% which is lower in the present study.5,4Goh et aland Hadadireported Pseudomonas 18% and 8%.13,4
Gram-negative bacteria were found to be sensitive to amikacin (56.9%), imipenem (66.6%) and piperacillin-tazobactam (47.1%). Bansalobserved 100% sensitivity to imipenem, 96% to piperacillin-tazobactam and 90% to Amikacin similarly Mahmoud B.Ahmedobserved sensitivity of 98.3% to imipenem and 89.8% to amikacin which is much higher when compared to the present study.11,10
Gram-positive isolates were 21% with Staphylococcus aureus(11.3%)being the most predominant whereas MRSA being 5.1%. This is similar to the study conducted by Bansal.11Alavireported a single microorganism, mainly Staphylococcus aureus, as the most frequently isolated bacteria from diabetic foot patients.14Whereas Macdonald et al also reported higher distribution of Staphylococcus aureus(32.5%) among Gram-positive organisms.3Global prevalence of MRSA is found to be 15-30% but in our study, it is much lower.16,17In our study Gram-positive isolates were sensitive to erythromycin (81.8%), ciprofloxacin (81.8%) and cotrimoxazole (54.5%).3 Alva observed cotrimoxazole to be 53.8% and ciprofloxacin to be 58.3% which is similar to the present study.18100 % sensitivity was observed with vancomycin, teicoplanin and linezolid which is similar to studies by M.B Girish and Jayashree Konar.15,12
A total of 21 (27.3%) patients who presented with gangrene were amputated. The level of amputation ranged from toes (n=16) to below-knee (n=5). Hadadi and Alva reported 45.5% and 34.4% amputations in their studies.4,1Empirical antibiotics used in these patients were third-generation cephalosporins. Treatment initiation with broad-spectrum antimicrobials including carbapenems and piperacillin-tazobactam for more extensive chronic moderate and severe infections is a safety measure as suggested by a study.19 However definitive treatment should be initiated following antibiogram and clinical correlation. In deeper infections surgical as well as medical intervention is necessary management of DFIs.
Conclusion: There was an increase in the prevalence of bacteria as the Wagner’s grade increased with Gram-negative growth being more predominant. Frequent surveillance of antibiotic resistance patterns would be useful in deciding empiric antibiotic therapy.
Further, the findings of this study emphasize the need to select the antimicrobial treatment which should be guided by proven culture results and antimicrobial sensitivity patterns exhibited by isolates.
Acknowledgement:
The authors acknowledge the immense help received from the scholars whose articles are cited and included in references to this manuscript. The authors are also grateful to authors/
editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.”
Conflict of Interest: There is no conflict of interest.
Source of Funding: No funding has been received for this study.
Authors’ Contribution
Dr . Dhanaleha P: Clinical Study
Dr Jayapradha.S: Study Design, Literature Review
Dr Aparna V: Manuscript preparation
Dr Anand M.R: Manuscript editing
Ethical Clearance: Obtained from the SLIMS NO.IEC/C-P/04/2020 dated 30.10.20
Englishhttp://ijcrr.com/abstract.php?article_id=4071http://ijcrr.com/article_html.php?did=4071
Alva KA, Aithala PS, Rai R, Rekha B. Clinical and microbiological profile of diabetic foot in patients admitted at a tertiary care centre in Mangalore. Muller J Med Sci Res. 2013;4:3–7.
Clinical Laboratory Standards Institute (CLSI) Performance Standards for Antimicrobial Susceptibility Testing Eighteenth informational supplement: M-100-S-2008,18: 28.
Macdonald, K.E., Jordan, C.Y., Crichton, E. et al. A retrospective analysis of the microbiology of diabetic foot infections at a Scottish tertiary hospital. BMC Infect Dis 20, 218 (2020). https://doi.org/10.1186/s12879-020-4923-1
Hadadi A, Omdeh Ghiasi H, Hajiabdolbaghi M, Zandekarimi M, Hamidian R. Diabetic foot: infections and outcomes in Iranian admitted patients. Jundishapur J Microbiol. 2014 Jul;7(7):e11680. doi: 10.5812/jjm.11680. Epub 2014 Jul 1. PMID: 25368803; PMCID: PMC4216583.
Zubair M, Malik A, Ahmad J. Clinico-bacteriology and risk factors for the diabetic foot infection with multidrug-resistant microorganisms in North India. Biol Med. 2010;2(4):22–34.
Anandi C, Alaguraja D, Natarajan V. Bacteriology of diabetic foot lesions. Indian J Med Microbiol. 2004;22(3):175–78.
Ramakant P, Verma AK, Misra R, Prasad KN. Changing Microbiological profile of pathogenic bacteria in diabetic foot infections: time to rethink on which empirical therapy to choose? Diabetologica. 2011;54(1):58–64.
Pappu AK, Sinha A, Johnson A. Microbiological profile of diabetic foot ulcer. Calicut Med Journal. 2011;9(3):e1–4.
Citron DM, Goldstein EJC, Merriam VC, Lipsky BA. Bacteriology of moderate to severe diabetic foot infections and in-vitro activity of antimicrobial agents. J Clin Microbiol. 2007;45(9):2819–28.
Mahamoud BA, Al-Mallah I, Said Eissa AN, Asif JF, Eed ME, Infection in the diabetic foot, Menoufia Medical Journal 2013,26:49-53.
Bansal E, Garg A, Bhatia S, Attri AK, Chander J. Spectrum of microbial flora in diabetic foot ulcers. Indian J Pathol Microbiol 2008;51:204-8
Jayashree K, Sanjeev D. “Bacteriological profile of diabetic foot ulcers, with a special reference to antibiogram in a tertiary care hospital in eastern India”. JEMDS 2013; (2)48,9323-9328
Goh, TC, Bajuri MY, Nadarajah C, et al. Clinical and bacteriological profile of diabetic foot infections in tertiary care. J Foot Ankle Res 13, 36 (2020).
Alavi A, Sanjari M, Haghdoost A, Sibbald RG. Common foot examination features of 247 Iranian patients with diabetes. Int Wound J. 2009;6(2):117–22
Girish MB, Kumar TN, Srinivas R. Pattern of antimicrobials used to treat infected diabetic foot in a tertiary care hospital in Kolar. Int J Pharm Biomed Res. 2010;1(2):48–52.
Eleftheriadou I, Tentolouris N, Ariana V, Jude E, Boulton AJ. Methicillin-resistant Staphylococcus aureus in diabetic foot infections. Drugs. 2010;70(14):1785–97.
Stacey HJ, Clements CS, Welburn SC, Jones JD. The prevalence of methicillin-resistant Staphylococcus aureus among diabetic patients: a meta-analysis. Acta Diabetol. 2019;56:907–21.
Alva K A, Aithala P S, Rai R, Rekha B. Clinical and microbiological profile of diabetic foot in patients admitted at a tertiary care centre in Mangalore. Muller J Med Sci Res 2013;4:3-7
Bajuri MY, Abdul Razak KA. Chronic osteomyelitis of the femur with a segmental bone defect: concepts and treatment. J Krishna Inst Med SciUniv. 2017;6(2):127–30.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareAn Extensive Usage of Hand-Held Devices will Lead to Musculoskeletal Disorder Among Paramedical Students of Parul University
English6568Didhiti DEnglish Ishita GEnglish Umang VEnglish Darshana CEnglishIntroduction: The usage of hand-held device is increasing with within the adolescents consistent with survey conducted in China, in the year 2018 the share of individuals using smartphones has drastically increased up to 98.6%.consistent with a study conducted by Alphas an et al. in the year 2016 there have been about 52.7% males and 46.9% females who were having their age between 18 to 23 and that they were considered to be addicted for the usage of smartphones. consistent with a study conducted by Alosaimi et al. about 27.2% of people are coming under the age of 20 to 24 years who were using their smartphones for over 8 hours. Topic: An extensive usage of hand-held devices will lead to musculoskeletal disorder among paramedical students of Parul University. Objective: The objective of this study is to find the prevalence of musculoskeletal disorder in the upper extremity among students of Parul University due to extensive usage of hand-held devices. As the usage of the hand-held device is increasing nowadays. Method: The subjects were paramedical students at Parul University. 215 subjects were included in this study out of which 209 were selected based on inclusion and exclusion criteria, the data was collected through a google form. Outcome Measure: DASH questionnaire. Results: Results showed that there was a moderate prevalence of musculoskeletal disorder within the upper extremity due to extensive usage of hand-held devices among paramedical students of the Parul University. Conclusion: Hand-held devices have become a crucial part of life. However, their extensive usage may lead to musculoskeletal disorders keeping this into considerations, further studies should be done in future for spreading awareness among the users.
EnglishHand-held device, Extensive, Typing, Musculoskeletal disorders, DASH, Cell phone, Upper extremityINTRODUCTION
Hand-held device are those devices that can be carried easily by one’s hand. 1Device like Tab, Cell-phone, Personal data assistants (PADs), iPod and gaming device are kind of hand-held devices. 2 Hand-held devices are having multiple uses like chatting, for calling, sending e-mails, for enjoying games and other entertainment and academic purposes.3Nowadays their usage is increasing worldwide.
The usage of hand-held device is increasing among adolescents. 4consistent with survey conducted in China, in the year 2018 the share of individuals using smartphones has drastically increased up to 98.6%. 4consistent with a study conducted by Alphas et al. in the year 2016 there have been about 52.7% males and 46.9% females who were having their age between 18 to 23 and that they were considered to be addicted for the usage of smartphones. 5consistent with a study conducted by Alosaimietal. there are about 27.2% of people coming under the age of 20 to 24 years who were using their smartphones for over 8 hours. 6,7
The usage of smartphones among students is over 80% and they spend approximately 5- 6 hours each day. 8,9In many studies it’s been concluded that there is an increase in the usage of mobile among college and university students. 10
The increased usage of text messaging across the globe has raised concern that its use could lead to musculoskeletal disorders. Due to the increased usage of hand-held devices like smartphones, the rate of musculoskeletal disorders of the hand, wrist and forearm has also increased across the globe. 3
Because of the long-term usage of the hand-held devices, there has been continuous mechanical stress on the structures like tendon, muscles and parametric tissues and it leads to problems in the thumb and the muscles within the forearm. 3 Also, there’s is the continuous movement of the wrist which ends within the musculoskeletal disorders. 11,12The musculoskeletal disorders are increasing within the upper extremity of college students by 32.9% and 89.3% among different parts of the globe. 10
Musculoskeletal disorders are those injuries and disorders that affect the movements of the human body or musculoskeletal system. 1 They’re a group of inflammatory and degenerative conditions.
Outcome measures are important for the evaluation of the standard of life and performance. 13The measurement of disability is very important for a comprehensive assessment of outcome following injury within the upper limb. 14
Measuring disabilities in patients with upper-limb disorders seem stapes a practical challenge, many distinct questionnaires are developed for the various regions of the upper limb. But due to of presence of multiple disorders or multiple affected regions in many patients, the selection available becomes difficult. 14
So, here Disabilities of the Arm, Shoulder and Hand outcome measure (the DASH) provides the solution.
PROCEDURE
MATERIALS:
Paper, Pen, Laptop, Calculator, DASH questionnaire.
METHODOLOGY:
This study was a survey study conducted on paramedical students of Parul University. The info was collected by using the DASH questionnaire for knowing the prevalence of musculoskeletal disorders because of extensive usage of hand-held devices among paramedical students of the Parul University. The themes were selected on the idea of the following criteria:
INCLUSION CRITERIA:
Age:18-25.
Paramedical students of Parul University.
More than 4hours.
EXCLUSION CRITERIA:
Having any injury in the upper extremity.
Having any deformity in the upper extremity.
Having any neurological problem because of other reasons.
RESULT:
Results showed that among 209 students there were 145 Females and 64 Male and the mean DASH score obtained by data analysis was 43.6013 and the standard response mean was 8.77252. So, the result strongly suggests that there is a presence of moderate difficulty in arm, shoulder and hand among the paramedical students of Parul University.
The bar diagram shows the mean and standard deviation of the Dash score
The graph shows the presence of a moderate amount of difficulty in the upper extremity of paramedical students at Parul University.
DISCUSSION
The present study was conducted to know the prevalence of musculoskeletal disorders among the paramedical students at Parul University due to the extensive usage of handheld devices. Within the study, the data was distributed and collected in the form of a questionnaire from the campus of Parul University in Vadodara. Subjects responded to the questionnaire and data analysis was done. Based on the result that is obtained from the study, it can be stated that the students were having moderate difficulty in arm, shoulder and hand due to more usage of the hand-held device. It has been reported that University students use their average time texting, emailing, scheduling, and Internet browsing on their mobile phones. 1
A study conducted by Barolo et al. states that there was 46-52% pain in the shoulder among the students and staff members who were using hand-held devices. 15 According to a study conducted by Charu Eapen et al. (2010) it was found that 18.5% of respondents complained of symptoms sin the upper limb due to extensive usage of the cell phone and more than 50% complained that they were having thumb pain and it increased due to excessive texting on cell phones. More than 70% of the subjects complained that the symptoms they faced were due to excessive use of the mobile phone. 16The reasons for the musculoskeletal disorder also depends upon the nature of smartphone use, users use the smartphone with a single hand, which puts stress on the thumb as the thumb moves in 79% of its maximum range of motion in abduction within the abduction/adduction plane and 55% of its maximum range of motion flexion in the flexion/extension plane which results into thumb pain. 17
Due to the overuse of the smartphone, there were continuous muscle contractions within the upper extremity and the neck which resulted in the microscopic damage of muscles, which lead to a collection of the fluid and an increase in pressure of the tissues within the intracellular and extracellular spaces which was the reason for increase within the pain. 18
When there are continuous fast movements which are with more reputations and performed with more force it leads to fatigue of the muscle with ischemic and metabolic changes that damages the muscle enzyme function. The affected muscles and their tendons become more susceptible to micro-tears and inflammatory changes which is also responsible for the pain that persists while doing activities like texting as well as rest. 16
The contributing factors are less spacing on the keyboard, size of the mobile, position of the thumb and the static load which is put on the thumb during text messaging on a hand-held device. Static repeated motion done by the users leads to reduction within the blood circulation as a result of which the supply of nutrients reduces which causes pain and fatigue among the users. 19
Sustained and prolong gripping, the repetitive movement of the thumb has led to musculoskeletal disorders in the thumb and the extrinsic musculature of the forearm. 20
The wrist engages in repeated flexion-extension which puts stress on the carpal tunnel and it results in narrowing of the carpal tunnel as well there is an increase within the pressure of the carpel tunnel, also there is a decrease within the space for the median nerve. 21 Due to the posture of the wrist it has been stated that the extensive usage of the smartphone may affect the flexor pollicis tendon, thumb joint and median nerve. 22
CONCLUSION
This study aimed to determine the prevalence’s of musculoskeletal disorders among the paramedical student of Parul University. Usage of cell phones is crucial; however, more use of cell phones may lead to serious musculoskeletal disorders. Even though the musculoskeletal disorders within the upper extremity due to handheld devices can be treated with proper rehabilitation, users need to understand the risk factors and prevention of the disorders and the users are advised to decrease the total amount of time on the usage of the device. The study concluded that there was the presence of moderate musculoskeletal disorders in the upper extremities among the students due to extensive usage of Hand-held devices. Further studies involving the identification of risk factors in a larger population are recommended to prevent the disorders.
SUMMARY
This study was conducted to know the presence of musculoskeletal disorders in the upper extremity among paramedical students of the Parul University at Vadodara, due to extensive usage of Hand-held devices. This study included 209 subjects age between18-25 years. The purpose for conducting the study was explained to students and the subjects were given a brief introduction regarding the study and the questionnaire. Data was collected in the form of Google Forms. The subjects were selected based on the inclusion and exclusion criteria and data analysis was done through the SPSS software version20.
Thus, the study concluded that there was the presence of a moderate amount of musculoskeletal disorders within the upper extremity among paramedical students of the Parul University due to extensive usage of hand-held devices
FURTHER RECOMMENDATION
The duration and the time interval of the study should be increased along with the increase in sample size.
The study should also be conducted in different locations and the professions which have high usage of hand-held devices should be included within the study.
ACKNOWLEDGEMENT
We acknowledge Parul University, Vadodara, Gujarat for their help in doing this work
Conflict of interest: None
Funding: None
Name of the authors and their contribution
1. DR. DIDHITI DESAI - concepts, design, the definition of intellectual content, literature search, data acquisition, manuscript preparation, manuscript editing, and manuscript review
2. ISHITA GOSWAMI- literature search, manuscript preparation, manuscript editing
3. UMANG VAGHELA-literature search, manuscript preparation, manuscript editing.
4. DARSHANA CHAUHAN- literature search, manuscript preparation, manuscript editing.
Englishhttp://ijcrr.com/abstract.php?article_id=4072http://ijcrr.com/article_html.php?did=4072
Balakrishnan R, Chinnavan E, Feii T. An extensive usage of hand-held devices will lead to musculoskeletal disorder of upper extremity among students in AMU: Int. j. Phys. educ. sports health .2016;3(2):368-72.
Hogg NA. Design of thumb keyboards: Performance, effort and kinematics (Master's thesis, University of Waterloo).
Sharan D, Mohandoss M, Ranganathan R, Jose JA, Rajkumar JS. Distal upper extremity disorders due to extensive usage of hand-held mobile devices. Human Factors in Organisational Des Manag. 2012; 51:1041-5.
Zhang Y, Lv S, Li C, Xiong Y, Zhou C, Li X, Ye M. Smartphone use disorder and future time perspective of college students: the mediating role of depression and moderating role of mindfulness. Child and Adol Psych Mental Health. 2020Dec;14(1):1-1.
Alruzayhi MK, Almuhaini MS, Alwassel AI, Alateeq OM. The effect of smartphone usage on the upper extremity performance among Saudi Youth, KSA. Rom J Rhinol. . 2018 Mar1;8(29):47-53.
Alruzayhi MK, Almuhaini MS, Alwassel AI, Alateeq OM. The effect of smartphone usage on the upper extremity performance among Saudi Youth, KSA. Rom J Rhinol. 2018 Mar1;8(29):47-53.
Alosaimi FD, Alyahya H, Alshahwan H, Al Mahyijari N, Shaik SA. Smartphone addiction among university students in Riyadh, Saudi Arabia.Saudi Med J.2016Jun;37(6):675.
Barkley JE, Lepp A. Cellular telephone use during free-living walking significantly reduces average walking speed. BMC Rese Notes. 2016 Dec1;9(1):195.
Barkley JE,Lepp A, Salehi-EsfahaniS .Collegestudents’mobiletelephone use is positively associated with sedentary behaviour. Ash J Med. 2016 Nov;10(6):437-41.
Gold JE, Driban JB, Thomas N, Chakravarty T, Channell V, Komaroff EG. Postures, typing strategies, and gender differences in mobile device usage: An observational study. Appl Ergon. 2012 Mar1;43(2):408-12.
Kwon M, Lee JY, Won WY, Park JW, Min JA, Hahn C, Gu X, Choi JH, Kim DJ. Development and validation of a smartphone addiction scale (SAS). PloS one. 2013 Feb 27;8(2):e56936.
Trudeau MB, Young JG, Jindrich DL, Dennerlein JT. Thumb motor performance varies with thumb and wrist posture during single-hand held mobile phone use.J. Biomech.. 2012 Sep21;45(14):2349-54.
Xie Y, Szeto G, Dai J. Prevalence and risk factors associated with musculoskeletal complaints among users of mobile handheld devices: A systematic review. Applied ergonomics. 2017 Mar 1; 59:132-42.
Beaton DE, Katz JN, Fossel AH, Wright JG, Tarasuk V, Bombardier C. Measuring the whole or the parts? validity, reliability, and responsiveness of the Disabilities of the Arm, Shoulder and Hand outcome measure in different regions of the upper extremity. J Hand Ther. 2001 Apr1;14(2):128-42.
Can S, Karaca A. Determination of musculoskeletal system pain, physical activity intensity, and prolonged sitting of university students using a smart phone.
Eapen C, Kumar B, Bhat AK. Prevalence of cumulative trauma disorders in cell phone users. J. Musculoskelet. Res.. 2010Sep;13(03):137-45.
Berolo S, Wells RP, Amick III BC. Musculoskeletal symptoms among mobile handheld device users and their relationship to device use: a preliminary study in a Canadian university population. Applied ergonomics. 2011 Jan1;42(2):371-8.
Kim GY, Ahn CS, Jeon HW, Lee CR. Effects of the use of smartphones on pain and muscle fatigue within the upper extremity. J. Phys. Ther. and variant.2012;24(12):1255-
Kim HJ, KimJS. There relationship between smartphone use and subjective musculoskeletal symptoms and university students. J. Phys. Ther. and variant.2015;27(3):575-9.
Gustafsson E, Johnson PW, Hagberg M. Thumb postures and physical loads during mobile phone use A comparison of young adults with and without musculoskeletal symptoms. J Electromyogr Kinesiol J Electromyogr Kines. 2010 Feb1;20(1):127-35.
Bower JA, Stanisz GJ, Keir PJ. An MRI evaluation of carpal tunnel dimensions in healthy wrists: implications for carpal tunnel syndrome.Clinical Biomech.2006Oct1;21(8):816- 25
?Nal EE, Demirci K, Çet?ntürkA, Akgönül M, Sava? S. Effects of smartphone overuse on hand function, pinch strength, and the median nerve. Muscle & nerve. 2015Aug;52(2):183-8.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareIntraoperative Frozen Section Analysis - A Study of Tertiary Care Centre
English6974Prajapati Jagdish ArvindbhaiEnglish Parikh Biren PravinchandraEnglishIntraoperative Frozen Section Analysis- A Study of the tertiary care centre Introduction: Frozen section (FS) is a key Histopathological technique used by pathologists during intraoperative consultation which will help operate surgeon to decide resection intraoperatively. FS is a rapid technique to evaluate tissue diagnosis, margins and lymph node metastasis. The present study aims to evaluate the accuracy, sensitivity and specificity of the frozen section with error rates of FS in our institute. Methods and Material: The present study was carried out at the Histopathology section of the department of Oncopathology at the tertiary care centre from 1st January 2018 to 31st December 2018. The data was obtained from our online Laboratory Information System (LIS). Fresh tissue was received in a clean sterile container. Gross examination and sectioning were done and the further procedure has been carried out in Cryostat. Rapid Haematoxylin and eosin staining were performed and slides were prepared. Statistical analysis was performed using Statistical Package for the Social Science Software (SPSS). Results: In the present study, the overall accuracy rate, sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were 94.93%, 98.96%, 91.17%, 92.13% and 98.96% respectively. The discordance rate was 5.07%. Conclusions: Frozen section is a reliable, accurate and rapid technique for intraoperative consultation which will help operate surgeons. Regular evaluation of discordance rate and analysis of methodology with technical skills will improve the accuracy rate of FS.
English Intraoperative consultation, Histopathology, Accuracy rate, Sensitivity, Specificity, Discordant rateIntroduction
Frozen section (FS) evaluation is a key Histopathological technique used by pathologists during intraoperative consultation.1 The beginning of this intraoperative diagnosis began with a publication by Louis B Wilson, MD at the Mayo clinic in 1905.2 FS is a rapid technique that contributes to the primary diagnosis like benign, malignant or inflammatory lesion. It also indicated to evaluate margins, lymph node metastasis and to determine nature of lesion that may require the ancillary test.3,4
The primary aims and objectives of the present study are to know
(1) Accuracy, sensitivity and specificity of FS
(2) Error rates of FS in our institute
Material and Method
The present study was carried out at the Histopathology section of the department of Oncopathology at the tertiary care centre from 1st January 2018 to 31st December 2018. It is a hospital record-based retrospective cross-sectional study. During this study, a total of 1015 specimens and biopsies were received for intra-operative pathological consultation for various malignant and non-malignant conditions. Out of 1015 cases, 9 cases were deferred due to inadequate material or non-representative tissue. In the present study, a total of 1006 cases was included for statistical analysis. The data was obtained from our online Laboratory Information system (LIS). Fresh tissue samples were received in a clean sterile and properly labelled container along with a test requisition form (TRF), which carries necessary clinical details and indications. An appointment for an FS consultation was usually fixed on the previous day by the surgical departments requesting for the investigation. Patients of all age groups with no sex predilection were included in the present study. Grossing of received specimens were done and submitted for further procedure and analysis. Imprint smear and squash smears were taken in required cases. During the procedure cryostat (SLEE) temperature was kept at -18?c to -24?c depending upon the nature of the tissue. The clearance angle was set at 10?c. Polyethylene-Glycol (PEG) compound was the freezing medium used and was poured onto chucks. When the medium and tissue were frozen, the chuck was inserted into the clamping lever and was fixed. Sections were cut at 4-5 µ thickness and were immediately fixed in 95% isopropyl alcohol. Two-three sections per slide and 2 slides were prepared from each block. Rapid haematoxylin and eosin (H&E) staining was performed. Frozen section diagnosis was made by a senior pathologist. Frozen sections were analysed for tissue diagnosis, surgical margins and lymph node metastasis. It was immediately conveyed to the operating surgeon through telephonic conversation as well as by an electronically signed report.
For routine buffered formalin-fixed paraffin embedding (FFPE) tissue processing: The remaining tissue from the FS specimen received for Histopathology was fixed in 10% neutral buffered formalin. Grossing was done and sections were taken from representative areas. Conventional Histopathology was performed in a fully automated tissue processor (Thermo Shandon). The paraffin-embedded sections were cut at 4 µ and were stained by routine H&E staining technique in automatic stainer by Leica and followed by Immunohistochemistry (fully automated, Ventana) whenever needed. The impression of the pathologist as given to the surgeon at the time of surgery was compared to the final Histopathology report of the permanent sections.
Concordant vs discordant cases: Concordant cases were those where the diagnosis of frozen section matched with the final histopathological diagnosis. The discordant cases were those in which incorrect or equivocal assessment adversely affect the intraoperative management.
Statistical Method: Statistical analysis was performed using Statistical Package for the Social Science (SPSS) software. The results were obtained as concordant and discordant cases. The results were further classified into the following categories: true negative (absence of tumour correctly diagnosed), true positive (presence of tumour correctly diagnosed), false positive (the cytological or frozen section was incorrectly diagnosed as a tumour), false negative (the cytological or frozen section specimen failed to diagnose as the tumour), accuracy rate, sensitivity, specificity, PPV (Positive predictive value) NPV (Negative predictive value).
Results
In this group of 1006 patients, 546 were male and 460 were female. Male to Female ratio is 1.2:1.
The most common indications of FS in our institute were:
(1) Primary diagnosis - 579 cases (57.5%)
(2) Assessment of margins of tumour excision - 398 cases (39.7%),
(3) Assessment of nodal status mainly in Head & Neck (H&N) and Breast malignancies - 29 cases (2.8%)
The commonest unit from which tissue was submitted for FS analysis was H&N (429 cases, 42.64%) followed by Neurology (308 cases, 30.62%) and Gynaecology (10 cases, 10.93%).
The total concordance cases were 955 (94.93%) which includes true positive 480 cases (47.71%) and true negative 475 cases (47.21%). Total discordant cases were 51 (5.07%). False-positive cases (46 cases) were more common than false-negative cases (05 cases) (Table I).
The overall accuracy rate was 94.93%. Sensitivity was 98.96% among all cases. Specificity was highest for benign cases (96.02%). The overall positive predictive value was 92.13% and the negative predictive value was 98.96% (Table II).
In the present study, a total of 1006 cases of FS analysis includes benign cases, borderline cases, malignant cases, margins, lymph nodes and no pathology in tissue. We have reported no pathology in 480 cases (47.7%). Out of that 5 cases were turned out to be malignant in permanent sections (Table III).
The commonest discordant cases were found in H&N (31 cases) followed by Neurology (12 cases) (Table IV).
Discussion
The frozen section is generally considered an accurate and reliable method of diagnosis which helps surgeons in deciding further intraoperative courses. Intraoperative frozen section evaluation for initial diagnosis, margin status and lymph node status or confirmation of prior diagnosis has become a common procedure. It is relatively expensive and technically limited, thus available only in major hospitals and diagnostics centres. It also requires highly trained technical staff, adequate equipment and workload. Pathologists must be trained for frozen section reporting. Technicians require more skill in the frozen section than the paraffin-embedded section. The frozen section guides the surgeons to avoid undertreatment or overtreatment. The pathologist must know the usefulness and limitations of frozen sections along with the limitation of technical staff. Pathologists also need details of clinical history, site, size of the lesion, any previous treatment like chemotherapy or radiotherapy along with radiological findings. So, frozen section reporting requires good teamwork. Long term monitoring of FS-permanent section correlation is associated with sustained performance improvement.5 The frozen section diagnosis can be benign, borderline lesion, malignant, free of tumour or no pathology at the oncology centre. The frozen section is also important in ensuring adequate margin clearance.6,7,8
In the available literature, the deferral rate varies from 0 to 6.1%. 9,10 Selvakumar et al. study has a deferred rate of 2.27%.4 However, in the present study deferred rate was 0.8%. The overall accuracy rate of frozen section diagnosis in the literature varying from 92% to 97.98%.10,11,12
In the present study, an overall accuracy rate of 94.93%. The sensitivity of the frozen section reported in various studies ranges from 84.6% to 97.98%. 11,12,13 In the present study, observed sensitivity of 98.96% which also falls within the range. The reported specificity of frozen sections in the literature ranges from 94.55% to 100%.11,12,13 In the present study observed specificity of 91.17%, which is near about the lower range of reported specificity of literature ranges. In the present study, observed sensitivity was 84.86% in benign cases and 95.7% in malignant cases while specificity in benign cases was 96.02% and 85.2% in malignant cases. We have compared the overall sensitivity, specificity of the accuracy of frozen sections with the other studies from India and different parts of the world (Table V).
Likelihood ratio (LR) is the probability of that finding in patients with disease divided by the probability of the same finding in patients without the disease. Positive LRs increase the probability of disease and negative LRs decrease the probability of disease. 15 In the present study, FS indicates a high increase in the likelihood of the disease as LR+ was 10.28.(LR+ > 10). Also, LR- value is 0.011 (LR< 0.1) this indicate that the frozen section has been effective in indicating a reduction in the likelihood of the disease. The LR values are comparable to Nayanar et al. and Carvalho et al.1,16
The literature reports discordance rates ranging from 1.4% to 12.9% in different anatomical sites.17,18,19 In the present study discordant rate was 5.07%. In the present study, out of 51 discordant cases, 35 (68.62%) cases are of H&N (31 cases) and Breast & Thorax unit (4 cases). Of which seven (20.0%) cases are false-negative and 28 (80.0%) cases are false positive. Studies have shown that the frozen section is important and highly effective in avoiding re-operations.14,23 In H&N and Breast & Thorax, margins clearance is crucial as chances of recurrence are high and difficult to treat,24 So in H&N and Breast & Thorax, a false negative is more costly during intraoperative frozen section analysis as it will lead to recurrences and repeat surgeries.
In the present study, out of 51 discordant cases, 12 (23.52%) cases were of the Neurology unit. Seven (58.33%) cases are of false negative for a malignant tumour in the frozen section and 5 (41.67%) cases are of false-positive because of freezing artefact and experience of pathologist dealing with the Neurology specimen. Soft and edematous nature of Neurology specimen, freezing artefact alters the cellular and nuclear morphology leads to misinterpretation.3
Three cases were reported negative for malignancy in the frozen section in case of the Orthopaedics unit, which was positive for malignancy in the paraffin section. These were due to inadequate tissue received for frozen and lack of communication to orthopaedics for clinical-radiological findings which again helpful for diagnosis of bone tumours. Additional tissue material was received after FS which were processed and the final diagnosis was made on the paraffin section.
In the present study, out of 51 discordant cases, one case was of the Gynaecology unit. In frozen mucinous neoplasm- borderline was reported which turned out to be well-differentiated mucinous adenocarcinoma on paraffin section. The cause for this false-negative diagnosis was inadequate sampling or may be due to the focal nature of the lesion. Misdiagnosis can be the result of lack of communication between the clinician and pathologist, false interpretation, improper and inadequate sampling.25,26 The leading causes which can affect the frozen section are sampling error due to improper sampling, technical error and interpretation error done by pathologists.27,28 The type of error varies in each study depending upon the method used for freezing, type of specimen most commonly received, type of procedure adopted and focal nature of the lesion.29 Many studies have concluded that disagreement in FS diagnosis is mostly due to interpretation and sampling error, followed by sectioning, inadequate history, staining and labelling.3,18,30 Out of 51 cases, 19 (37.25%) cases were due to interpretation error and the remaining 32 (62.75%) cases were due to inadequate sampling and sectioning. Interpretation errors include morphological changes due to freezing, lack of technical staff experience and experience of pathologists dealing with FS.
The average turnaround time (TAT) required for the entire frozen section procedure varies from 20 to 25 minutes.31 The average turnaround time observed in the present study is 20-30 minutes, which is comparable with the range reported by other studies.
Conclusion:
The frozen section is a reliable, accurate and rapid technique for intraoperative consultation. The frozen section has its value which should be remembered by both pathologists and surgeons. The frozen section is an important method in H&N to evaluate the status of margins as it is very crucial to avoid repeat surgery, chances of recurrences and also to decide for further procedure. Also helpful in Breast conservative surgery (BCS)/lumpectomy specimens to evaluate sentinel lymph node intraoperatively to check for metastasis of lymph node and further axillary lymph node dissection (ALND).
Regular audit and analysis of methodology, technical skills, clinicopathological discussion and adequate sectioning are important factors to improve frozen section reliability in the pathology department. Evaluation of discordant rate regularly with experience of the pathologist in the frozen section will improve the accuracy of frozen section diagnosis and thus patient management.
Acknowledgement: Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors whose articles from where the literature for this article has been reviewed.
Source of funding: None
Conflict of interest: None
Author’s contribution: Both authors have contributed to the planning, implementation and analysis of the research study and its presentation in the form of the manuscript.
Ethical clearance Letter No: IRC/2019/P-106
Englishhttp://ijcrr.com/abstract.php?article_id=4073http://ijcrr.com/article_html.php?did=4073
1. Nayanar SK, Aswathi KM, Mrudula KI, Thavarool SB, Thiagarajan S. Frozen section evaluation in Head and neck Oncosurgery: An initial Experience in a Tertiary Cancer Centre. Turk PatolojiDerg 2019; 35:046-51.
2. Ryan J, Baker L, Editors. Dordrecht. Recent concepts in sarcoma treatment. Springer Netherlands 1988:81-8.
3. Patil P, Shukla S, Bhake A, Hiwale K. Accuracy of frozen section analysis in correlation with surgical pathology diagnosis. Int J Res Med Sci 2015;3:399-04.
4. Selvakumar AS, Rajalakshmi V, Sundaram, KM. Intraoperative frozen section consultation- an audit in a tertiary care hospital. Indian J Pathol 2018;5:421–28.
5. Raab SS, Tworek JA, Souers R, Zarbo RJ. The value of monitoring frozen section-permanent section correlation data over time. Arch Pathol Lab Med 2006;130:337-42.
6. Hatami H, Mohsenifar Z, Alavi SN. The diagnostic accuracy of frozen section compared to the permanent section: A single-centre study in Iran. Iran J Pathol 2015;10:295-99.
7. Olson SM, Hussaini M, Lewis JS Jr. Frozen section analysis of margins for head and neck tumor resections: reduction of sampling errors with a third histologic level. Mod Pathol 2011;24:665-70.
8. Esbona K, LiZ, Wilke LG. Intraoperative imprint cytology and frozen section pathology for margin assessment in breast conservation surgery: a systematic review. Ann Surg Oncol 2012;19:3236-45.
9. Khoo JJ. An audit of intraoperative frozen section in Johor. Med J Malaysia 2004;59:50-5.
10. Oneson RH, Minke JA, Silverberg SG. Intraoperative Pathologic Consultation. An audit of 1,000 recent consecutive cases. Am J Surg Pathol 1989;13:237-43.
11. Chang J-L, Tseng H-H, Sheru L-F, Lee W-H, Tu Y-C. Diagnostic accuracy of frozen section in a surgical pathology-a retrospective analysis of 1084 frozen sections. J Med Sci 1992;13:133-42.
12. Farah-Klibi F, Neji O, Ferjaoui M, Zaouche A, Koubaa A, Sfar R et al. Accuracy of frozen section diagnosis: an analysis of 1695 consecutive cases. Tunis Med 2008;86:693-97.
13. Shrestha S, Lee MC, Dhakal H, Pun CB, Pradhan M, Shrestha S et al. Comparative Study of frozen section Diagnoses with Histopathology. Postgrad. Med. J of NAMS 2009;3:1-5.
14. Abbasi F, Yekta Z, Aryan A. Accuracy of frozen sections. Iranian J Pathol 2012;7(1):3-8.
15. McGee S. Simplifying Likelihood Ratios. J Gen Intern Med 2002;17:647-50.
16. Carvalho MB, Soares JM, Rapoport A, Andrade SJ, Fava AS, Kanda JL et al. Perioperative frozen section examination in parotid gland tumors. Sao Paulo Med J 1999;117:233-37.
17. Ozdamar SO, Bahadir B, Ekem TE, Kertis G, Dogan B, Numanoglu G et al. Frozen section experience with emphasis on reasons for discordance. Turkish Journal of cancer 2006;36:157-61.
18. Mahe E, Ara S, Bishara M, Kurian A, Tauqir S, Ursani N et. al. Intraoperative pathology consultation: error, cause and impact. Can J Surg 2013;56:E13-18.
19. da Silva RD, Souto LR, Matsushita GdeM, Matsushita MdeM. Diagnostic accuracy of frozen section tests for surgical diseases. Rev Col Bras Cir. 2011;38:149-54.
20. Ahmad Z, Barakzai MA, Idrees R, Bhurgri Y. Correlation of intraoperative frozen section consultation with the final diagnosis at a referral centre in Karachi, Pakistan. Indian J Pathol Microbiol 2008;51:469-73.
21. Chbani L, Mohamed S, Harmouch T, Fatemi HE, Amarti A. Quality assessment of intraoperative frozen section: an analysis of 261 consecutive cases in a resource-limited area: Morocco. Health 2012;4:433-35.
22. Roy S, Parwani AV, Dhir R, Yousem SA, Kelly SM, Pantanowitz L. Frozen section diagnosis Is there discordance between what pathologists say and what surgeons hear? Am J Clin Pathol 2013;140:363-69.
23. Jorns JM, Visscher D, Sabel M, Breslin T, Healy P, Daignauts S et al. Intraoperative frozen section analysis of margin in breast-conserving surgery significantly decreases reoperative rates: One year experience at an ambulatory surgical centre. Am J Clin Pathol 2012;138:657-69.
24. Hosseini M, Alizadeh Otaghvar HR, Tizmaghz A, Shabestanipour G, Arvaneh S. Evaluating the accuracy of fine-needle aspiration and frozen section based on permanent histology in patients with follicular lesions. Med J Islam Repub Iran 2015;29:239.
25. Jaafar H. Intra-operative frozen section consultation: Concepts, applications and limitations. Malays J Med Sci 2006;13:4-12.
26. Gol M, Baloglu A, Yigit S, Dogan M, Aydin C, Yensel U. Accuracy of frozen section diagnosis in ovarian tumours. is there a change over time? Int J Gynecol Cancer 2003;13:593-97.
27. Wootipoom V, Dechsukhum C, Hanprasetpong J, Lim A. Accuracy of intraoperative frozen section in the diagnosis of ovarian tumours. J Med Assoc Thai 2006;89:577-82.
28. Mohammed AB, Ahuja VK, Farghaly H. Role of frozen section in the intraoperative management of ovarian masses. Middle East Fertil Soc J 2014;20:97-101.
29. Tangjitagamol S, Jesadapatrakul S, Manusirivithaya S, Sheanakul C. Accuracy of frozen section in diagnosis of ovarian mass. Int J Gynecol Cancer 2004;14:212-19.
30. Evans CA, Suvarna SK. Intraoperative diagnosis using frozen section technique. J Clin Pathol 2006;59:334.
31. Novis DA, Zarbo RJ. Interinstitutional comparison of frozen section turnaround time. A college of American Pathologists Q-Probes study of 32868 frozen sections in 700 hospitals. Arch Pathol Lab Med 1997;121:559-67.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareEffect of Music - Raga Malkauns & Yaman on Emotional Intelligence and General Intelligence Among Undergraduate Medical Students
English7579Jayamala AKEnglish Karthika PUEnglish Manjulakshmi REnglish Madhura KSEnglishBackground: Medical education poses immense stress on undergraduate medical students due to workload & competitive clinical training environment. A high level of stress has a negative effect on cognition. Music intervention is known to reduce stress, thereby improving cognition. High emotional intelligence subjects cope well with their own emotions as well as respond better to patients emotions thereby have a good patient-doctor relationship. With this background, the Effect of Raga Malkauns & Yaman on general & emotional intelligence is assessed in this study. Materials and Methods: Thirty undergraduate medical students of both genders were recruited randomly based on inclusion & exclusion criteria. Assessment of emotional intelligence & general intelligence was done before and after music intervention. Pre-recorded music Raga Malkauns & Yaman was heard by students for 6days /week for 6 weeks in the department of Physiology. Results: After music intervention, significant improvement in general intelligence test - DSST (digit symbol substitution test) scores (p=0.0005) but not in global emotional intelligence or any of the four subscales of EI (p>0.41). Conclusion: Listening to music helps in the improvement of GI thereby helps in improving academic performance. No improvement in EI was noted.
English Cognition, Emotion, Stress, Young adultsINTRODUCTION
Daniel Goleman a distinguished psychologist defines Emotional Intelligence (EI) as “the capacity for recognizing our feelings and those of others, for motivating ourselves, and for managing emotions well, in ourselves and our relationships’’.1.EI is an essential aspect of human interactions. People with high EI cope well with their own emotions, notice and respond appropriately to the emotions of other people. The medical profession thrives on human interactions. High EI level has been reported to contribute positively towards a healthy doctor-patient relationship, increased empathy, teamwork and communication skills, stress management, organizational commitment and leadership.2 Perceiving and managing emotions is fundamental to medicine as physicians must navigate their own emotions as well as the emotions of the patients and other team members, to succeed as effective practitioners.
Our medical training focuses mainly on cure, amelioration of disease, and the restoration of good health but it fails to teach, how to handle emotional situations, witness the dying process and communicate during the period of grief. In an era of competitiveness, students are forced to develop an attitude of passive knowledge acquisition and skill gathering sometimes even forgetting the patient, the very reason for his existence. Physicians are trained to strive for detachment to their professional competence to cure the disease rather than empathizing with the patient. Improving observational skills (to detect patient emotions) and communication skills (to convey his feelings to the bereaved family) can help in sensitizing the undergraduate students to be more empathizing with patients.3
Though general Intelligence is essential for both short-term and long term memory, attention, perception & problem-solving in medical education, it poses considerable stress on undergraduate students & trainees due to the immense academic workload and competitive clinical training environment.4 High level of stress has a negative impact on the cognitive function and learning potential of the students.5
Music is an art of sound in time. The capacity of music to communicate emotions is one of the important functions of music. In Indian classical music, Ragas are the one that constitutes to specific combinations of tonic intervals that are capable of evoking distinct emotions. Music was also known to enhance cognition by relieving stress and by inducing a moderate level of arousal & pleasant mood. Various studies have reported the association between Emotional Intelligence (EI) and academic performance.6,7 Though many studies have been done to find the effect of music on general and emotional intelligence, not any of the studies were done among medical students’ emotional intelligence, hence this study was chosen.
HYPOTHESIS
Music has a positive impact on general and emotional intelligence among medical students.
OBJECTIVES:
To determine the effect of Indian Raga Malkauns and Yaman on Emotional Intelligence
To determine the effect of Indian Raga Malkauns and Yaman on General Intelligence
To Correlate and compare the relation between Emotional Intelligence and General Intelligence
METHODOLOGY:
Sample size estimation:
An institution-based interventional study was conducted in the department of Physiology after obtaining Institutional Ethics Committee clearance. Thirty volunteers from second-year MBBS (sample size estimated was 22 using Open Epi software based on the mean and SD obtained from the previous study.8 Considering 20% nonresponsive rate and few loss to follow up rate the sample size included in the study is 30) aged between 18 and 25 years of both the sex were recruited randomly. Subjects with a history of epilepsy, diabetes, hearing impairment and those who were already acquainted with Indian classical music were excluded from the study. After explaining the purpose of the study, informed written consent was obtained from all the participants. Demographic data were collected. Emotional Intelligence (EI) and General Intelligence (GI) score was recorded before and after music intervention using a questionnaire.
Emotional intelligence (ei):
TEQ- SF is a validated questionnaire used to score Trait- Emotional intelligence among undergraduate medical students.11 It is developed by K. V. Petrides, Director of the London Psychometric Laboratory at University College London (UCL). TEQ- SF includes 2 items from each of the 15 facets of the trait EI sampling domain which can be used in research designs with limited experimental time. TEIQue-SF yields scores on global trait EI and its four subscales (Well-being, Self-control, Emotionality, and Sociability).9
General intelligence (gi):
Tests to assess the executive aspect of cognition function was used to assess general intelligence as it is known to be independent of Mozart effect of music. 10
Digit symbol substitution test (DSST):
This test assesses the neuropsychological activity of the brain. The key consists of a list of one digit &one symbol in pairs (e.g. 1/-, 9/=).The test items are printed below the key. Participants were instructed to draw the symbol below the appropriate digit by seeing the key. The first 10 items were used as practice items, to ensure that participants understand the test instructions. After completion of 10 practice items, participants are instructed to complete the test as fast as possible. Based on the number of correct substitutions made in 90 seconds, a score was awarded. 11
Letter digit substitution tests (LDST):
In the LDST test, the key gives the numbers 1 to 9, each paired with a different letter; the test items were printed below the key. Participants were instructed to replace the letters which are randomized with the appropriate digit by seeing the key. The first 10 items were used to practice, to ensure that participants understand the instructions. After completion of 10 practice items, participants were instructed to draw the remaining items as fast as possible. The number of correct substitutions made in 60 seconds is measured and a score was given.
Music intervention:
All 30 participants were instructed to listen to Indian classical Music Raga ‘Malkauns’ and Yaman for 30mins daily for 6 days a week for6 weeks from 5.00 to 6.00 pm in the department of Physiology using pre-recorded Raga Malkauns and Yaman by flute with earphones at a comfortable level of volume of their choice from the android mobile phone. Raga Malkauns & Yaman by Pandit Raghunath Seth was included based on trained musicians' opinions. Raga Malkauns is known for its special appeal to human feelings. In Indian classical music, Malkauns belongs to the Bhairavi That. Malkauns is a meditative raga and is developed mostly in the lower octave & in a slow tempo. Rabindra Sangeet based on raga Malkauns has a strong positive effect in relieving stress from human beings. 12
Statistical analysis:
The data is analyzed using SPSS version 23. All the values were expressed as Mean ± SD. The student's paired "t" test was used to compare EI & GI scores before and after music intervention. Pearson’s correlation was used to determine the correlation between EI & GI.
RESULTS:
The mean age of male and female participants was 19.47±1.76yrs and 19.24±1.47yrs respectively. Emotional Intelligence (EI) and General Intelligence (GI) was scored before and after music intervention. Table 1 provides the effect of music on general intelligence. Digit symbol substitution test (DSST) test scores show significant improvement after music. Letter digit substitution tests (LDST) score did not show significant improvement after music. Table 2 shows that TEI global score and the four subscales proved to be independent of the music, p>0.41. Table 3 provides a correlation among five measures of EI (TEI global & four subscale scores) and 2 IQ measures (DSST & LDST). The global score of the TEI test did not show a correlation with any of the GI tests. TEI subscale- Self-control and Emotionality showed a strong significant positive association with the DSST & LDST.
DISCUSSION:
This study aimed to test the hypothesis that listening to music-Raga Malkauns & Yaman is associated with improved emotional and general intelligence among undergraduate medical students. The key finding was that music had increased the executive aspect of cognition, but not the Global Emotional intelligence score or any of the four subscales of emotional intelligence.
Our results are similar to the study done by Schellenberg et al. where listening to music was positively associated with IQ in school children. Listening to Mozart music for 10mins was known to improve spatial reasoning skills. According to the Mozart effect, any cognitive enhancement did not last longer than 10-15mins, and the increase in IQ is mainly because of ‘enjoyment arousal’. It was also found that the Mozart effect does not influence the executive function of cognition. So to avoid the Mozart effect, in our study executive aspect of cognition was measured using LDST, DLST. 10
Subdivision of executive functions such as planning, attention, inhibition and working memory plays a crucial role in the general intelligence process. In our study, we found a significant improvement in DSST score after 6weeks of listening to music. Similarly, Jaschke et al. showed that children following structured music lessons perform better on tasks measuring verbal IQ, planning & inhibition subdivision of executive functions during two and half year follow-up with music interventions.13 Our findings were further supported by Karuna Nagarajan et al. where Indian Raga Bhupaliand was shown to have a significant effect on cognition.14 Also studies on Raga Darbari showed enhancement in cognitive performance as a direct consequence of listening to music among medical college students.
In child musicians, fMRI and neuropsychological testing showed increased brain activity in the Ventro-Lateral Prefrontal cortex (VL-PFC) and medial prefrontal cortex which are involved in executive sub-functions. Thus, these areas are equally recruited while playing music which might be the reason for increased cognition and academic performance. 15
Similar to our results, a study done on musically trained participants showed higher IQs but not EI when compared with untrained counterparts.16 In contrast, listening to Indian classical music Hamsadhvani had shown a significant effect on Emotional Intelligence among young adults.
According to our results in table 3, self-control and emotional stability were known to be positively correlated with an executive aspect of cognition. People with high Emotional intelligence (EI) were known to have lower perceived stress despite high Cortisol levels at baseline compared to subjects with low EI subjects. In contrast, GI showed no significant correlation with EI and stress level.17 Positive correlation between EI and academic performance is noted in many studies.6,7 Intelligence is said to be directly related to academic success and the higher the emotional intelligence, the higher will be the academic success and vice versa. It can be assumed that for better academic performance, students’ emotional intelligence has to be enhanced.18
Continuous development of EI skills is assumed to help students cope with stressful environments. Raga Malkauns has a strong positive effect in relieving stress from human beings. It conveys a mood that is serene, calm, peaceful, joyful and lively.12 Thus listening to these types of ragas can relieve stress and improve the emotional intelligence and general intelligence in medical students.
Medical students with high EQ have the potential to become effective compassionate physicians who are in a position to communicate well with patients. A high level of EI is a protective factor in the occurrence of mental disorders, including depression, affects the treatment process in patients and also the creation of effective strategies for coping with stress.19 Surgeons EI have a positive effect on patient-rated patient-surgeon relationships.20 EI among clinical postgraduate students was positively associated with age but negatively correlated with the workload, longer night duty hours, & more sudden emergency duties.21 EI training programs for a surgical specialty, otolaryngology, showed that a faculty-led and mentored interactive training program using high-risk/high-stress simulations enhanced participants’ recognition, understanding, and management of emotions. When followed over some time, these changes were reflected in increased patient satisfaction with their physicians.22 EQ has growth potential and inherent plasticity. Hence EI must be addressed collaboratively by the students, faculty and administration to improve patient care in a tertiary care hospital.
CONCLUSION:
Listening to Music helps in the improvement of general intelligence thereby helps in improving academic performance in medical undergraduates. No improvement in emotional intelligence was noted. At the same time, no deleterious effect of music was observed in emotional intelligence.
LIMITATION:
In our study the duration of music listened was 6 weeks, a study on the long term effect of music on Emotional and general intelligence is required.
CONFLICT OF INTEREST: None
SOURCE OF FUNDING: None
ACKNOWLEDGEMENT: Authors acknowledge the study participants for their time and commitment to follow the instructions given by the principal investigators. The authors acknowledge the immense help received from the management & dean of our institute for providing us with the required infrastructure to carry out this work even after working hours. We also thank the scholars whose articles are cited and included in references of this manuscript.
Englishhttp://ijcrr.com/abstract.php?article_id=4074http://ijcrr.com/article_html.php?did=40741. Cherniss C, Extein M, Goleman D, Weissberg RP. Emotional intelligence: What does the research really indicate?. Educational Psychologist. 2006; 41(4): 239–245.
2. Azimi S, AsgharNejad Farid AA, Kharazi Fard MJ, Khoei N. Emotional intelligence of dental students and patient satisfaction. Eur. J. Dent. Educ. 2010;14(3):129–132.
3. Mishra S. Do we need to change the medical curriculum: regarding the pain of others. Indian Heart J. 2015; 67(3):187.
4. Dyrbye LN, Harper W, Moutier C, Durning SJ, Power D V, et al. A Multi-institutional study exploring the impact of positive mental health on medical students’ professionalism in an era of high burnout. Acad Med. 2012;87(8):1024–1031.
5. Abdulghani HM, AlKanhal AA, Mahmoud ES, Ponnamperuma GG, Alfaris EA. Stress and its effects on medical students: A cross-sectional study at a college of medicine in Saudi Arabia. J Heal Popul Nutr. 2011;29(5):516–522.
6. Ranasinghe P, Wathurapatha WS, Mathangasinghe Y, Ponnamperuma G. Emotional intelligence, perceived stress and academic performance of Sri Lankan medical undergraduates. BMC Med Educ. 2017;17(1):41
7. Wijekoon CN, Amaratunge H, De Silva Y, Senanayake S, Jayawardane P, Senarath U. Emotional intelligence and academic performance of medical undergraduates: A cross-sectional study in a selected university in Sri Lanka. BMC Med Educ. 2017;17(1):1–11.
8. Vijayabanu U, Menon R. Impact of music intervention on emotional intelligence. Int J Humanit Arts Med Sci . 2016;4(1):19–24.
9. Cooper A, Petrides K V. A psychometric analysis of the Trait Emotional Intelligence Questionnaire-Short Form (TEIQue-SF) using item response theory. J Pers Assess. 2010;92(5):449–457.
10. Franco F, Swaine JS, Israni S, Zaborowska KA, Kaloko F, et al. Affect-matching music improves cognitive performance in adults and young children for both positive and negative emotions. Psychol Music. 2014;42(6):869–887.
11. Jaeger J. Digit symbol substitution test. J Clin Psychopharmacol. 2018;38(5):513–519.
12. Mukherjee S, Palit SK, Banerjee S, Bhattacharya DK. A comparative study on three different types of music based on the same Indian raga and their effects on human autonomic nervous systems. In: Springer Proceedings in Complexity. Springer; 2015; 243–254.
13. Jaschke AC, Honing H, Scherder EJA. Longitudinal Analysis of Music Education on Executive Functions in Primary School Children. Front Neurosci. 2018;12:103.
14. Nagarajan K, Srinivasan T, Ramarao N. Immediate effect of listening to Indian raga on attention and concentration in healthy college students: A comparative study. J Heal Res Rev. 2015;2(3):103-107.
15. Zuk J, Benjamin C, Kenyon A, Gaab N. Behavioral and Neural Correlates of Executive Functioning in Musicians and Non-Musicians. PLoS One. 2014;13(1): e0191394.
16. Schellenberg EG. Music lessons, emotional intelligence, and IQ. Music Percept. 2011;29(2):185–194.
17. Singh Y, Sharma R. Relationship between general intelligence, emotional intelligence, stress levels and stress reactivity. Ann Neurosci. 2012;19(3):107–111.
18. Id QS, Hussain I, Syed MA, Parveen R, Lodhi S, Mahmood Z. Association between emotional intelligence and academic success among undergraduates?: A cross-sectional study in. PLoS One. 2019;1–22.
19. ?uchowicz P, Skiba A, Ga?ecki P, Talarowska M. The emotional intelligence in major depressive disorders. Pol Merkur Lekarski. 2018;45(267):131–133.
20. Weng HC, Steed JF, Yu SW, Liu Y Ten, Hsu CC, Yu TJ, et al. The effect of surgeon empathy and emotional intelligence on patient satisfaction. Adv Heal Sci Educ. 2011 Dec;16(5):591–600.
21. Ravikumar R, Rajoura OP, Sharma R, Bhatia MS. A Study of Emotional Intelligence Among Postgraduate Medical Students in Delhi. Cureus. 2017;9(1):1–10.
22. Dugan JW, Weatherly RA, Girod DA, Barber CE, Tsue TT. A longitudinal study of emotional intelligence training for otolaryngology residents and faculty. JAMA Otolaryngol - Head Neck Surg. 2014;140(8):720–726.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareMultiple Myeloma Presenting as Fatal Hyperviscosity Syndrome: A Rare Case Report
English8083Jahnabi BhagawatiEnglish Abhijeet Kumar AgrawalEnglish Sunil KumarEnglish Sourya AcharyaEnglishIntroduction: Hyperviscosity syndrome is regarded as a rare oncological emergency with a bleak prognosis. Though it is more commonly found in patients of Waldenstrom’s macroglobulinemia and only 2-6% cases are reported in multiple myeloma. Aim: To highlight the therapeutic burden vindicated by Hyperviscosity syndrome over a case of multiple myeloma. Case Report: A 46-Year-old male patient presented to the emergency department with a history of two episodes of epistaxis with a mild headache for a few hours. The patient gave a history of bony pain at night. On investigation, the patient’s complete blood count revealed Hb-1.2g/dl, TLC-6300 cells, platelet count -77 lakhs/cu mm) and Peripheral smear-showed RBC in rouleaux formation. Bone marrow showed myeloma cells. X-ray skull [lateral view] showed punched-out lytic lesions. Urine examination showed no Benz Jones proteins. Hyperviscosity syndrome ultimately leads to the patient’s demise. Methods: We are reporting a case of multiple myeloma in a 46-year-old male who presented with epistaxis and acute kidney injury as part of Hyperviscosity syndrome. The database was searched from google, PubMed, Scopus and web of science. Conclusion: This case report represents the minority of multiple myeloma patients. This case report represents the minority of multiple myeloma patients. Hyperviscosity syndrome presents as a significant touchstone when dealing with patients with multiple myeloma and the complications following HVS can be often fatal while the patient may present with varied clinical features each separate time.
English Hyperviscosity syndrome, Waldenstrom’s macroglobulinemia, Multiple Myeloma, Epistaxis, Acute Kidney InjuryIntroduction
Among plasma cell neoplasms, the most common is multiple myeloma. Other included neoplasms are MGUS (monoclonal gammopathies of unknown significance), plasma cell leukaemia, and plasmacytomas. Plasmacytoma is a localized form of neoplasm that is further classified into SPB (solitary plasmacytoma of bone) and EMP (extramedullary plasmacytoma) with each of them forming only < 4% of neoplasm burden whereas multiple myeloma forms the systemic disease.1 Multiple myeloma, a neoplastic lymphoproliferative B-cell systemic malignant disease depicts non-prohibited plasma cell (monoclonal) proliferation inside bone marrow resulting in flooding of peripheral blood with immunoglobulins that are non-functional.2
Blood Hyperviscosity Syndrome (BHVS) encompasses clinical features due to increased blood or plasma viscosity.3HVS presents with a classical triad of neurological manifestations, visual disturbances, and mucosal bleeding. Universal findings in cases of HVS would be epistaxis, oral bleeding, and visual symptoms. Evaluation of patients with Hyperviscosity syndrome must include a clinical history of any haematological disease or a similar disorder that runs in family. Impaired platelet function gives rise to bleeding in the form of Gastrointestinal bleed or epistaxis. The neurological manifestations are due to impaired blood supply to the central nervous system, the peripheral nerves however are affected due to paraproteins getting deposited in their myelin sheath. Patients show easy bruising with characteristic evidence on retinal examination (thick veins, haemorrhages, and papilledema). Patients may develop visual symptoms in the form of a sudden loss of vision, blurred vision, etc. Patients may also show signs of cardiac dysfunction in the form of valvular dysfunction, shortness of breath, myocardial infarction, and high output cardiac failure. The hypoperfusion of kidneys may lead to acute kidney injury (AKI).3 Few case reports are available about multiple myeloma and Hyperviscosity syndrome, but no reports are available regarding this syndrome presenting as fatal epistaxis and acute kidney injury.4,5 We are reporting a case of multiple myeloma in a 46-year-old male who presented with epistaxis and acute kidney injury as part of Hyperviscosity syndrome.
Case report
A 46-Year-old male patient presented to the emergency department with a history of two episodes of epistaxis with a mild headache for a few hours. The patient gave a history of bony pain at night. The patient had no other relevant history in the form of fever, cough, vomiting, loss of consciousness, seizures, head trauma, etc. The patient had similar episodes 2 days back. The patient was initially admitted to the ENT (Oto-rhino-laryngology) department where nose packing with supportive management was given. No Oro-pharyngeal cause could be found to explain the epistaxis. Hence patient was transferred to the medical department for further evaluation.
On examination-patient was conscious, oriented, afebrile with a pulse rate of 102/min, blood pressure of 100/70 mm of Hg in right arm supine position, and a respiratory rate of 22 cycles per min. JVP was not raised, the hepatojugular reflex was negative. Mild Pallor was present, no icterus, cyanosis, pedal oedema, lymphadenopathy. On systemic examination, cardiovascular examination revealed s1s2, respiratory system -no basal rales in bilateral lung fields, abdominal examination showed no splenomegaly, and the patient had no focal neurological deficit.
On investigation, the patient's complete blood count revealed Hb-1.2g/dl, TLC-6300 cells, platelet count -77 lakhs/cu mm) and Peripheral smear-showed TLC-6300cells/cu mm, DLC-Polymorphs 57%, lymphocytes 27, eosinophils-02% and monocytes-01% with RBC in rouleaux formation which gave a false impression of anaemia. There was a high suspicion of myeloma cells. Bone marrow showed myeloma cells. The repeat peripheral smear was suggestive of peripheral blood spill of myeloma cells (fig1) Other investigations -ESR-127mm (Westergren)in 1st hour Other relevant investigations revealed punched out lytic lesions on X-ray skull (lateral view), urine examination showed no Benz jones proteins and Hypercalcemia was present. Initial blood urea-160, serum creatinine -5.4. Liver function test showed Total bilirubin -1.3 mg/dl, serum protein-8.3 mg/dl, albumin-2.7mg/dl, globulin-5.6mg/dl.
Specific investigations about multiple myeloma like serum protein electrophoresis showed a small M band, serum-free light chain showed kappa free light chain -19.1, and lambda free light chain -37.
Following the above investigations, the patient was diagnosed to have multiple myeloma with Hyperviscosity syndrome. For the management of Hyperviscosity, the patient was put on extensive intravenous fluid therapy and side by side patient was counselled for plasmapheresis and chemotherapy. For 2 – 3 days patients' urine output started showing decrement and blood urea rose to 200 mg/dl and serum creatinine peaked to a value of 12.5 mg/dl signifying acute kidney injury. Subsequently, the patient was planned for hemodialysis. During the process of dialysis catheter insertion, there was frequent catheter blockage due to increased blood viscosity and the same could not be rectified even after copious heparinization of a dialysis catheter. Similar problems were encountered during future venipuncture for monitoring renal status.
Intractable acute kidney injury (persistent metabolic acidosis and hyperkalemia) due to non-responsive Hyperviscosity syndrome ultimately leads to the patient’s demise.
Discussion
Multiple myeloma as a separate entity was extensively documented for the first time in 1844, in a 39-year-old female named Sarah Newbury via autopsy. The disease was initially thought to have an inflammatory process where the bone substance was eliminated from the body via patients’ kidneys.3 This may explain the rise in cases of multiple myeloma in the western population because of the increasing age of the population. Fatigue and bony pain are often the commonest presenting symptoms in multiple myeloma, especially in patients with a high tumour burden. The hallmark lesions for multiple myeloma comprise lytic lesions seen on x-ray, present in up to 80% of cases. On x-rays, the frequent sites to be affected are the spine and ribs, with around 3% of patients also presenting with clinical features of spinal cord compression following compression fractures in vertebrae or due to soft tissue tumours in the spinal cord. Osteolytic lesions in multiple myeloma in contrast to neoplasms which show bony metastasis does not have new bone formation. These bone lesions are the consequence of an exaggerated osteoclastic process in active myeloma cases. Increased bone lysis may further lead to hypercalcemia which forms the other spectrum of clinical manifestations due to hypercalcemia in the form of constipation, abdominal pain, and confusion. Some red flag signs can contribute to early diagnosis such as chronic backache (forming 58% of complaints by patients), fatigue, weight loss along abnormal blood test results. Pleural effusion is a rare occurrence in multiple myeloma, forming < 6% of cases. However, the presence of pleural effusion indicates a poor prognosis with a median survival of fewer than 4 months. Another rare presentation can be Isolated cystic swelling.1 Evidence of end-organ damage in the form of renal impairment, bone marrow failure, bone damage, or hypercalcemia must induce the idea to start treatment immediately as these patients carry high-risk features. Initially, the tumour burden should be decreased to reduce the ongoing damage. The patients with multiple myeloma can be divided into 2 broad categories depending on if they are eligible for stem cell transplantation and the ones who cannot undergo intensive procedures.2
Plasma viscosity is primarily determined by the number of cells (cell volume), RBC’s mechanical properties, concentration, and nature of plasma proteins, etc. BHVS [blood Hyperviscosity syndrome] consists a characteristic of Waldenstrom’s triad which consists of visual disturbances (visual acuity decline, diplopia), mucosal bleeding (gum bleeding, epistaxis), and neurological manifestations (ataxia, motor deficit, headache, dizziness, tinnitus, chorea, altered consciousness, coma, and seizures). Some non-specific signs like signs of heart failure, dyspnoea, microcirculatory dysregulation (livedo reticularis, extremities necrosis), and pulmonary hypertension.5 Hyperviscosity syndrome presents itself in 3 distinct faces, generalized manifestations, vascular manifestations, and central nervous system manifestations. Patients with HVS may present with symptoms like loss of appetite, tiredness, and loss of weight. They may suffer from episodes of epistaxis that are recurrent in nature, menorrhagia, and bleeding per rectum and through gums. In the periphery, the patient may present with palmar erythema. Central nervous system manifestations may include dizziness, headaches, convulsions, nausea, and peripheral neuropathies. A shift of extra fluid into the vascular compartment due to increased serum proteins can precipitate congestive cardiac failure.6
A patient may suffer bleeding tendencies even with a normal platelet count due to increased blood viscosity. Patients who have chronic diseases may show a lower threshold for the development of HVS. Patients who have diabetes tend to develop visual symptoms earlier than non-diabetic patients, this may be because diabetic patients are already at risk for retinopathy. The rise in serum globulin concentration is not always in proportion to serum viscosity. Serum viscosity also varies as per immunoglobulin structure and their tendency to form aggregates. For example, IgM rapidly produces Hyperviscosity syndrome in lymphoid malignancy due to increased synthesis. HVS is seen in about 4% of multiple myeloma cases, maximum cases having IgG myeloma. This feature may be due to the tendency of IgG to form polymers at lower concentrations leading to an exaggerated rise in blood viscosity with only 3 times a rise in serum protein levels. In contrast, IgA myeloma rarely causes Hyperviscosity syndrome. Many immune complex diseases, some of which are having concomitant cryoglobulinemia develop Hyperviscosity. In patients with rheumatoid factor, they form intermediate complex” due to aggregation of proteins within the circulation. These complexes may come to be by various mechanisms. Their contents may vary as some have only IgG, some may have IgM, and some have ANA (anti-nuclear antibody). Some of these immunoglobulins deposit in glomeruli whereas others may lead to vasculitis.6
Hyperviscosity syndrome is a life-threatening emergency that may present with any of the following complications like ischemia leading to organ failure, myocardial infarction & thromboembolic events.7 The patient must also undergo laboratory investigations for complete blood count, coagulation studies, serum biochemistry, and urine analysis. Urine examination showing heavy proteinuria leading to a high albumin-protein gap may suggest gammopathy. Serum stasis can be indicated by rouleaux formation, serum stasis may further lead to improper lab equipment reading hindering the sample analysis. Immunoglobulins if measured quantitatively may help to determine long-term management.8 Hyperviscosity syndrome often presents as a medical emergency characterized by a wide spectrum of clinical manifestations due to raised plasma viscosity. The most common mode of presentation forms a triad of mucosal bleeding in the form of epistaxis or bleeding from the gums, neurological presentation in the form of altered consciousness, ataxia, chorea, etc. and visual symptoms in the form of diplopia or fall in acuity.5 Our patient came with chief complaints of epistaxis and headache. An extensive blood workup revealed that he has multiple myeloma and a peripheral smear showing rouleaux formation signifying the presence of HVS [Hyperviscosity syndrome].
The most common aetiology for HVS is Hypergammaglobulinemia, Waldenstrom macroglobulinemia to be specifically followed by multiple myeloma. 25% of these cases are due to elevated IgA immunoglobulins in plasma.8 Patients with multiple myeloma are prone to develop renal insufficiency in the presence of HVS that may go unrecognized for some time. Multiple myeloma patients having raised plasma viscosity show features of impaired blood flow through microvascular circulation, this may present as acute renal failure demanding an immediate response. Plasmapheresis is specifically required on an urgent basis either at the first clinical sign of HVS or even prophylactically in patients of multiple myeloma as soon as the patient's paraprotein level crosses the threshold.4 our patient too was planned for plasmapheresis but due to severe HVS the cannulation failed, and the patient succumbed the next day due to acute renal failure.
Classically, the syndrome is a result of increased amounts of immunoglobulin M (IgM) in Waldenstrom macroglobulinemia. Less commonly, symptomatic blood Hyperviscosity has been described in certain cases of MM, especially when abnormal polymers of IgA, IgG, or kappa light chains are produced. HVS is a consequence of stasis of blood that leads to circulatory failure ultimately resulting in organ dysfunction. The clinical spectrum is broad, including the following: Mucosal bleeding to life-threatening gastrointestinal haemorrhage. Cardio-respiratory symptoms. Vascular occlusion in the periphery may present as ulcers or gangrenes of the extremities and Raynaud’s phenomenon. 9,10,11
Conclusion: Hyperviscosity syndrome presents as a significant touchstone when dealing with patients with multiple myeloma and the complications following HVS can be often fatal while patients may present with varied clinical features each separate time. Timely interventions and standard treatment protocol even when followed to the letter may not be enough to save the patient in some cases. Careful clinical and laboratory correlation is a must to make a judgment for prompt management.
Acknowledgement: Nil
Conflict of interest: Nil
Source of funding: Nil
Englishhttp://ijcrr.com/abstract.php?article_id=4075http://ijcrr.com/article_html.php?did=40751. Kumar S, Jain A, Waghmare S. Multiple cystic swelling: Initial presentation of multiple myeloma. Indian J Med Paediatr Oncol. 2010;31(1):28.
2. Gerecke C, Fuhrmann S, Strifler S, Schmidt-Hieber M, Einsele H, Knop S. The Diagnosis and Treatment of Multiple Myeloma. Dtsch Arztebl Int. 2016; 113(27-28):470-476.
3. Perez Rogers PA, Estes M. Hyperviscosity Syndrome. In: StatPearls. Treasure Island (FL). 2020.
4.Costa AF, Almeida F, Batista AF. Hyperviscosity syndrome - a case report. Int J Fam Commun Med. 2019;3(4):166-167.
5. El Kassim I, Touab R, Elkoundi A, Khayar Y. Blood Hyperviscosity Syndrome Revealing Multiple Myeloma in Emergency Department: Report of a New Case. 2018; 5:88–91.
6. Goldschmidt N, Zamir L, Poperno A, Kahan NR, Paltiel O. Presenting Signs of Multiple Myeloma and the Effect of Diagnostic Delay on the Prognosis. J Am Board Fam Med. 2016;29(6):702–9.
7. Yogesh Khithani, Sunil Kumar, Nitin Raisinghani, Sachin Agarwal, Ayush Somani.Multiple myeloma presenting as a pleural effusion in the elderly. Ann Geriatr Educ Med Sci. 2018 ;5(1):36–7.
8. Jewell S, Xiang Z, Kunthur A, Mehta P. Multiple Myeloma: Updates on Diagnosis and Management. Fed Pract Health Care Prof VA DoD PHS. 2015;32(Suppl 7):49S-56S.
9. Kaur G, Umar J, Thoguluva Chandrasekar V, Graziano S. Acute Respiratory Failure Secondary to Hyperviscosity Syndrome in a Rare Case of IgM Myeloma. Chest. 2016;150(4):410A.
10. Akhilesh Annadatha, Sourya Acharya, Samarth Shukla, Amol Bhawane, Anuj Varma, Amol Andale. Multiple Myeloma presenting as Hypercalcemic Crisis: A case report. Medical Science.2020;24(105):3148-3152.
11. Parveen, Sana, Jain S. Pathophysiologic Enigma of COVID-19 Pandemic with Clinical Correlates. Int J Cur Res Rev. 2020;12: 33-37
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareEffectiveness of Right Median Nerve Electrical Stimulation in Improving Functional Status in Persons with Traumatic Brain Injury
English8487Divya LEnglish Kumaresan AEnglish Prathap SuganthirababuEnglish Vignesh SEnglishBackground: Traumatic brain injury is one of the devastating clinical conditions, leading to loss of consciousness and arousal at some point of time after injury. The median nerve serves as the peripheral gateway for accessing the central nervous system among persons with coma. Aim: The study aims to evaluate the effectiveness of the right median nerve electrical stimulation on functional status in participants with traumatic brain injury. Methods: A quasi-experimental study was done on 30 traumatic brain injury participants. Participants were recruited after obtaining an informed consent form from the participant’s caregiver. Ranchos Los Amigos Scale was used as a screening tool for the inclusion of participants. The pre-test measurement of functional status was obtained through the Disability rating scale. Right median nerve electrical stimulation was given over the right hand for four weeks. At the end of study duration, Post-test measurements were taken and data were tabulated and analyzed statistically by using Wilcoxon signed-rank test. Results: It was observed that there was a significant improvement in functional status (PEnglishTraumatic Brain Injury, Coma, Median Nerve, Right Median Nerve Stimulation, Functional Status, Disability Rating ScaleIntroduction
Traumatic brain injury (TBI) is a form of acquired brain injury leading to insult to the brain due to sudden trauma and the Centers for Disease Control and Prevention (CDC) defines TBI as craniocerebral trauma related to neurological/neuropsychological abnormalities, skull fracture, intracranial lesions or death.1,2At the global, it has been estimated that the annual incidence and mortality from TBI are 200 and 20/100000/year, respectively.3,4The incidence, mortality, and case-fatality rates in India were 150/100000, 20/100000, and 10% based on an epidemiological study.4,5In India, it is estimated that nearly about 1 million dies every year.6Road Traffic accident (RTA) is regarded as one of the leading causes of TBI. RTA contributes to (60%) of TBI followed by falls (20-25%) and violence (10%).4 Males are suspectable to TBI with 75% incidence in contrast to females and the ratio of injury in male to female in India is about 3:1.7, 8
TBI has been categorized into primary or secondary brain injury. The former is due to the consequences of the physical insult whose pattern and extent of damage depend upon the nature, intensity, and duration of impact.9 Primary and secondary TBI cause temporary and/or permanent dysfunction in the brain, which limits a patient’s activities, affects participation in society, and lowers the quality of life.10,11About 17% of TBI persons undergo a period of complete unconsciousness or coma.12TBI patients have a clinical presentation with the signs and symptoms of loss of consciousness, ear and nose bleed, seizures, paresis, nausea, balance deficits, cognitive-communication and swallowing.13 Physical therapists play a vital role in the neurorehabilitation of traumatic brain injury patients.
The disorders of consciousness(DOC) include coma, vegetative state, and minimally conscious state. Clinical diagnosis of coma is defined by absent or limited vocal or muscle activity and presence of decreased or any abnormal response to noxious stimuli, an absence of sleep-wake cycle.14
Severe DOC range from coma via vegetative state (VS) also referred to as unresponsiveness wakefulness syndrome, a condition during which the patient shows no behavioural evidence of conscious–to minimally conscious state (MCS), characterized by one or more minimal but definite behavioural signs of consciousness.15,18
In the past decades, physiotherapy techniques including neuromuscular electrical stimulation have played a vital role in neurorehabilitation for facilitating or inhibiting muscle tone. It also plays an essential role in unconscious patients. For providing stimulation, the median nerve of the right arm was selected. The right side of the brain has a major representation for cortical reorganization and is responsible for cognitive and sensory reorganization. The sensory distribution of the right hand has a larger cortical representation in the brain. Median nerve stimulation might function by acting on a few neurotransmitters.19,20The disability rating scales (DRS) has been utilized in moderate and severe TBI. DRS can be easily administered and has good reliability and validity. This study aims to evaluate the effect of the right median nerve stimulation on functional status among traumatic brain injury participants.
Methods
The study was a Quasi-experimental study conducted in Saveetha Medical Hospital, Thandalam, Chennai. The sample was drawn from the Physiotherapy neurorehabilitation centre and Inpatient Units at Saveetha Medical Hospital. The study was conducted after getting approval from the Institutional Human Ethical Committee of Saveetha Institute of Medical and Technical Sciences 038/07/2020/IRB-HS/SIMATIC. A convenient sampling technique was used for 30 participants in the study. The safety and simplicity of the procedure were explained to participants caregivers and an informed consent form was obtained from them. Ranchos Los Amigos (RLA) scale was used as a confirmatory test for the inclusion of participants. Selection criteria included RLA Level 1-2 participants, both male, and female, aged between 20 to 55 years, hand dominance–right hand. Participants were excluded if there was, vital signs of unstable, injury of median nerve/brachial plexus and fracture of right wrist, metallic implant in the right upper limb, cervical spinal cord injury, absent sensation in the thenar eminence of the right hand, history of seizures, Cardiac arrhythmia /Pacemaker implanted and pregnancy.
Pre-treatment reading of functional status was noted by using a disability rating scale. After the pre-test measures, participants received treatment through the right side median nerve stimulation. The participant position was supine lying with upper extremity elbow extended, forearm supinated, wrist and fingers extended. The right side forearm was selected for treatment and Neuromuscular electrical stimulation equipment was used.
In order, to reduce the skin resistance hand was wiped with a cotton swab. The electrode placement was active electrode over the volar aspect of the right forearm and the inactive electrode over the volar 2/3rd of the right forearm. Parameters of neuromuscular electrical stimulation- the type of current: surged faradic current, waveform: asymmetric biphasic, frequency: 40hz, duration: 300 ms, amplitude: 20 sec/min, no of contractions: based on the response of muscle to avoid fatigue. The skin was examined for erythema under the electrode site during each treatment session. Similarly, Post-treatment readings were noted by using a disability rating scale.
Results
The collected data were tabulated and analyzed using a nonparametric test. Wilcoxon signed-rank test was utilized for within-group analysis. The significance level of (PEnglishhttp://ijcrr.com/abstract.php?article_id=4076http://ijcrr.com/article_html.php?did=40761. Solmaz et al. Traumatic brain injury due to gunshot wounds. A single Institution's experience with 442 consecutive patients. Turk Neurosurg.2009;19:216-23.
2. Centers for Disease Control and Prevention (CDC). National centre for traumatic brain injury prevention and control. Report to Congress on mild traumatic brain injury in the United States: Steps to prevents serious public health problem. Atlanta (GA): Centers for Disease Control and Prevention. 2003.
3. Romer CJ, Zitnay G, Gururaj G et al. Prevention, critical care and rehabilitation of Neurotrauma WHO Collaborating center for Neurotrauma.1995.
4. Gururaj G. An Epidemiological approach to prevention, prehospital care and Rehabilitation In neurotrauma, Neurology India.1995;43(3):106.
5. Gururaj G. Epidemiology of Traumatic brain injuries.Indian Scenario. Neur Res.2002;24:1-5.
6. Masel B, Dewitt D. Traumatic Brain injury disease. Long-term consequences of traumatic brain injury. In H.Levin, D&R.Chan(Eds), Understanding traumatic brain injury. Curr Res Fut Direct.2014.
7. Iranmanesh.F. Outcome of Head trauma. Indian J Pediatr.2009;76(9):929-31.
8. Oyedele EA, Andy E, Solomon GM, Rifkatu L, Nanbur S. The prevalence of traumatic the head is seen in a tertiary health facility in North-Central Nigeria.IJPHR.2015;3(4):127-9.
9. Mass AI MAGS.Prognosis and clinical trial design in traumatic brain injury: The IMPACT study.2007.
10. B.T Mausbach, et al. Activity Restriction and depression in medical patients and their caregivers. A meta-analysis, ClinicalPsychology Review.2011; Vol 3: No 6,pp.900-908.
11. K.A Cappa, J.C Conger, A.J. Conger.Injury severity and outcome.A meta-analysis of prospective studies on TBI.Health Pschol.2011;30(5): 542-560.
12. Mohammad Ali HeidariGorijiet.al.Effect of auditory Stimulation on traumatic coma duration in intensive care unit of the Medical Sciences University of Mazandaran. 2014;8(1);69-72.
13. Gill P, Gill T, Kamath A, Whisnant B. Readability assessment of concussion and traumatic brain injury publications by the Centers for Disease Control and Prevention. Int J General Med.2012; 5:923-933.
14. Laureys S, Owen A, Schiff N. Brain Function in a coma, vegetative state, and related disorders. Lancet Neur.2004;3(9):537-46.
15. Jennett B, Plum F. Persistent Vegetative state after brain damage- A syndrome in search of a name. The Lancet.1972;229(7753):734-37.
16. LaureysS, Celesia G G, Cohadon F, Lavrijsen J, Leon-Carrion J, Sannita WG et al. European Task Force on Disorders of consciousness Unresponsive wakefulness syndrome: A new name for the vegetative state or apallic syndrome. BMC Med.2010;8-68.
17. Giacinto JT, Ashwal S, Childs N, Cranford R, Jennett B, Katz DI et al. The minimally conscious state: definition and diagnostic criteria. Neurology.2002; 58(3):349-53.
18. Giacino JT, Kalmar K, Whyte J. The JFK Coma recovery scale- Revised measurement characteristics and diagnostic utility. Arch Phys Med Rehabil.2004;85:2020-2029.
19. Cooper EB, Scherder EJ, Cooper JB. Electrical treatment of reduced consciousness: experience with coma and Alzheimer's disease. Neuropsychol Rehabil. 2005;15:389-405.
20. Lei J, Wang L Gao G, Cooper E, Jiang J. Right Median Nerve Electrical Stimulation for acute traumatic coma patients. J Neurotrauma.2015;32(20):1584-1589.
21. Michal VaimanEphraimnEviatar, Samuel Segal, Tel Aviv, Israel, Surface electromyographic studies of swallowing in normal subjects. A review of 440 adults. Report Quantitative Data. Timing Measures Otolaryngology-Head and Neck Surgery 2004;131:548-555.
22. Rappaport M, Hall KM, Hopkins K, Belleza T, Cope DN. A disability rating scale for severe head trauma: coma to community. Arch Phys Med Rehabil.1982;63(3):118-23.
23. Kaur H, Gupta D, Sharma V. Right Median nerve stimulation for improving consciousness: A case series.Int J Neo Ther.2015;12(2):144-8.
24. Kwan CL,Crawley AP, Mikulis DJ, Davis KD. An fMRI study of the anterior cingulated cortex and surrounding medial wall activations by noxious cutaneous heat and cold stimuli.Pain.2000;85(3):359-74.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareCorrelative Evaluation between Clinical and Pathological Diagnosis in Multinodular Goiter
English8891Abhay D. HavleEnglish Kaenat AhmedEnglish Munnuru Khaleel BashaEnglishIntroduction: Multinodular goitre is an enlarged, diffusely heterogeneous thyroid tissue. Initial presentation may include diffuse enlargement, but asymmetrical nodularity develops later on. Objective: To correlate between clinical features, FNAC and histopathology findings in cases of multinodular goitre. As far as the Study Design is concerned it is a prospective observational study. Materials and Methods: All clinically diagnosed cases of multinodular goitre were included in the study. All cases underwent FNAC and subsequent thyroidectomy after routine pre-operative work up such as CBC, Urine, BT, CT, FT3, FT4 and ultra TSH, blood sugar, BUN and ultrasonography of neck etc. The surgical specimens of thyroidectomy were subjected to histopathological examination in all cases. Result: The commonest presenting symptom was neck swelling (100%) and associated pain (48%). The pressure symptoms on food, air passage and recurrent laryngeal nerve like dysphagia, dyspnoea and hoarseness of voice were noted in 42, 22, and 22 per cent of cases respectively with a mean 28.6± 11.54. A significant association of these pressure symptoms was seen with colloid goitre (74%). Hyperthyroidism (14%) was in association with multinodular goitre. On fine needle aspiration cytology (FNAC) the most common finding was nodular colloid goitre 64%, followed by Hashimoto’s thyroiditis 11% and follicular neoplasm 4%. On histopathological examination of the resected thyroid specimen, colloid nodular goitre was seen at 74% and Hashimoto’s thyroiditis in 18%. 1 % of cases had papillary and follicular carcinoma each. Conclusion: Multinodular goitre was more common in females belonging to the age group of 30 to 40 years. The most common (48%) presenting symptom was swelling in front of the neck and associated pain. Pressure symptoms were significantly associated with colloid goitre. Associated hyperthyroidism was in (14%) multinodular goitre cases. The FNAC is a useful investigation for initial diagnosis in cases of multinodular goitre but it could not differentiate between follicular neoplasms. Therefore, histopathology remains an imperative investigation to rule out malignancy in multinodular goitre
EnglishMultinodular Goitre, Presenting Complaints, Fine Needle Aspiration Cytology, ThyroidectomyINTRODUCTION:
Multinodular goitre is an enlarged, diffusely heterogeneous thyroid tissue. Initial presentation may include diffuse enlargement, but asymmetrical nodularity develops later on. Iodine deficiency is a common cause. Initially, the patient is euthyroid; however, eventually, T3 and T4 levels get elevated and later may progress into a clinical hyperthyroid state or malignancy in the nodule. Ultrasonography (USG) and radioisotope scanning help to identify the heterogeneous thyroid substance in the goitre. Nodules with poor uptake of radioactive isotope- I131 or 128 suggest suspicion of malignancy.1-3 The possibility of malignant transformation of thyroid nodule in multinodular goitre is 5% to 10%.4 A variety of tests are carried out to know the anatomical and functional status of the thyroid gland. Fine Needle Aspiration Cytology (FNAC) is an established outpatient procedure useful in knowing the cytological status of thyroid neoplasia. According to American Thyroid Association and National Comprehensive Cancer Network, FNAC should be used as an initial test, because of its superior diagnostic reliability and cost-effectiveness, before both thyroid radioisotope study and ultrasonography.5 Similarly, the most sensitive imaging modality, high-resolution ultrasonography, is available for thyroid gland examination and associated abnormalities. USG in cases of thyroid disease, apart from being useful in interventional diagnostic procedures, is non-invasive, easily available, less expensive and without any ionizing radiation.6
The thyroid functions, i.e. whether the thyroid gland is underactive, overactive or normal cannot be assessed by the USG alone for which simultaneous thyroid function tests and subsequent radioactive isotope study may be required. Hyperthyroidism may be adequately controlled by drugs, but surgical management and histopathological examination of the resected tissue is preferred as it provides an insight as to whether total thyroidectomy would be needed additionally. Subtotal or total thyroidectomy is performed depending on the portion involved. Radioactive iodine therapy is reserved for the elderly who are part of poor operative risk.7 There are many studies conducted about the correlation between FNAC and histopathology of nodular goitre. This study about the correlation between clinical presentation, FNAC and histopathology in cases of nodular goitre was conducted at the rural tertiary care teaching hospital.
MATERIALS AND METHODS:
This is a prospective observational clinical study in cases of multinodular goitre, at the department of otorhinolaryngology of the tertiary care teaching hospital. A total of 100 cases of nodular goitre, irrespective of normal or abnormal thyroid status and having age above 20 years was included in the study. All cases presenting with diffuse enlargement or solitary nodule of the thyroid gland or pregnancy were excluded from the study. The diagnosis of multinodular goitre was based on findings of palpation during clinical examination in all cases. Further, all cases were subjected to T3, T4 and TSH tests, FNAC and ultrasonography of the neck apart from routine CBC(complete blood count), BT(Bleeding time), CT(Clotting time), Urine, blood grouping, x-ray chest and neck etc. Cases with hyperthyroidism were treated and brought to a euthyroid state before surgery. The resected specimen in all cases was further studied by histopathological examination.
STATISTICS METHODS:
A Chi-square test was used to find the significance of age, pain, dysphagia, dyspnoea, hyper/hypo / euthyroid status, hoarseness of voice etc. in the diagnosis of thyroid swelling. All data analysis had been done by using SPSS version 20.0.
RESULTS:
In this study total of 100 diagnosed cases of multinodular goitre without any initial evidence of malignancy were enrolled and subjected to clinical evaluation. The results of relevant investigations, Fine Needle Aspiration Cytology FNAC, the histopathological examinations of surgical specimens were compiled, analyzed. In table 1 Age distribution of multinodular goitre is presented. In table 2 Incidence of presenting complaints in multinodular goitre is presented. In table 3 Fine needle aspiration cytology in multinodular goitre is presented. In table 4 HPE reports in multinodular goitre presented. In table 5 Statistical comparison is presented. The females outnumbered males with M: F ratio of 6:94. The commonest age group was 30 to 40 years and the least common was above 60 years was with 6 females and 4 males. The mean age was 42.26 years ± 12.79. Amongst all cases the commonest associated symptom noted was a pain in neck swelling (48%). Followed by the symptoms due to pressure on food, air passage and recurrent laryngeal nerve noted were dysphagia (42%), dyspnoea (22%) and hoarseness of voice (22%) with an average of 28.6± 11.54. Out of these 42 cases having dysphagia, 20 had only dysphagia, 10 had hoarseness of voice and 12 had dyspnoea as associated symptoms. In 74 cases having colloid goitre the symptoms of dysphagia, dyspnoea, hoarseness of voice and hyperthyroidism were seen with p values 0.05, 0.03, 0.002 and 0.03 respectively. The number of cases of colloid goitre having dysphagia was 48 (35.13%), dyspnoea 15 (20.02%), hoarseness 12 (16.21%) and hyperthyroidism 14 (10.81%). Colloid nodular goitre was the most common finding on FNAC in 64 cases followed by Hashimoto’s thyroiditis 22, adenomatous goitre 8. FNAC was inconclusive in 2 of the cases. In 4 cases follicular neoplasm was found on FNAC who underwent total thyroidectomy to rule out malignancy. On histopathology of surgical specimen colloid, nodular goitre was the commonest finding in 74 of the cases, followed by Hashimoto’s thyroiditis 18, follicular and papillary carcinoma 2 and follicular adenoma 4. The histopathology revealed papillary carcinoma in one case which was inconclusive on FNAC and requiring a total thyroidectomy with nodal clearance at a second surgery.
DISCUSSION:
In this study of 100 cases, the majority were females with an M: F ratio of 6:94. In a similar study, Antonio Rios – Zumbudio et al in 2004 found it to be 11:89. The majority of the cases (33%) were from the age group 30 – 40 years and the least were having age above 60 years. All cases presented with neck swelling. 50% of the cases were having associated symptoms of pain. The mean percentage of the number of cases having symptoms due to pressure by neck swelling like dysphagia (42%), dyspnoea (22%) and hoarseness of voice (22%) was 27.3±9.428. Similarly in the study Rios Zumbudio et al., the average of pressure symptoms is 28.5%. Hyperthyroidism on presentation was found in 14% of cases of multinodular goitres in this study. And in a study of 301 cases of multinodular goitre by Rios- Zumbudio et al it was 22%. This difference maybe because it was presented at an early age in cases of this study as compared to one carried out amongst the western population. In this study out of 100 cases 52% were involving right lobe followed by 44% left lobe and 4% bilateral which correlates with the study by Chakravarthy et al (2017) wherein out of 290 cases 55.1% were involving the right lobe, 40.7 % were left and 4.1% bilateral. One case having multinodular of one lobe with largest measuring 0.7 cm underwent right lobectomy and at 3 months of follow up the opposite lobe was normal. Seven cases involved to left lobe and 4 that involved the right underwent subtotal thyroidectomy. Two cases underwent subtotal thyroidectomy as the initial FNAC was inconclusive. Based on the HPE of the surgical specimen that revealed papillary carcinoma and follicular adenoma, total thyroidectomy was performed in these 2 cases. Therefore, in all 11% underwent subtotal thyroidectomy, 1% right lobectomy and 88% underwent total thyroidectomy. The goitre was confined to the thyroid gland in 90% of cases. Out of the remaining 10%, 8% had a malignant transformation and restricted mobility of thyroid swelling and/ or 2% associated cervical lymphadenopathy which is comparable to 7.9% and 4.1% respectively in the above-mentioned study by Chakravarthy et al.The FNAC finding of the 100 cases revealed nodular colloid goitre in 64% followed by Hashimoto’s thyroiditis 22%, adenomatous goitre 8%, follicular neoplasm 4%and inconclusive in 2%. Cases with follicular neoplasm underwent total thyroidectomy to rule out malignancy. The histopathological examination of the resected specimen revealed colloid nodular goitre in 37% of the cases and Hashimoto’s thyroiditis in 18%. 1 case of follicular neoplasm on FNAC that was operated on turned out to be follicular carcinoma (Hurthle cell variant) on HPE of the specimen. Out 2 cases with inconclusive on FNAC 1 turned out as papillary carcinoma and another follicular adenoma on histopathological examination of the specimen. In all, there were 4 cases of follicular adenoma, 2 cases of follicular carcinoma and 2 cases of papillary carcinoma. Incidence of malignancy in multinodular goitre accounts for 4% which is comparable to the studies by Gondolfi et al. (2004) who had a result of 6.7% in a retrospective study of 81cases, but 1.21% in a study conducted by Nandedkar et al. in 2018. This is probably due to the larger sample size of the study (606) over a long duration (10 years). This study also included all cases of thyroid swellings such as solitary nodular goitre or thyroglossal cyst whereas the present study is focused only on clinically diagnosed cases of multinodular goitre.
CONCLUSION:
Females were the commonest sufferers of multinodular goitre with an M: F ratio of 6:94. The commonest age group was 30 to 40 years amongst all cases of multinodular goitre. Pressure symptoms were significantly associated with colloid goitre. Hoarseness of voice was a significant pressure symptom in 22% of cases of multinodular goitre. FNAC finding of multinodular goitre was significantly useful in making the initial diagnosis. FNAC conclusion of follicular neoplasm could not differentiate further between follicular adenoma and carcinoma therefore histopathological examination to rule out malignancy becomes mandatory. Other symptoms like dysphagia, dyspnoea, tremors, insomnia, palpitation and change in appetite or intolerance to change in temperature were seen in cases suffering from a multinodular goitre but their number was not statistically significant. The presence of cervical lymphadenopathy, as in 2 cases of this study of multinodular goitre, needs to be considered as malignant secondaries arising from the thyroid unless proved otherwise. Similarly, reduced mobility of the gland with irregular margins as in 8 cases of the study to be kept in mind as the possibility of malignancy, however, which was not statistically significant. Even though FNAC is reliable in determining the treatment plan, histopathological evaluation of surgical specimens must be undertaken for confirmation in all cases.
CONFLICT OF INTEREST: There is no conflict of Interest
SOURCE OF FUNDING: No Source of Funding
AUTHORS CONTRIBUTION: This is a collaborative work among all authors. Abhay D. Havle and Kaenat Ahmed performed the statistical analysis, wrote the protocol, and wrote the first draft of the manuscript. Kaenat Ahmed along with Munnuru Khaleel Basha managed the literature searches. All authors read and approved the final manuscript.
Englishhttp://ijcrr.com/abstract.php?article_id=4077http://ijcrr.com/article_html.php?did=40771. Pang HN, Chen CM. The incidence of cancer in nodular goitres. Ann Acad Med. 2007;36:241-3.
2. Belfiore A, La Rosa GL, Padova G, Sava L, Ippolito O, Vigneri R. The frequency of cold thyroid nodules and thyroid malignancies in patients from an iodine-deficient area. Cancer. 1987;60:3096-102.
3. Mazzaferri EL, de Los Santos ET, Rofagha-Keyhani S. Solitary thyroid nodule: Diagnosis and management. Med Clin North Am. 1988;72:1177-211.
4. ul Haq RN, Khan BA, Chaudhry IA. Prevalence of malignancy in a goiter-A review of 718 thyroidectomies. J Ayub Med Coll Abbottabad. 2009; 21:134-6.
5. Tan H, Li Z, Li N, Qian J, Fan F, Zhong H, Feng J, Xu H, Li Z. Thyroid imaging reporting and data system combined with Bethesda classification in qualitative thyroid nodule diagnosis. Med. 2019;98:50(e18320).
6. Chaudhary V, Bano S. Imaging of the thyroid: Recent advances. Indian J Endocrinol Metab. 2012;16:371–6. [PMCID: PMC3354842] [PubMed: 22629501]
7. Al-Qurayshi Z, Randolph GW, Srivastav S, Kandil E. Outcomes in endocrine cancer surgery are affected by racial, economic, and healthcare system demographics. Laryng. 2016;126:775-81.
8. Zambudio AR, Rodríguez J, Riquelme J, Soria T, Canteras M, Parrilla P. Prospective study of postoperative complications after total thyroidectomy for multinodular goitres by surgeons with experience in endocrine surgery. Ann Surg. 2004;240:18-25.
9. Ríos A, Rodríguez JM, Canteras M, Galindo PJ, Tebar FJ, Parrilla P. Surgical management of multinodular goiter with compression symptoms. Arch Surg. 2005;140:49-53.
10. Chakravarthy NS, Chandramohan A, Prabhu AJ, Gowri M, Mannam P, Shyamkumar NK, et al. Ultrasound-guided fine-needle aspiration cytology along with clinical and radiological features in predicting thyroid malignancy in nodules ≥1 cm. Indian J Endocr Metab. 2018;22:597-60
11. Gandolfi PP, Frisina A, Raffa M, Renda F, Rocchetti O, Ruggeri C, et al. The incidence of thyroid carcinoma in multinodular goitre: Retrospective analysis. Acta Biomed. 2004;75:114-7.
12. Nandedkar SS, Dixit M, Malkani K, Varma AV, Gambhir S. Evaluation of thyroid lesions by fine-needle aspiration cytology according to Bethesda system and its histopathological correlation. Int J App Basic Med Res. 2018;8:76-82.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareSupport Vector Machine Classification of Autism and Typically Developing Children using Electroencephalograph and Recurrence Quantification Analysis Parameters
English9297Thanga Aarthy MEnglish Menaka REnglishEnglishASD, EEG, RQA, SVM, TDhttp://ijcrr.com/abstract.php?article_id=4078http://ijcrr.com/article_html.php?did=4078Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareFormulation and Characterization Floating Matrix Tablets of Methimazole
English98104Bhambar Kunal VEnglish Pande Shrikant D.English Bhambar Rajendra S.English Gadakh Pravin P.EnglishIntroduction: Methimazole is an active pharmaceutical ingredient effectively utilized in hyperthyroidism. Methimazole inhibits peroxidase as well as iodine interactions with thyroglobulin to produce triiodothyronine with thyroxine. Methimazole shows very low protein binding (1-10%) bounds to plasma proteins and is easily metabolized by the liver. Gastro retentive drug system improve the pharmacotherapy of the stomach by local release of therapeutic agent results in high concentrations of drug at the gastric mucosa, which further sustained for long Aim: In this investigation, efforts were given to developing a sustained release floating matrix tablet of Methimazole. Methodology: Floating matrix tablets of methimazole were prepared by utilizing the direct compression method. Sodium bicarbonate and citric acid were used as gas-forming agents. HPMC K100M along with Ethylcellulose used to retard drug release from the dosage form. Result: Floating matrix tablets of methimazole were evaluated for different quality control tests to improve the quality of the product. In dissolution study of the floating matrix of methimazole formulation Floating matrix tablet (FLM4) shows maximum drug release 96.88 % at the end of 12 hours while FLM-1 shows least 84.33 %. Conclusion: In vitro release study of methimazole floating matrix tablets shows that polymer percentage used in the formula is enough to extend the release of the drug for at least 12 hr.
English Floating Matrix tablet, Methimazole, Sustained Release, FLM, HPMC K100M, Ethyl Cellulose
INTRODUCTION:17
In a Conventional drug delivery system, periodic doses of therapeutic agents are required. Most of the drugs are formulated by conventional methods for effective drug administration, but some therapeutic agents are unstable or have narrow therapeutic ranges so require modification. These problems were overcome by developing sustained release gastro retentive drug delivery. Gastro retentive drug delivery promising approach not only retard the drug release but also retain the dosage form in the stomach. Gastro retentive drug delivery effectively improves absorption of the drug due to increased residence time in the stomach. Methimazole is absorbed through the whole Gastrointestinal tract and bioavailability is 80-95%. Methimazole is a biologically active agent widely used in hyperthyroidism. It prevents iodine and peroxidase. Methimazole has a biological half-life of 5 to 6 hours so it requires three times a day dosing. Hence an attempt was made to develop floating matrix tablets of Methimazole to improve all characteristics.1,2,3
MATERIAL AND METHODS:
Methimazole was purchased from Innova Laboratories, Division of Innova Remedies Pvt. Ltd. Nagpur. HPMC K100M, EC was procured from Molychem, Mumbai. All other reagents and materials were of analytical grade.7
Formulation of Methimazole Floating Matrix Tablets.1
The direct compression technique was used to formulate the Methimazole tablets for all batches containing methimazole. Sodium bicarbonate was passed through # 36 sieves. Magnesium stearate and Citric acid were passed through # 60 sieves. Required quantity of drug and all other ingredients were weighed and transferred into a polythene bag and blended for 10 minutes. The blend was compressed on a 10-station rotary press using round-shaped punches. Punches measuring 10 mm were used for compression of the tablets. Table1 consist of formulas for the preparation of floating matrix tablets which include Ethylcellulose, HPMC K100M and gas-forming agents like citric acid and sodium bicarbonate.
Evaluation of Floating matrix tablet
a. Physical Evaluation:
The prepared tablets were examined visually for cracks, depressions, pinholes, colour and polish. 1,2,3,8
b. Size and shape:
Vernier callipers are used for determining the thickness of the tablet.
c. Test for hardness:
Monsanto hardness tester is used for the determination of the hardness of the tablet.
d) Weight variation: 11.12,17
To determine weight variation Twenty tablets were weighed individually and the average weight was calculated from the total weight of all tablets. The individual weights of tablets were compared with the average weight of tablets. The percentage difference in the weight variation should be within the permissible limits (±7.5%). The per cent deviation was calculated using the following formula.
e) Friability test:
Friability of the tablets was measured by using Roche friabilator. Ten tablets were weighed collectively and placed in the friabilator chamber and rotated at 25 rpm. After 100 rotations (4 minutes), the tablets were taken out from the friability and intact tablets were again weighed collectively. The permitted friability limit is 1.0%. The per cent friability was determined using the following formula.
Where W1 = weight of the tablets before the test
W2 = weight of the tablets after test
f) Content uniformity13
Randomly selected 20 tablets were used to calculate average weight. All tablets were crushed in a mortar and weighed accurately for analysis. In a conical flask, samples were transferred and diluted with 0. 1NHCL. The sample content was shaken and kept for 30 minutes for the complete dissolution of the drug. After filtration dilutions were made. Drug content was estimated against blank as a reference at λ max 251.5 nm
g) In Vitro Drug Release (Dissolution Studies): 14,15,16
In vitro drug release study of the samples was carried out using USP – type I dissolution apparatus (Basket type). The dissolution medium, 500 ml of simulated gastric fluid (without enzyme), was placed into the dissolution flask maintaining the temperature of 37 + 0.5 0C and rpm of 100. One Methimazole matrix tablet was placed in each basket of the dissolution apparatus. The dissolution was carried out for 12 hours. During dissolution 5 ml sample was withdrawn after every 1 hour up to 12 hours manually. During sampling sample was filtered. The fresh dissolution medium (37oC) was added every time to maintain shrink condition. Collected samples were analyzed at 251.5 nm using 0.1 N HCl as blank. The cumulative percentage drug release was calculated using PCP Disso v3 software.
h) In Vitro Buoyancy Study: 5,6,17
The matrix tablet of methimazole was kept in a 100 ml beaker containing 0.1 N HCL. The time required for the tablet to rise in surface and float was determined as floating lag time. The duration in which dosage form constantly remained on the surface of the medium was determined as the total floating time.
i) Water Uptake Study (Determination of Swelling Index) 6.7
The swelling index of matrix tablets of methimazole was determined in distilled water at room temperature. The water uptake study of the tablet was done using the USP II dissolution apparatus. The medium used for the study was 500ml distilled water with a revolution of 100 rpm. The temperature of the medium was maintained at 37+ 0.5 0C throughout the study. After 12 hours the tablets were withdrawn, blotted to remove excess water and weight. The swelling characteristics of the tablets were expressed in terms of water uptake (WU) as,
Fourier Transform-Infra red spectroscopy (FT-IR) of Methimazole Floating Matrix Tablet:
The FT-IR spectrum of formulation FLM4 was recorded using spectrophotometer Fourier Transform-Infra red spectroscopy (Shimadzu 84005) using the KBr pellet technique.
Differential Scanning Coulometry (DSC) of Methimazole Floating Matrix Tablet:
DSC analysis of formulation FLM4 was performed using Shimadzu-Thermal Analyzer DSC 60 on 2-5mg samples. Samples of Methimazole Floating Matrix Tablets were heated in an open aluminium pan at a rate of 10°C/min. This study was conducted over a temperature range of 30 to 300°C under a nitrogen flow of 2 bar pressure.
In-vitro drug release Kinetics study of Methimazole Floating Matrix Tablet:4,5
In-vitro drug release Kinetics study of Methimazole Floating Matrix Tablet was studied using USP dissolution apparatus II and result getting by this study was analysed for different kinetic models such as zero order, first order, Higuchi, Hixson Crowell and Korsmeyer- Pappas.
Optimization of Methimazole Floating Matrix Tablet: 9,10,11
22 Factorial Design for Methimazole Floating Matrix Tablet:
A 22 factorial design was used in this study and 2 factors were evaluated, each at 2 levels shown in table no.7. Experimental trials were performed at all 4 possible combinations. The conc. of Ethylcellulose and HPMC K 100 M were selected as independent variables. The response % release was selected as dependent variables. The resulting data analyzed statistically using analysis of variance (ANOVA)were fitted into Design Expert 8.0.3 software. The data were also subjected to 3-D response surface methodology to determine the influence of HPMC, Na-CMC and Avicel on dependent variables. Tablet weight was not constant because that would require the use of diluents for weight adjustment, which in turn may have caused variation in the release profile. Thus, did not alter the number of diluents in the formulation to nullify any effect due to a change in the proportion of diluents
Y = b0 + b1X1 + b2X2 + b3X1X2
Y is the dependent variable; b0 is the arithmetic mean of responses of 4 runs. bi (b1, b2, b3, and b12) is the estimated coefficient for the corresponding factor Xi (X1, X2, X1X2) which represent the average result of changing 1 factor at the time from its low to high value. The interaction term (X1X2) shows the response changes when 2 factors are simultaneously changed.
RESULT
Organoleptic Properties:
After evaluation floating matrix tablets were white having a smooth surface in appearance. When the variation in the drug-polymer ratio will affect. The thickness of all the formulations and ranges from 4.8-5.2 mm. After performing the weight variation test the average percentage deviation of all the formulations was found to be less than 5 %. It was found that all batches show per cent drug content of more than 98%. The tablet hardness of all the formulations was found in the range of 5.5-5.7 kg/cm2. Another measure of tablet hardness was friability. Compressed tablets that lose less than 1 % of their weight are generally considered acceptable. For all formulations tried here the weight loss was less than 1 % hence acceptable shown in table no 2. All the formulations FLM-1 to FLM-4 float in one minute but FLM-4 takes minimum time as it contains the minimum amount of polymers. All the formulations FLM-1 to FLM-4 remain buoyant for more than 20 hours and lag time for floating was less than one minute shown in tables no 4 and 3 respectively. A swelling index was performed for formulation (FLM-4) shown in figure no.1. Complete swelling of the tablet takes place at the end of 10 hours after that the weight of the tablet decreases. The absorption bands shown by FLM-4 are characteristic of the groups present in the molecular structure of Methimazole. The presence of absorption bands corresponding to the functional groups present in the structure of Methimazole and the absence of any well-defined unaccountable peaks is a confirmation of the purity of the formulation shown in figure no.2. The DSC curve of Methimazole shows a sharp endothermic peak at 191.26 0 C corresponding to its melting and indicating its crystalline nature shown in figure no 3. Drug release studies were performed to determine the release of the drug is slow enough for at least 12 hr shown in figure no.4. The dissolution curve of formulation FLM4 shows maximum drug release i.e. 96.88% at the end of 12hours while FLM1 shows the least i.e. 84.96 % shown in table no.5. The value of release exponent, n, obtained from the Korsmeyer equation was greater than 0.5 for FLM1, FLM2, FLM3and FLM4 shown in table no.6. The Model F-value of 73.90 implies the model is significantly shown in table no.8. Percentage release graph for 22 factorial design and 3D graph response surface methodology of % release for methimazole floating matrix tablets shown in figure no 8 and 9 respectively. 3D graph of % Desirability for methimazole floating matrix Tablets as per 22 factorial design shown in figure no.10. Predicted Vs. actual values of % release of methimazole floating matrix tablets shown in figure no. 11
Final Equation in Terms of Coded Factors:
% release = 86.40375 - 0.50125* A - 2.49875* B + 2.85625 * A * B
Final Equation in Terms of Actual Factors:
% release = 344.76 - 2.62075* Ethyl cellulose - 2.8205* HPMC K100M + 0.0285625* Ethyl cellulose* HPMC K100M
DISCUSSION
Due to the entrapment of drugs within polymers, there was a shift in melting point was observed. The highest R2 value was obtained for the Higuchi model, so diffusion was the predominant release mechanism for matrix tablets. Release exponent, n, obtained from the Korsmeyer equation was greater than 0.5 indicate non-Fickian transport (Anamolous) so the final mechanism of drug release was swelling or chain relaxation of polymers followed by diffusion and erosion. Values of p-value less than 0.0500 indicate model terms are significant. In this case B, AB is the significant model term. Values greater than 0.1000 indicate the model terms are not significant. Adequate Precision measures the signal to noise ratio. A ratio greater than 4 is desirable. This model shows a ratio of 20.829 indicates an adequate signal.
Conclusion:
The general tablets parameters i.e. hardness, friability, weight variation, the thickness was found within specifications. Floating lag time was within 1 minute and the total floating time was 22 hours for all the developed formulations. For floating matrix tablets, the formulation FLM4 shows the highest drug release 96.88% as containing the minimum amount of polymers and FLM1 shows the lowest drug release 84.96% as containing the maximum amount of polymers.
ACKNOWLEDGEMENT: The Authors are thankful to Innova Laboratories, Division of Innova Remedies Pvt. Ltd. Nagpur for providing the sample of Methimazole.
CONFLICT OF INTEREST AND SOURCE OF FUNDING: NIL
Englishhttp://ijcrr.com/abstract.php?article_id=4079http://ijcrr.com/article_html.php?did=4079
1. Khan F, Shaikhul M, Preparation and In-vitro Evaluation of Theophylline Loaded Gastro retentive Floating Tablets of methocel K4M. J Pharm Sci. 2008; 65-70.
2. Tanwar YS, Rana AC, Formulation and Evaluation of Famotidine Floating Tablets. Current Drug Delivery. 2007;4:51 –55.
3. Prajapati ST, Patel LD, Patel DM, Studies on Formulation and In Vitro Evaluation of Floating Matrix Tablets of Domperidone. Indian J Phar Sci. 2009; 19 –23.
4. Sungthongjeen S, Sriamornsak P, Design and evaluation of floating multi-layer coated tablets based on gas formation. Eur J Pharma Biopha. 2008;255–263.
5. Li S, Lin S, Statistical Optimization of Gastric Floating System for Oral Controlled Delivery of Calcium. AAPS Pharm Sci Tech. 20016(12):1 –12.
6. Robles LV, Martínez IJ, Sustained delivery of captopril from floating matrix tablets. Int J Pharm. 2008,36(2):37–43.
7. Shah S.H, Patel J.K, Patel N.V, In, Stomach Specific Floating Drug Delivery System A Review. Int J Pharm Tech Reas. 2009:623 –633.
8. Singh BN, Kim KH. Floating drug delivery systems: An approach to Oral Controlled Drug Delivery via Gastric Retention. J Cont Rel. 2000; 63: 235-59.
9. Scan C Sweet man, Martindale The complete drug Reference, Thirty-four edition, Published by the Pharmaceutical press, 1616-1618
10. Bhise SB, Aloorkar NH, Formulation and In-vitro Evaluation of Floating Capsules of Theophylline. Ind J Pharm Sci. 2008; 224– 227.
11. Lachman L, Liberman HA, Kanig JL, The Theory and Practice of Industrial Pharmacy, 3rd Ed., Varghese Publishing House, Bombay, 1987;416-418, 430-453.
12. Gambhire M., Ambade k., Development and In Vitro Evaluation of an oral floating matrix tablet of diltiazem hydrochloride. AAPS Pharm Sci Tech.2012; 8(3):81-87.
13. Tokumura T, Machida Y, Preparation of amoxicillin intragastric buoyant sustained-release tablets and the dissolution characteristics. J Controlled Rel. 2006; 110:581 – 586
14. Chien YW, Lin S. Effect of HPMC and Carbopol on the release and floating properties of Gastric Floating Drug Delivery System using factorial design. Int J Pharm.2003; 25(3):13–22
15. Bodmeier R, Krogel I, Floating pulsatile drug delivery systems based on coated effervescent cores. Int J Pharma. 1999;18(7):175–184
16. Rajveer Ch., Rathinaraj B.S., Design and evaluation of ketorolac tromethamine sustained release matrix tablets, Int J Curr Res Rev. 2010;2: 39-55.
17. Patil S, Jagdale S, Formulation and evaluation of xanthan gum-based floating tablet of tramadol hydrochloride. Int J Curr Reas Rev. 2012;4:171-179.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareBone Graft Materials in Late Secondary and Tertiary Alveolar Bone Grafting: A Review
English105115Mallick RizwanaEnglish Pisulkar Sweta KaleEnglish Reddy Srinivas ReddyEnglish Jain VanshikaEnglishIntroduction: Bone grafting of the alveolar cleft is necessary to facilitate unhindered growth of maxillofacial complex and eruption of permanent teeth in defect region when not congenitally missing. Secondary grafting undertaken during mixed dentition helps achieve these two functions. However, due to varying reasons, socioeconomic concerns being one of them, many patients do not undergo this procedure and report at a time when late grafting is the only option to overcome the deficit bone. Aims: To identify the different grafting materials that have been utilized for the 2 surgical procedures. Methodology: Electronic databases were searched to find bone sources used for secondary and tertiary bone grafting to identify their characteristics and clinical outcomes. Attention was paid to literature which elucidated potential use of dental implants in the grafted site and presented its clinical course. Results: Over the years, many graft materials have been researched upon with autologous sources being considered as the gold standard and being the most commonly utilized. Additionally, graft characteristics, observations of the published authors, and success of implant rehabilitation, where used showed a mixed bag of results. Certain other potential bone sources were also identified that have shown in-vitro or animal model success but have not yet made a clinical presence for the reviewed procedures. Conclusion: Choice of bone graft depends on numerous factors such as defect size, surgeon preference and patient acceptance. To understand further each graft source and its characteristics, randomized control trials should be conducted to provide better clinical evidence.
EnglishAlveolar bone grafting, Alveolar cleft, Congenital abnormalities, Dental implants, Rehabilitation, Tertiary graftingINTRODUCTION
The multidisciplinary team involved in the treatment and repair of the orofacial cleft has faced challenges of successfully and satisfactorily repairing and rehabilitating the affected region. Advances in surgical knowledge, techniques, and materials, have kept the quest open, to find a universally accepted ideal bone grafting material. Secondary alveolar bone grafting (SABG) is done during the mixed dentition to facilitate permanent teeth eruption and minimizes functional and esthetic compromise. In cases where the permanent tooth in the cleft region fails to form or is indicated for extraction, it inadvertently requires prosthetic replacement which cannot be done till the patient attains skeletal maturity.
Removable and fixed partial dentures (RPD and FPD) are the oldest rehabilitative substitutes that, though easy to fabricate, provide limited esthetics. They also do not contribute to functional graft stimulation, thereby leading to increased resorption.1 With overtime use, RPDs require frequent replacement and irritate the underlying mucosa. Contrarily, FPDs compromise the adjacent healthy hard and soft tissue. Thus, both modalities add to patient’s physical stress of frequent and multiple visits, often denting them psychologically. Dental implants are a welcome alternative however, by the time a patient completes facial growth, the previously grafted bone inadvertently undergoes resorption, providing poor dimensions for implant support, thus failing the test of time. In such cases, tertiary bone grafting is undertaken to restore the dimensions and proceed with the treatment. In many cases, patients are not subjected to SABG and report after the eruption of all permanent teeth. These patients also require an initial repair of the bone defect before proceeding with dental implant-based rehabilitation, if permitted by other factors.
This current review is written to identify bone graft materials used for either late secondary or tertiary alveolar bone grafting in cleft patients (figure 1). It also discusses the qualitative and quantitative success of these materials as identified by the respective authors and the possibility of placing dental implants, wherever adequately provided.
To avoid ambiguity, the review considers certain terminologies as:
Primary alveolar bone grafting: any procedure performed to repair lip and/ or alveolar cleft at less than two years of age.
SABG: a surgical procedure performed during the mixed dentition phase before the eruption of the permanent maxillary canine.
Late secondary alveolar bone grafting: a surgical procedure performed after the eruption of permanent maxillary canine, without prior history of grafting procedure except primary alveolar grafting.
Tertiary grafting: alveolar cleft repair in a patient more than 18 years of age and with a positive history of SABG or late SABG.
AUTOLOGOUS GRAFTS
The use of autologous grafts is the most widely accepted as it is autologous origin avoids graft rejection. Various anatomical sites have been explored that provide adequate quantity without causing substantial donor site morbidity, is well accepted at the recipient site and maintains form over time.
Iliac bone graft
Autogenous bone graft from the iliac crest is one of the oldest sources, use of which is not limited to repair of maxillofacial defects. The many associated advantages and anatomy make iliac bone a “gold standard” grafting material. Mesenchymal in origin, it provides a rich quantity of cancellous bone which can be harvested with minimal complications.1 Three varieties of graft can be obtained from the iliac crest namely; cortical graft found in the outer bone layer comprising of compact bone, most widely used cancellous bone, the porous inner layer made of trabecular bone and corticocancellous bone which is a combination of the two. Vascularized grafts can also be obtained which provides predictable results.2 Anterior or posterior approach is used for bone harvesting with the latter showing superior results although it negates the advantage of simultaneous operation at two sites and has a slightly higher donor site morbidity.3,4
In probably the first of its kind published report, Ronchi et al,5did a late secondary procedure in three patients followed by endosseous implants placed after 8-12 months. The cancellous iliac graft was used in two patients while corticocancellous crest bone was harvested in the third patient. Overcorrection of bone defects was advocated to avoid repeat procedures during implant surgery.
Brauner et al.6 conducted tertiary grafting using heterologous cancellous bone with collagen membrane to restore bone dimensions in the affected site followed by dental implants after six months. Although no qualitative or quantitative assessments were provided for the regenerated bone, they concluded that tertiary grafting provided predictable and satisfactory esthetic results.
Performing SABG and late alveolar grafting, Takahashi et al.7 utilized autogenous cancellous iliac bone followed by endosseous implant placement after at least 1.4 years. Before implant surgery, the amount and density of trabecular bone were assessed and onlay graft using chin during implant surgery was conducted in some patients. At follow-up, in two of the concerned patients, the chin graft was partially lost because of wound dehiscence. Two implants were lost which was attributed to the short length and class 4 bone type formed by the graft. In a similar long-term follow-up study, due to insufficient vertical bone height after SABG, tertiary bone grafting was performed using only mandibular symphysis graft with simultaneous implant placement.8 Assessment of interdental alveolar bone height (IABH) was done for up to six years. From among the patient of interest for our review, only one case showed IABH reduction from score 3 to score 2 with no changes observed in other cases.
Hartel et al.9 retrospectively analyzed the data of cleft patients who were rehabilitated using implants. All patients received cancellous iliac chips as tertiary graft followed by additional augmentation using iliac or chin bone chips before implant placement due to partial or complete bone resorption. Need for the second graft varied from 7-60 months in most patients with re-graft being done as early as 5-7 weeks following tertiary grafting in three patients. Clinical and radiological follow-up presented one-fourth to two-third of resorption of the grafted bone around the implant in 70% of cases which were attributed to scars of previous surgical repairs.
Comparing SABG with tertiary grafting, Dempf et al.10 used cancellous iliac chips for overcorrection of defect to compensate for post-operative physiological resorption. 47 tertiary grafting were done with an aim of prosthodontic rehabilitation. During follow-up, compared to a single patient (1.7%) in the SABG group, two tertiary grafted cases (8%) exhibited bone levels between 0-25%. Excellent bone stock (75-100%) was found in 10 patients (40%) in the latter group compared to 25 patients (41.7%) in the former. Complete graft resorption was not seen in any case, though lower resorption was reported for secondarily grafted cases.
Matsui et al.11 performed late secondary and tertiary grafting using versatile materials for implant-based rehabilitation in 47 patients. In 26 patients, 39 implants required the use of additional bone chips for coverage which were taken from the adjacent area. Appropriate distribution of these patients according to the previously performed bone grafting could not be determined. No statistically significant level of marginal bone loss (MBL) was seen between implants requiring bone chips and their counterparts. Acceptable results by the same author have been shown in another published work.12
From an orthodontic perspective, the use of iliac graft in late secondary grafting followed by maxillary expansion showed higher bone density than cases treated first with maxillary expansion followed by late grafting.13 At 12 months postoperatively, no significant difference in mean graft volume and bone density were observed between the two protocols.
Many other conducted studies have successfully used iliac crest graft, showing a mixed bag of results.14–18
Tibial graft
Proximal and distal tibia provide good quality, sufficiently stiff 25-70cm3 corticocancellous bone, without causing significant morbidity.2 Compared to iliac graft, tibial graft shows decreased inter-operative bleeding and surgical time (approximately 15 minutes), post-operative pain, scarring and hospitalization time with faster ambulation.19,20
Kaalaji et al.21 presented the retrospective success of tibial graft in repairing the alveolar cleft defect. Of the 39 patients, five underwent late secondary grafting followed by dental implant placement while the remaining patients were subjected to SABG. Patient follow-up reported the absence of complications; however, individual data for late grafting cases could not be elucidated.
Hussain20 performed alveolar bone grafting in nine patients of which six underwent tertiary grafting. The mean efficacy of material in terms of pre-and post-operative volume or area of the defect was calculated in tertiary grafted cases(71.72 ± 4.86) which were comparable to secondary grafting values (79.53 ± 9.07). They concluded tibial graft to be at par with usual grafting materials (iliac and rib graft) for cleft repair. Other authors have also reported successful use of tibial graft.22
Mandibular bone block
Mandibular symphysis and the retromolar area being embryonically like maxillary bone (ectomesenchymal origin), provides up to 3cm membranous bone (sufficient for small defects) with faster revascularization potential and lower resorption rate.1 Also, the procedure can be done under local anesthesia, in the same operative field as for cleft repair, thereby reducing post-operative discomfort.23
One of the oldest comparisons between autologous iliac and mandibular bone graft was made by Koole et al.1 who concluded that grafted mandibular bone showed a maximum of 37% resorption (52% patients) which was lesser than 50-100% resorption seen with iliac graft (44% patients).
Dolanmaz et al.23 did alveolar defect reconstruction using autologous mandibular block wherein procedures performed were either late secondary or tertiary grafting. In follow-up did two weeks following surgery, graft exposure was encountered only in three patients. 36 endosseous implants were placed, none of which showed clinical signs of failure except in one case where implant insertion led to graft mobilization. The accurate number of implants in cleft defect could not be assessed.
Sawaki et al.24 undertook bone height augmentation using ramus onlay graft in the bilateral cleft case due to insufficient available bone post SABG. The implant was placed in the grafted bone after five months which showed no clinical or radiographic signs of failure.
Calvarial bone
In probably the first of its kind study, Sadove et al evaluated the bone-forming potential of calvarial bone harvested to that of iliac bone for SABG.25 Comparable results were seen with the two graft types, however, craniotome use for obtaining calvarial graft was discouraged. Though technique sensitive, calvarial graft presents lower complications and resorption rate (9% to 19%) compared to approximately 50% resorption rate seen with iliac graft.26,27
Smolka et al.27 used calvarial bone for tertiary repair followed by implant-based rehabilitation after 4-6 months of grafting. In all cases, successful graft uptake and implant survival were reported, thereby supporting the use of calvarial bone.
Autogenous tooth bone (AutoBT)
Showing promising results, the use of permanent teeth (most commonly impacted third molars) as bone graft material is a recent advancement attributed to the osteoconductive nature of organic tooth structure.28 Based on the degree of demineralization, three types of dentin are evident namely; demineralized dentin, partially demineralized dentin matrix (70% decalcified), and demineralized dentin matrix, all of which show different results.28
Operating on the 19-year boy, Jeong et al.29 did the cleft repair using AutoBT obtained from the extracted mandibular third molar. The patient had a history of cleft lip and palate repair at 5-months and 6-years of age with the absence of further surgical details. Thus, the performed repair was either late secondary or tertiary grafting. Particulate AutoBT with collagen membrane was placed in the defect site and re-entered after 3.5 months for implant surgery which was subsequently loaded after six months. Six months follow-up post prosthesis placement showed no evident clinical or radiographic finding directing towards implant failure.
ALLOGRAFTS
While autografts avoid rejection, they are often unacceptable to patients because of second surgical procedure, associated pain, risk of injury and increased hospitalization time especially during tertiary grafting. Also, large defects often warrant an increased amount of graft which the autologous sites may fail to provide due to anatomical and functional limitations. When using tibial grafts, it is observed that graft from both legs might be required to meet the recipient’s need, while mandibular graft has an increased risk of sensory alteration and damage to teeth roots.30 Alloplastic grafts do not limit supply and make the procedure less invasive, countering these drawbacks. It also eliminates the requirement of additional professionals for obtaining autologous bone. However, economic considerations show mixed observations.31 Exhibiting substantial osteogenic and angiogenic potential, allografts are commonly used in combination with autologous sources to decrease integration time and achieve enhanced results.
Blume et al.32 did tertiary grafting using alloplastic graft from cancellous femur head of patient undergoing total hip replacement. The graft was milled using 3-dimensional (3D) models and augmented with autologous platelet-rich fibrin (PRF) matrix at the time of placement. Two dental implants were placed at the site after six months and cone-beam computed tomography was recorded as baseline data. These baselines were compared six months post-operatively which revealed bone resorption of approximately 3% and 1% in horizontal and vertical bone levels, respectively.
As a randomized control trial (RCT), Shirani et al.33 compared the effectiveness of autogenous iliac bone+plasma with freeze-dried bone+plasma wherein they did not associate the material to the type of bone grafting but concluded autogenous bone to be superior.
XENOGRAFT
Xenografts are obtained from species different from humans and are mostly of bovine or porcine origin. They have shown good results and can be used alone or in combination with other synthetic materials.
Hengjeerajaras et al.34 treated a cleft patient with xenogenic graft and resorbable collagenous membrane. A dental implant was placed six months after a repair which was loaded after additional three months. At a 10-year follow-up, bone levels of the area were maintained with satisfactory esthetics and functionality.
ALLOPLASTIC GRAFT MATERIALS
Synthetic in origin, alloplastic provides excellent osteogenic, osteoconductive, mesenchymal differentiation and angiogenic properties.35 These can be based on various compositions such as ceramic, polymer or growth factor enhanced and have been used for a variety of craniomaxillofacial defects. They also potentiate the bone-forming capabilities of autogenous or allogenic grafts.35
Bone morphogenetic protein (BMP)
BMPs belong to the superfamily of transforming growth factor-beta with potent bone and cartilage forming capacity.35 Depending on micro-environment and interactions, they contribute to differentiation, proliferation, growth inhibition, and maturation arrest of various cells.36 Recombinant human BMP (rhBMP-2 and -7) are growth factor enhanced materials, commercially available for craniofacial surgeries.37
Le et al.31 successfully utilized human mineralized allograft alone and in combination with BMP for alveolar repair and implant placement. While one case was treated as late secondary alveolar bone grafting, the second underwent tertiary grafting. Both showed good quality bone formation with minimal resorption and the absence of repeat procedures at the time of implant placement. Histologic assessment showed new bone formation with properties comparable to the native bone.
Comparing BMP-2 and iliac bone for late secondary cleft repair, Dickinson.38 found fewer complications in patients treated with the former. Statistically significant, higher values for graft uptake (2.8±0.2) with better radiographic bone healing were seen with BMP-2 compared to iliac bone (1.9±0.4) (p-value Englishhttp://ijcrr.com/abstract.php?article_id=4080http://ijcrr.com/article_html.php?did=40801. Koole R, Bosker H, Dussen FN van der. Late Secondary Autogenous Bone Grafting in Cleft Patients Comparing Mandibular (Ectomesenchymal) and Iliac Crest (Mesenchymal) Grafts. J Oral Maxillofac Surg. 1989; 17(Suppl 1):28–30.
2. Myeroff C, Archdeacon M. Autogenous bone graft: donor sites and techniques. J Bone Joint Surg Am. 2011; 93(23):2227–36.
3. Ahlmann E, Patzakis M, Roidis N, Shepherd L, Holtom P. Comparison of Anterior and Posterior Iliac Crest Bone Grafts in Terms of Harvest-Site Morbidity and Functional Outcomes. J Bone Joint Surg Am. 2002; 84(5):716–20.
4. Abramowicz S, Katsnelson A, Forbes PW, Padwa BL. Anterior versus posterior approach to iliac crest for alveolar cleft bone grafting. J Oral Maxillofac Surg. 2012; 70(1):211–5.
5. Ronchi P, Chiapasco M, Frattini D. Endosseous implants for prosthetic rehabilitation in bone grafted alveolar clefts. J Craniomaxillofac Surg. 1995; 23(6):382–6.
6. Brauner E, De Angelis F, Jamshir S, Mezi S, Tiroli RC, Pompa G et al. Aesthetic satisfaction in lip and palate clefts: A comparative study between secondary and tertiary bone grafting. Clin Ter. 2018; 169(2):e62–6.
7. Takahashi T, Fukuda M, Yamaguchi T, Kochi S. Use of endosseous implants for dental reconstruction of patients with grafted alveolar clefts. J Oral Maxillofac Surg. 1997; 55(6):576–83.
8. Takahashi T, Inai T, Kochi S, Fukuda M, Yamaguchi T, Matsui K et al. Long-term follow-up of dental implants placed in a grafted alveolar cleft: evaluation of alveolar bone height. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2008; 105(3):297–302.
9. Härtel J, Pögl C, Henkel KO, Gundlach KKH. Dental implants in alveolar cleft patients: a retrospective study. J Craniomaxillofac Surg. 1999; 27(6):354–7.
10. Dempf R, Teltzrow T, Kramer FJ, Hausamen JE. Alveolar bone grafting in patients with complete clefts: A comparative study between secondary and tertiary bone grafting. Cleft Palate Craniofac J. 2002; 39(1):18–25.
11. Matsui Y, Ohno K, Nishimura A, Shirota T, Kim S, Miyashita H. A long-term study of dental implants placed into alveolar cleft sites. Cleft Palate Craniofac J. 2007; 44(4):444–7.
12. Matsui Y, Ohta M, Ohno K, Nagumo M. Alveolar Bone Graft for Patients with Cleft Lip/Palate Using Bone Particles and Titanium Mesh: A Quantitative Study. J Oral Maxillofac Surg. 2006; 64(10):1540–5.
13. Uzel A, Benliday? ME, Kürkçü M, Kesikta? E. The Effects of Maxillary Expansion on Late Alveolar Bone Grafting in Patients with Unilateral Cleft Lip and Palate. J Oral Maxillofac Surg. 2019; 77(3):607–14.
14. Mahajan R, Ghildiyal H, Khasgiwala A, Muthukrishnan G. Evaluation of Secondary and Late Secondary Alveolar Bone Grafting on 66 Unilateral Cleft Lip and Palate Patients. Plast Surg (Oakv). 2017; 25(3):194–9.
15. Jeyaraj P, Sahoo NK, Chakranarayan A. Mid Versus Late Secondary Alveolar Cleft Grafting Using Iliac Crest Corticocancellous Bone Graft. J Maxillofac Oral Surg. 2014; 13(2):195–207.
16. Garcia MA, Yatabe M, Fuzer TU, Calvo AM, Trindade-Suedam IK. Ideal Versus Late Secondary Alveolar Bone Graft Surgery: A Bone-Thickness Cone-Beam Computed Tomographic Assessment. Cleft Palate Craniofac J. 2018; 55(3):369–74.
17. Trindade-Suedam IK, Filho OGS, Carvalho RM, Faco RAS, Calvo AM, Ozawa TO et al. Timing of Alveolar Bone Grafting Determines Different Outcomes in Patients With Unilateral Cleft Palate. J Craniofac Surg. 2012; 23(5):1283–6.
18. Chowdhury SKR, Menon PS, Vasant MR, Jayan B, Dhiman RK, Karkun S. Secondary and delayed bone grafting in alveolar and anterior palatal clefts. Med J Armed Forces India. 2006; 62(3):231–5.
19. Coots BK. Alveolar bone grafting: Past, present, and new horizons. Semin Plast Surg. 2012; 26(4):178–83.
20. Hussain S. Evaluation of alveolar grafting with tibial graft in adolescent patients. Indian J Dent Res. 2013; 24(6):659–63.
21. Kalaaji A, Lilja J, Elander A, Friede H. Tibia as Donor Site for Alveolar Bone Grafting in Patients With Cleft Lip and Palate: Long-Term Experience. Scand J Plast Reconstr Surg Hand Surg. 2001; 35(1):35–42.
22. Al Harbi H, Al Yamani A. Long-term follow-up of tibial bone graft for correction of alveolar cleft. Ann Maxillofac Surg. 2012; 2(2):146.
23. Dolanmaz D, Esen A, Y?ld?r?m G, ?nan Ö. The use of autogenous mandibular bone block grafts for reconstruction of alveolar defects. Ann Maxillofac Surg. 2015; 5(1):71-6.
24. Sawaki M, Ueno T, Kagawa T, Kanou M, Honda K, Shirasu N et al. Dental Implant Treatment for a Patient With Bilateral Cleft Lip and Palate. Acta Med Okayama. 2008; 62(1):59–62.
25. Sadove AM, Nelson CL, Eppley BL, Nguyen B. An Evaluation of Calvarial and Iliac Donor Sites in Alveolar Cleft Grafting. Cleft Palate Craniofac J. 1990; 27(3):225–9.
26. Smolka W, Eggensperger N, Carollo V, Ozdoba C, Iizuka T. Changes in the volume and density of calvarial split bone grafts after alveolar ridge augmentation. Clin Oral Implants Res. 2006; 17(2):149–55.
27. Smolka W, Smolka K. Tertiary bone grafting using calvarial bone transplants in patients with cleft lip and alveolus. Oral Surg. 2011; 4(3):135–9.
28. Gual-Vaqués P, Polis-Yanes C, Estrugo-Devesa A, Ayuso-Montero R, Marí-Roig A, López-López J. Autogenous teeth used for bone grafting: A systematic review. Med Oral Patol Oral Cir Bucal. 2018; 23(1):e112–9.
29. Jeong K-I, Lee J, Um I-W, Kim Y-K. Alveolar Cleft Restoration Using Autogenous Tooth Bone Graft Material for Implant Placement: A Case Report. J Oral Implantol. 2015; 41(4):487–90.
30. Reininger D, Cobo-Vázquez C, Monteserín-Matesanz M, López-Quiles J. Complications in the use of the mandibular body, ramus and symphysis as donor sites in bone graft surgery. A systematic review. Med Oral Patol Oral Cir Bucal. 2016; 21(2):e241–9.
31. Le BT, Woo I. Alveolar Cleft Repair in Adults Using Guided Bone Regeneration With Mineralized Allograft for Dental Implant Site Development: A Report of 2 Cases. J Oral Maxillofac Surg. 2009; 67(8):1716–22.
32. Blume O, Back M, Born T, Donkiewicz P. Reconstruction of a Unilateral Alveolar Cleft Using a Customized Allogenic Bone Block and Subsequent Dental Implant Placement in an Adult Patient. J Oral Maxillofac Surg. 2019; 77(10):2127.e1-11.
33. Shirani G, Abbasi AJ, Mohebbi SZ, Moharrami M. Comparison between autogenous iliac bone and freeze-dried bone allograft for the repair of alveolar clefts in the presence of plasma rich in growth factors: A randomized clinical trial. J Craniomaxillofac Surg. 2017; 45(10):1698–703.
34. Hengjeerajaras P, Froum S, Adawi H, Yu P, Cho S-C. Anterior Tooth Replacement with an Implant in a Grafted Alveolar Cleft Site: Case Report with a 10-Year Follow-up. Int J Periodontics Restorative Dent. 2019; 39(4):511–5.
35. Kumar P, Vinitha B, Fathima G. Bone grafts in dentistry. J Pharm Bioallied Sci. 2013; 5(SUPPL.1):1–6.
36. Chenard KE, Teven CM, He TC, Reid RR. Bone morphogenetic proteins in craniofacial surgery: Current techniques, clinical experiences, and the future of personalized stem cell therapy. J Biomed Biotechnol. 2012; 2012.
37. Dickinson BP, Ashley RK, Wasson KL, O’Hara C, Gabbay J, Heller JB et al. Reduced morbidity and improved healing with bone morphogenic protein-2 in older patients with alveolar cleft defects. Plast Reconstr Surg. 2008; 121(1):209–17.
38. Janssen NG, Schreurs R, de Ruiter AP, Sylvester-Jensen HC, Blindheim G, Meijer GJ et al. Microstructured beta-tricalcium phosphate for alveolar cleft repair: a two-centre study. Int J Oral Maxillofac Surg. 2019; 48(6):708–11.
39. Du F, Wu H, Li H, Cai L, Wang Q, Liu X et al. Bone Marrow Mononuclear Cells Combined with Beta-Tricalcium Phosphate Granules for Alveolar Cleft Repair: A 12-Month Clinical Study. Sci Rep. 2017; 7(1):1–8.
40. Saint-Surin I, Roman T, Touzet-Roumazeille S, Ferri J, Lauwers L. Implant-borne rehabilitation for alveolar dental cleft: Retrospective analysis of thirty-nine cases. J Stomatol Oral and Maxillofac Surg. 2020. 121(4):339-43.
41. Pisulkar SK, Agrawal R, Belkhode V, Nimonkar S, Borle A, Godbole SR. Perception of Buccal Corridor Space on Smile Aesthetics among Specialty Dentist and Layperson. J Int Soc Prev Community Dent. 2019; 9(5):499–504.
42. Feichtinger M, Zemann W, Mossböck R, Kärcher H. Three-dimensional evaluation of secondary alveolar bone grafting using a 3D- navigation system based on computed tomography: a two-year follow-up. Br J Oral Maxillofac Surg. 2008; 46(4):278–82.
43. Witsenburg B, Freihofer HPM. Autogenous rib graft for reconstruction of alveolar bone defects in cleft patients. J Craniomaxillofac Surg. 1990; 18(2):55–62.
44. Balaji S. Maxillary Cleft Surgery with Rib Graft. 2019. Available from: https://www.smbalaji.com/maxillary-cleft-surgery-with-rib-graft/
45. Hudak KA, Hettinger P, Denny AD. Cranial Bone Grafting for Alveolar Clefts: A 25-year Review of Outcomes. Plast Reconstr Surg. 2014; 133(5):662e-8e.
46. Sybil D, Jain V, Mohanty S, Husain SA. Oral stem cells in intraoral bone formation. J Oral Biosci. 2020; 62(1):36–43.
47. Korn P, Ahlfeld T, Lahmeyer F, Kilian D, Sembdner P, Stelzer R et al. 3D Printing of Bone Grafts for Cleft Alveolar Osteoplasty – In vivo Evaluation in a Preclinical Model. Front Bioeng Biotechnol. 2020; 8:217.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareProtein Enrichment of Cassava Pulp by using Saccharomyces Cerevisiae and Candida Utilis as Alternative Feed Resource
English116121Pichad KhejornsartEnglishIntroduction: Cassava (Manihot esculentaCrantz) pulp was increasingly and potential as environmental pollution, this study aimed to determine the optimal condition for increasing protein content of cassava pulp by microbial fermentation under the various condition. Methods: Cassava pulp were fermented with each pure strain of S. cerevisiae or C. Utilis using urea as a Nitrogen (N) source (0, 2, 4, and 8%) for 8 days. Reducing sugar, crude protein, NPN and cell number were measured daily. Results: It was found that significant increase (pEnglish Cassava pulp, S. cerevisiae, C. Utilis, Single-cell protein, Feed resources, FermentationIntroduction
The substantial increase in demand for livestock products in developing countries has resulted in a consequent increase in the production and supply of animal feed. The exploitation of large amounts of agro-industrial waste, such as cassava, is of particular relevance. The cassava plant is cultivated throughout the tropics because of its roots as an important source of carbohydrates. Cassava pulp is a high moist attributed largely to the manufacture of cassava starch and constitutes approximately 10-15% of the original root weight. Thai cassava starch factories were increasingly producing more than 4 million tons per year. Cassava pulp, which is mainly composed of 70% starch, is a valuable resource to be used as feed for livestock. Cassava pulp, however, is slightly low in protein and high in fibre content, restricting its use in animals. There has been reported that dried cassava pulp can be used in broiler diets, with higher levels of inclusion resulting in lower growth performance and digestibility of nutrients.1 It is also noted that the significant disadvantage of the use of cassava root meal in animal feed is due to its low protein content and the inaccessibility of essential amino acids.2If this by-product is fermented with microorganisms to improve its nutritious value before being included in livestock diets, it will also be more beneficial. By raising the protein content of cassava pulp by micro-organism fermentation, an increase in the feed value of cassava pulp could be accomplished. The low protein content of cassava pulp (less than 3% in DM) does not constitute a limitation for cattle, as the use of non-protein nitrogen (NPN) in the form of urea could be possible. However, for monogastric animals such as pigs, an additional supply of true protein is required. The protein content of cassava fermentation with A. niger could increase from 4.4-12.2 per cent.3 In addition, microorganism cultivation, such as A. niger, A.oryzae, S. cerevisiae, C. Utilis and C. tropicalis have also been widely reported in previous research on low protein content feedstuffs.4-8However, the dependability of fermentation can be attributed to variations in microorganism, cassava pulp waste condition and technique, especially true protein content. Therefore, this study was to confirm the optimal conditions for improving the protein content of cassava pulp through S. cerevisiae and C.utilis by using fermentation at different concentrations of urea.
Materials and Methods
Cultivation of microorganism starter
This research used fresh cassava pulp obtained from Premier Quality Starch (2012) Co., Ltd, Sakon Nakhon, Thailand.Microorganisms and preparation of inoculum: In this study, three strains of microorganisms were used: S. cerevisiae (5051) and C. Utilis (5046), collected from the Thai Institute of Scientific and Technical Research (TISTR).S.cerevisiae and C. Utilis were cultivated on Yeast-Malt-Agar (YMA). Batch cultures have been agitated on reciprocal shakers at 200 rpm at 30 °C for 1 day and held at 4 °C. Until substrate inoculation with microorganisms. The suspension was centrifuged at 3000 rpm at 4 °C for 15 minutes and the deposit was washed twice at 0.85 % NaCl. The resulting cells were suspended with 0.85 per cent NaCl to reach an average concentration of 108 cells/mL. To achieve an average concentration of 108 cells/mL, the resulting cells were suspended with 0.85 % NaCl.
Procedure of fermentation
The optimal condition for improving the nutritional composition of cassava pulp by fermentation processes was studied using three variables(microorganism, concentration of urea and time of fermentation). Approximately 50 g of fresh cassava pulp was placed into a 250 mL Erlenmeyer flask with triplicates and was autoclaved for 15 min at 121 °C. At various amounts nitrogen (urea)was applied to each flask.2% of suspension (by 108cell/mL) was immersed in the substrate. Then properly blended and coated with aluminium foil until allowing for 8 days to ferment at 30 °C. The ingredients for fermentation were collected every 2 days (0,2,4,6 and 8 days) of fermentation and consequently for chemical composition.
Sample analysis
After fermentation, the samples (fermentation products) were collected from the Erlenmeyer flask, cut into similar size particles. Then, 10 g of samples were dissolved in a 250 mL ?ask with 90 mL of sterile saline water (0.9%). The series dilution (105 to 107) was performed for total cell count by using a microscope. Approximately 10 mL of sample was centrifuged at 2000 ×g for 10 min. The supernatants were used for glucose concentration measurement. The glucose concentration was measured by a colourimetric method using the dinitrosalicylic acid (DNS) reagent and a spectrophotometer at a wavelength of 540 nm.9Total nitrogen and moisture contents of samples were determined by standard procedure.10Non-protein nitrogen was measured precipitated from the diluted sample with trichloroacetic acid, and true protein was measured using the Kjeldahl method.11
Statistical analysis
Statistical analysis was carried out using factorial arrangement in CRD according to the GLM procedure of SAS.12Analysis of variance (ANOVA) was performed and the significant differences between treatment means were determined by Duncan New Multiple Range Test.
Results
Production of reducing sugar and yeast cell biomass
The results of this study show that, after fermentation with C. Utilis at urea level, the reducing sugar content of cassava pulp reached a maximum of 235.3 mg/g for 6 days and subsequently tended to decrease at the end of the fermentation period (Fig. 1). While the reducing sugar of S. cerevisiae-fermented cassava pulp remained lower at both urea levels and fermentation times (Fig. 2).
Production of protein
Cassava pulp fermentation protein and true protein derived from S. cerevisiae and C. Utilis showed that urea level and fermentation time with optimal condition exhibited significant influent concerning protein content (P = 0.023). Chemical analysis findings found that the protein and true protein content of fermented cassava pulp are higher than that of unfermented cassava pulp and true protein was highest in cassava pulp fermentation by C. Utilis with 4% urea at 4 days. This phenomenon was due to the influence of the mechanism of microbial cell growth and the N source of urea.
Production of protein
Cassava pulp fermentation protein and true protein derived from S. cerevisiae and C. Utilis showed that urea level and fermentation time with optimal condition exhibited significant influent concerning protein content (P = 0.023). Chemical analysis findings found that the protein and true protein content of fermented cassava pulp are higher than that of unfermented cassava pulp and true protein was highest in cassava pulp fermentation by C. Utilis with 4% urea at 4 days. This phenomenon was due to the influence of the mechanism of microbial cell growth and the N source of urea.
Fermentation with C. Utilis resulted in a higher rate of conversion of crude to true protein than fermentation with S. cerevisiae, with intermediate results from urea and fermentation period (Table 1.).Cassava pulp fermented for each urea level for 8 days shows an improvement in crude protein and true protein content from 3.77 to 21.66 and 2.19 to 10.72, respectively, while fermentation time increase from 0 to 8 days, crude protein increased from 10.14 to 17.86 and true protein increased from 1.04 to 12.39, respectively.
Fig. 5: Crude protein contentof cassava pulp fermented usingS. cerevisiae andC.utilis by various urea concentration during 8 days of fermentation (m1 = S. cerevisiae,m2 = C.utilis; t0 = day 0, t2 = day 2, t4 = day 4, t8 = day 8; u0 = 0%urea, u2 = 2% urea, u4 = 4%urea and u8 = 8% urea)
Fig. 6: True protein content of cassava pulp fermented usingS. cerevisiae andC.utilis by various urea concentration during 8 days of fermentation (m1 = S.cerevisiae, m2 = C.utilis; t0 = day 0, t2 = day 2, t4 = day 4, t8 = day 8; u0 = 0%urea, u2 = 2% urea, u4 = 4%urea and u8 = 8% urea)
From the combinations of effects of independent variables on the crude protein and true protein content(Fig.5), it can be noted that the maximized protein production(33.15%)was achieved at 4% urea and 4 days of fermentation by using C.Utilis. An increase of 30.41% was noted in comparison with non-fermented cassava pulp.
Discussion
Production of reducing sugar and yeast cell biomass
To the results of this study, cassava pulp fermentation by C. Utilis at 4% of urea, the reducing sugar content was highest. While the reducing sugar of S. cerevisiae-fermented cassava pulp remained lower at both urea levels and fermentation times. In general, microorganisms have a wide capacity to produce the enzyme for starch degradation into sugar and glucose. It has recently been reported that yeast produces enzymatic activity, which is an enzyme involved required for polysaccharides decarboxylation into smaller sugars.C. Utilis can generate enzymes, in particular cellulase and amylase, to hydrolysate glucosidic bonds in polysaccharides may be seen with the highest reducing sugar content of cassava pulp fermentation with C. utilis.13The cell maximal amount obtained is similar for Saccharomyces species (8.92 g/L)13and also obtained 10.83 and 8.29 g/L, respectively from C. Tropicalis and C. Utilis NOY1.14This could be useful to food and agro-based industries for the development of value-added goods, waste disposal, and valorization, as stated in the finding of C. Utilis yeast cultivation on cassava peel showed high significance in growth rate and cell concentration.15
Production of protein
The protein content in this study was obtained rage from 8.76 to 33.55 % of DM and it was higher than the results of the previous report.16 It is also existing research on cassava pulp fermentation with microorganisms that is still inaccessible, whereas a great deal of information on fermented cassava has been widely reported. There has been reported that C. Utilis-fermented cassava root can increase crude protein by up to 18.3%.5 In this study, the maximum amount of crude protein derived from S. cerevisiae and C. Utilis was 24.67% fermented for 4 days at 8% urea and30.34% fermented for 4 days at 4% urea, respectively. However, a portion of N from urea that is known to be a non-protein N and not useful for non-ruminant animals was included in this protein enhancement. In addition, it has also been reported that true protein is more effective than crude protein for animal production. There have been found after 48 hours of fermentation, the mean crude protein content of fermented cassava increased from 0.74 to 4.58 per cent.6, 17-18Considering that most observations show that the highest degree of conversion of added NPN sources to true protein is on the order of 70-80%, the logical implication is that residual NPN is the element causing lower intake and hence growth rate.19
Several factors can influence microbial growth and product formation during the fermentation process. The composition of the substrate (carbon and nitrogen sources), microbial capacity, and degree of process optimization all may contribute to increasing the supply of reducing sugar to yeast, thus enhancing the efficiency of the process. However, protein production was influenced by the time of cultivation and concentration of substrate.20 It can be established that the optimal conditions for the growth of S. cerevisiae and C. Utilis in cassava pulp to produce the maximum biomass is 8% fermented urea for 4 days and 4% fermented urea for 4 days, respectively.S. cerevisiae and C. Utilis can produce protein and true protein from 2.59 vs. 0.89% (unfermented) to 22.67 vs. 15.15 and 30.34 vs. 19.46%, respectively, under these circumstances. The treatment combination found significantly different (PEnglishhttp://ijcrr.com/abstract.php?article_id=4081http://ijcrr.com/article_html.php?did=4081
Khempaka S, Molee W, Guillaume M. Dried cassava pulp as an alternative feedstuff for broilers: Effect on growth performance, carcass traits, digestive organs and nutrient digestibility. J Applied Poult Res. 2009; 18: 487-493.
Chauynarong N, Elangovan AV, Iji PA. The potential of cassava products in diets for poultry. World's Poult Sci J 2009; 65: 23-36.
Oboh G. Nutrient enrichment of cassava peels using a mixed culture of Saccharomyces cerevisae and Lactobacillus sp. solid media fermentation techniques. Electron J Biotechnol. 2006; 9: 46-49.
Oboh G, Akindahunsi AA, Oshodi AA. Nutrient and anti-nutrient contents of Aspergillus niger-fermented cassava products (flour and gari). J Food Comp Anal. 2002; 15: 617-622.
Chumkhunthod P, Rodtong S, Teaumroong N, Boonkerd N. Bioconversion of cassava roots to high protein product for animal feed. Thai J Biotechnol. 2001; 3: 17-25.
Boonop K, Wanapat M, Nontaso N, Wanapat S. Enriching nutritive value of cassava root by yeast fermentation. Sci Agric. 2009; 66(5): 629-633.
Sokchea H, Thi Hang P, Dinh Phung L, Duc Ngoan L, Thu Hong TT, Borin K et al. Effect of Time, Urea and Molasses Concentration on Saccharomyces cerevisiae Biomass Production. J Vet Ani Res. 2018; 1: 104.
Hang DT, Chau HLQ, Hang LTT, Preston TR. Protein-enrichment of cassava pulp as feed for growing pigs. Livest Res Rural Dev. 2019; 31(5).
Miller GL. Use of dinitro salicylic acid reagent for determination of reducing sugar. Anal Chem. 1959; 31: 426-428.
AOAC. Official Methods of Analysis, 19th ed.; Association of Official Analytical Chemists: Gaithersburg, MD, USA, 2012.
Licitra G, Hernandez T, Van Soest P. Standardization of procedures for nitrogen fractionation of ruminant feeds. Ani Feed Sci and Tech. 1996; 57: 347-358.
SAS. User’s Guide: Statistic, Version 6.12thed.; SAS Inst. Inc.: Cary, NC, USA, 1998.
Somda MK, Savadogo A, Ouattara CAT, Ouattara AS, Traoré AS.Production of alcohol from mango (Mangifera Indica L.) using strains of Saccharomyces and Schizosaccharomyces genera isolated from wasted mangos in Burkina Faso. Biosci Biotech Res Asia. 2010; 7(2): 529-536.
Gao Y, Li D, Liu Y.Production of single-cell protein from soy molasses using Candida tropicalis. Ann Microbiol. 2012;62(3): 1165-1172.
Ezekiel O, Aworh O. Simultaneous saccharification and cultivation of Candida Utilis on cassava peel. Innov Food Sci Emer Tech. 2018; 49: 184-191.
Thongkratok R, Khempaka S, Molee W. Protein enrichment of cassava pulp using microorganisms fermentation technique for use as an alternative animal feedstuff. J Anim Vet Adv. 2010; 9 (22): 2859-2862.
Tefera T, Ameha K, Bruhtesfa A. Cassava based food: Microbial fermentation by single starter culture towards cyanide reduction, protein enrichment, and palatability. Inter Food Res. 2014; 21(5):1751-1756.
Sengxayalth P and Preston TR. Fermentation of cassava (Manihot esculenta Crantz) pulp with yeast, urea and diammonium phosphate (DAP). Livest Res Rural Dev. 2017; 29(9).
Bayitse R, Hou X, Laryea G and Bjerre AB. Protein enrichment of cassava residue using Trichoderma pseudokoningii (ATCC 26801). AMB Express. 2015; 5(80); 1-6.
Coman G, Leustean I, Georgescu L, Bahrim G.Optimization of protein production by Geotrichum candidum miug 2.15 by cultivation on paper residues, using response surface methodology. BioResources 2012; 7(4): 5290-5303.
Kour D, Kaur T, Devi R, Yadav A, Singh M, Joshi D, Singh J, Suyal DC, Kumar A, Rajput VD, Yadav AN, Singh K, Singh J, Sayyed RZ, Arora NK, Saxena AK et al. Beneficial microbiomes for bioremediation of diverse contaminated environments for environmental sustainability: present status and future challenges. Environ Sci Pollut Res 2021.
Salvia HM, Yadav GD. Process intensification using immobilized enzymes for the development of white biotechnology. Catal Sci Technol. 2021; 11: 1994-2020.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareSurvey of Trends in Electrotherapy in Gujarat
English122125Gosai GEnglish Dave YEnglish Parmar JEnglish Chhatlani REnglishIntroduction: Electrotherapy has been a very important part of physiotherapy treatment, yet it is an area of debate and research that how it is being practised. Specifically use of Ultrasound, Short wave Diathermy and Traction (Cervical and Lumbar). Aims: To find the trends in the use of Electrotherapy modalities in Gujarat. Methodology: A questionnaire with a variety of questions on the application and frequency of prescribing modalities to patients was prepared and circulated online to 30 Physiotherapy Colleges in Gujarat. Result: Data obtained from all colleges was analyzed by SPSS 24.0. The Means were utilized to observe the trends in the use of Electro-modalities. (pEnglish Physiotherapy, Electro modalities, Ultrasound, Short-wave Diathermy, Lumbar Traction, Cervical TractionINTRODUCTION
Electrotherapy is the main module of physiotherapy practice. Modalities like Cervical Traction (CT), Lumbar Traction (LT), Ultrasound (US) and Short-wave Diathermy (SWD) are frequently used in a physiotherapy clinic. 1,2
Cervical traction is a modality of choice for many cervical dysfunctions. It applies to a wide range of problems from sprain to fractures and dislocations of the cervical vertebrae.
Mainly there are 2 ways in which CT can be given
Static traction: Traction with a constant pull varying from 10 to 30 lbs is applied for 20–25 min. It is indicated in the presence of definite neurological signs, including radiating pain, not relieved by other conservative modes.
Intermittent traction: Traction with alternate phases of stretching (pull) and relaxation is the popular mode of traction. It produces the effects of massage on the muscular, ligamentous and capsular structures. It promotes circulation and reduces swelling, thereby reducing inflammation, spasm and pain. 3
Lumbar Traction is also known as spinal traction. It is a popular modality in the management of Low Back Pain (LBP). Again, there are 2 main ways in which LT can be given
Sustained traction: In supine lying, the static traction with a tractive force of not less than 50%–60% of the bodyweight is applied for 20–30 min.
Intermittent traction: Alternate application of traction and its release is the most popular method of applying lumbar traction. It has a vascular massaging effect, and relaxation is produced in the tight soft tissues. The combination of alternating stretch and release promotes relaxation. It is well accepted by the patients as compared to sustained traction.4
In Ultrasound therapy, ultrasound energy is used to treat human tissue. The energy has applied to a transducer which consists of a crystal, which vibrates to produce energy. The US is a form of acoustic vibrations propagating in the form of longitudinal compression waves at frequencies too high to be heard by human ears.
There are various means by which the US can be given to the human tissue.
Direct contact with Gel: On a regular skin surface, a coupling medium is applied to eliminate air between the skin and the transducer and transmit the ultrasound beam to the tissues. The transducer head is moved in small concentric circles over the skin, keeping the metal front plate in full contact with the surface.
Water Bag: irregular bony surfaces, a rubber bag filled with degassed water is used. A coupling medium is placed between the rubber bag and the skin, and between the rubber bag and transducer head. The treatment head is moved over this rubber bag. The only disadvantage is of attenuation of ultrasound, as it has to cross many interfaces.
Water Bath: A water bath is filled with de-gassed water if possible. Ordinary water presents a problem that gas bubbles dissociate out from the water. These bubbles accumulate on the skin and transducer head, and so reflect the ultrasound beam. Then these bubbles must be wiped from these surfaces regularly.5
Short wave Diathermy is a deep heating modality. Radio waves in the short-wave band have a frequency in the range of 10 MHz-100 MHz. The short-wave diathermy used widely utilise the frequency of 27.12 MHz and wavelength greater than 11m.
There are further 3 methods of applying SWD to the patients:
1. Co-planar: It is also called the parallel method. The electrodes are placed side by side.
2. Contra-planar. It is also called through and through the method. Pads are placed on either side of the joints. In this method, deeper tissues are heated. 6
3. Crossfire Method: In this technique, half of the treatment is given with the placement
of electrodes in one direction, i.e., medial or lateral aspect and another half is used
with the placement of electrodes in other direction, i.e., anterior or posterior aspect.
This method is commonly used for the treatment of the knee joint, sinuses (frontal,
maxillary and ethmoidal) and pelvic organs.7
Need of the study:
Electrotherapy has been a very important part of physiotherapy treatment, yet it is an area of debate and research that how it is being practised. Choosing parameters and techniques for Electro Physical Agents (EPAs)is not simple. Although, when used inappropriately, EPAs can be ineffective. Clinical decision making is found to be dependent upon past experiences and the availability of resources. This study intends to find how US, LT, CT and SWD are used in educational institutes, as it is likely to affect future therapist’s clinical decision making.
AIMS AND OBJECTIVES:
Aim:
To find the trends in the use of Electrotherapy modalities in Gujarat
Objective:
To prepare and circulate survey questionnaire.
To obtain data from colleges in Gujarat regarding the survey.
To analyse the data obtained.
METHODOLOGY:
Study Design: A Cross-sectional Survey
Sample Size: 30 Colleges participated in the study
Sampling Method: Purposive Sampling
Study setting: Faculty of Physiotherapy, Marwadi University, Rajkot.
Study Duration: April 2020 to May 2020
Method:
A brief Questionnaire was prepared to understand the trends in Electrotherapy Modality usage among various colleges and their Out-Patient Departments/Clinics.
35 Colleges were approached in Gujarat out of which 31 Colleges responded with data. Out of 30 Colleges, data of one college was found to be incomplete hence 30 college data were included and analysed.
This Questionnaire is intended to know techniques used by physiotherapists across Gujarat regarding Electrotherapy modalities like Ultrasound, Traction (Lumbar and Cervical) and Short-wave diathermy.
The Questionnaire was prepared in Google Forms.
The Questionnaire was forwarded to all colleges in Gujarat through E-mail and consent was taken for not disclosing their data.
The data was then obtained through e-mail and analysed.
RESULT:
Data were analysed using SPSS Version 24.0 and the p value was set to 0.05. Means were calculated as a measure of central tendency for all data obtained.
It should be noted that the Questionnaire contained checkboxes for Use of the method of application of US and factors to decide the frequency of US, hence the total number of samples is more than n (=30).
Figure 4: (a) How often CT is used in the clinic, (b) How often is LT used in the clinic, (c) Which method of CT is utilized and (d) Which method of LT is utilized.
DISCUSSION:
From the analysis of the data obtained it was observed that all of the institutes were using Ultrasound (US) and Cervical Traction (CT) frequently. Some did not use Short-Wave Diathermy (SWD) or Lumbar Traction (LT). Water bath and water bag were the least preferable methods for the US. The majority is giving the US for 5-7 min, ignoring many aspects in deciding the dosage of it.
Intermittent and Supine with 90-90 position for 10-20 minutes was the most common parameters used for LT. The prone method is almost unused. CT is usually not differentiated with lesion site but given in neutral position. SWD is given according to available resources or in general about 10-15 min in the Co-planner method (Contra-planner and cross-fire being less popular) and rarely as severity or chronicity.
These trends suggest that for US therapy not all methods of application are applied. This may be on account of ease of delivery with Direct contact with Gel method of application.
CT and LT were also prescribed to the patients irrespective of lesion type. Previously, Phil Harris has concluded that CT is effective only if proper Differential Diagnosis is made and application has been done based on the Differential Diagnosis.8
SWD is given with the resources available and not following factors deciding the treatment time.
From the survey, additionally, it was found that UVR is not used in the majority of the clinical setups.
It can be observed that Physiotherapy College and their OPD do not follow the treatment factors and methods described in Literature every time. This also implies that students, who are enrolled under Physiotherapy colleges learn concepts from literature but may apply knowledge based on practical scenarios (as observed and practised in Physiotherapy OPD or clinics), which might create a dilemma.
This is one of a kind survey to find the trends of Electrotherapy Modality usage among Gujarat state.
CONCLUSION:
From the present survey, it was observed that all of the institutes were using Ultrasound and Cervical Traction frequently. The majority of the clinics were giving Ultrasound for 5-7 min, ignoring many aspects in deciding the dosage of it. Cervical Traction is usually not differentiated with lesion site but given in a neutral position. Short-wave Diathermy is given according to available resources or in general about 10-15 min in the Co-planner method.
ACKNOWLEDGEMENT:
The authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.
SOURCE OF FUNDING:
Nil
CONFLICT OF INTEREST:
Nil
INDIVIDUAL AUTHOR’S CONTRIBUTION:
GOSAI G:
Data Collection, Methodology and Referencing,
DAVE Y:
Data Collection, and Discussion.
PARMAR J:
Research Design, and Framework for the research.
CHHATLANI R:
Statistical Analysis and Cross-referencing.
Englishhttp://ijcrr.com/abstract.php?article_id=4082http://ijcrr.com/article_html.php?did=40821. Watson T. The role of electrotherapy in contemporary physiotherapy practice. Man Ther. 000;5(3):132–41.
2. Watson T. Introduction: current concepts and clinical decision making in electrotherapy. In: Watson T, editor. Electrotherapy: evidence-based practice. 12th ed. Edinburgh: Churchill Livingstone/Elsevier; 2008. p. 3–10.
3. Joshi J, Essentials of Orthopaedics and Applied Physiotherapy, Elsevier Publication, 3rd Edition, pg.439-442
4. Joshi J, Essentials of Orthopaedics and Applied Physiotherapy, Elsevier Publication, 3rd Edition, pg. 548-552
5. Khokhar V, Helpline Electrotherapy for Physiotherapists, Bharat Bharati Prakashan, 3rd Edition, pg.77-88
6. Khokhar V, Helpline Electrotherapy for Physiotherapists, Bharat Bharati Prakashan, 3rd Edition, pg.49-62
7. Singh J, Textbook of Electrotherapy, Jaypee Brothers Publication, 2nd Edition, pg.151-162.
8. Phil R. Harris. Cervical Traction: Review of Literature and Treatment Guidelines, Physical Therapy, 5(1) 1977, p. 910-914
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareStudy of Relation between Serum Albumin and Glycosylated Hemoglobin Levels in Patients of Type 2 Diabetes Mellitus
English126130Stuti PUEnglish Shilpa CPEnglishIntroduction: Diabetes mellitus (DM) can affect people throughout the world, Even though diabetes has been known for a long time, only in the last few decades discoveries have provided measures to minimize morbidity and mortality. Objective: Study of relation between serum albumin and glycosylated haemoglobin levels in patients of type 2 Diabetes mellitus. Method: The present study can be stated as a Hospital-based cross-sectional, observational study design. The study was carried out in the patients admitted in the ward who are diagnosed cases of type 2 DM, in Krishna hospital and Medical Research Centre, Karad. Result: It was observed that along with type 2 DM, hypertension was the most common comorbidity, present in 35.64% of the patients. The second most common comorbidity found was obesity, present in 25.74% of the patients. Conclusion: It was observed that patients who had higher levels of glycosylated haemoglobin had relatively lower levels of serum albumin and patients who had lower levels of glycosylated haemoglobin had normal or near-normal serum albumin levels.
EnglishSerum Albumin, Glycosylated Hemoglobin, Type 2 Diabetes Mellitus, Hypertension, Obesity INTRODUCTION
Diabetes mellitus (DM) can affect people throughout the world, Even though diabetes has been known for a long time, only in the last few decades discoveries have provided measures to minimize morbidity and mortality. Diabetic ketoacidosis, which is a major fatal complication of diabetes, its occurrence has decreased due to the discovery of insulin. However, Diabetes is characterized by metabolic abnormalities along with long-term microvascular and macrovascular complications. The prevalence of diabetes in developing countries is on the rise. It not only multiplies the risk of coronary artery disease but also increases the incidence of Cerebrovascular accidents. End-stage renal disease and also non-traumatic limb amputations.1 Chronic complication of diabetes is often present at the time of diagnosis of Diabetes mellitus. Presently data are scarce when it comes to the occurrence of complications relating to chronic. This case should be specific to diabetic patients at the time of diagnosis.2By educating the high-risk persons about diabetes-related complications, they can be encouraged for seeking medical consultation earlier. Diabetes-associated complications can be prevented only up to a certain point. Also, once the complications are set in, treating hyperglycemia alone itself is not sufficient and even if we treat aggressively, these complications will go on progress further. This emphasizes more aggressive screening for both microvascular as well as macrovascular complications at the time of diagnosis.3 In type 2 diabetes mellitus HbA1c testing is used to measure diabetic glycemic control Diabetic control is categorized as Poor control – HbA1c level >9%, Moderate control – HbA1c level between 7 to 9% Good or desired levels HbA1c level - 2mg/dl)
4. Pregnancy.
5. Chronic liver disease. (Total bilirubin > 3mg/dl)
6. Hypertriglyceridemia.
7. Iron or vitamin B12 deficiency.
Demographic information such as age, gender, past medical history, personal history and general examination findings such as weight, height, BMI were recorded with the help of standard, pre-validated semi-structured case record proforma. All enrolled patients underwent the following investigations-
Haemoglobin by fully automated 3 part cell analyzer
Total leukocyte count by fully automated 3 part cell analyzer
Platelet count by fully automated 3 part cell analyser
Urine routine and microscopy examination.
Blood urea by Urease-GLDH method
Serum creatinine by Modified JAFFE’S method
Random blood sugar by Hexokinase-mediated reaction
Fasting blood sugar by Hexokinase-mediated reaction
Postprandial blood sugar by Hexokinase-mediated reaction
Liver function tests by calorimetry
Serum albumin by bromocresol green assay
HbA1c by immune turbidimetry method.
All CBC parameters were performed in an automated 3 part analyzer by Nihon Kohden (Model number MEK 6420P)
STATISTICAL ANALYSIS
The statistical analysis was performed using the statistical package for social science (SPSS) 21(trial version) for windows. The data was recorded in the study Performa sheet and was entered into the statistical software for further evaluation. The data was arranged in the form of tables and groups for frequency analysis. Data were expressed as mean values ± standard deviations (SD), the percentage for continuous variables. Frequency and proportions were reported for categorical variables. A Chi-square test was used and The ‘P’ value of Englishhttp://ijcrr.com/abstract.php?article_id=4083http://ijcrr.com/article_html.php?did=4083[1] Harrison’s Principle of Internal Medicine, 20th edition, chapter 396 - Diabetes Mellitus: Diagnosis, Classification, and Pathophysiology, by lvin C. Powers; Kevin D. Niswender; Carmella Evans-Molina.
[2] Sosale A, Prasanna Kumar K, Sadikot S, Nigam A, Zargar A, Singh S et al. Chronic complications in newly diagnosed patients with Type 2 diabetes mellitus in India. Ind J Endocrin Metab. 2014;18 (3):355-60.
[3] Kumar M, Rawat R, Verma V, Zafar K, Kumar G. Chronic complications in newly diagnosed patients with type 2 diabetes mellitus in the rural area of western Uttar Pradesh, India. Int J Res Med Sci. 2016;4 (6):2292-2296.
[4] Shalbha Tiwari, Manish Bothale, Imtiaz Hasan, Mahesh J. Kulkarni, Mehmood G. Sayyad, Rita Basu, Ananda Basu, AmbikaGopalakrishnan Unnikrishnan,. Association between serum albumin and glycated haemoglobin in Asian Indian subjects. Ind J Endoc Metab. 2015, Jan-Feb, 19(1) 52-55.
[5] Shalbha Tiwari, Manish Bothale, Imtiaz Hasan, Mahesh J. Kulkarni, Mehmood G. Sayyad, Rita Basu, Ananda Basu, AmbikaGopalakrishnan Unnikrishnan,. Association between serum albumin and glycated haemoglobin in Asian Indian subjects. Ind J Endoc Metab. 2015, Jan-feb, 19(1) 52-55.
[6]Hardikar PS, Joshi SM, Bhat DS, Raut DA, Katre PA, Lubree HG, et al. Spuriously high prevalence of prediabetes diagnosed by HbA1c in young Indians partly explained by haematological factors and iron deficiency anaemia. Diab Care. 2012;35:797-802.
[7] Ramachandran A, Snehalatha C, Smith Shetty A, Nanditha A. Predictive value of HbA1c for incident diabetes among subjects with impaired glucose tolerance – analysis of the Indian Diabetes Prevention Programmes. Diabet Med. 2012;29:94-98.
[8] Sarojini C. Role of albumin in the estimation of HbA1c in south Indian subjects. Int J Sci Res. 2016; 5(4): 629-634.
[9] Sarojini C. Role of albumin in the estimation of HbA1c in south Indian subjects. Int J Sci Res. 2016;5(4)179-183.
[10] Shalbha Tiwari, Manish Bothale, Imtiaz Hasan, Mahesh J. Kulkarni, Mehmood G. Sayyad, Rita Basu, Ananda Basu, AmbikaGopalakrishnan Unnikrishnan. Association between serum albumin and glycated haemoglobin in Asian Indian subjects. Ind J Endocri Metab. 2015; 19(1): 52-55.
[11]Santiago R, Javier RI, Dolores M. Plasma Albumin Concentration Is a Predictor of HbA1c Among Type 2 Diabetic Patients, Independently of Fasting Plasma Glucose and Fructosamine. Diabetes Care. 2005;28(2):185-191.
[12] Xiao jing Feng, Influence of serum albumin on HbA1c and HbA1cdefined glycemic status: a retrospective study.2015;46(12):571-574.
[13] Masafumi Koga, Jun Murai, Hiroshi Saito, Soji Kasayama, Glycated Albumin and Glycated Hemoglobin Are Influenced Differently by Endogenous Insulin Secretion in Patients With Type 2 Diabetes, American diabetes association, Diabetes Care. 2010 Feb; 33(2): 270-272.
[14] Vinay N Minocha, Kavita Pal and Robert Zaiden, The association of serum albumin and glycated haemoglobin with all-cause mortality in patients with breast cancer, Thirty-Seventh Annual CTRC-AACR San Antonio Breast Cancer Symposium. 2014;12: 9-13.
[15] Po-Chung Cheng, Shang-Ren Hsu, and Yun-Chung Cheng, Association between Serum Albumin Concentration and Ketosis Risk in Hospitalized Individuals with Type 2 Diabetes Mellitus, J. Diabetes Res, 2016;23(5): 126-129.
[16]F A Nazki, A Syyeda, S Mohammed, F A Nazki, A Syyeda, S Mohammed. Int J Biochem. 2017; 3(9): 497-501.
[17] Rosemary Adamma Analike, Assessment of glycated haemoglobin, total protein and albumin levels in patients with type 2 diabetes mellitus visiting NAUTH, Nnewi, Ind J Pathol Oncol, 20196(4):700-703
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareEthidium Bromide-Agar Cartwheel Method in the Detection of Efflux Pump Mediated Multi-Drug Resistance in Enterobacteriaceae
English131135Patil REnglish Rangappa KGEnglish Rangaiah AEnglish Shankar SMEnglishIntroduction: Multidrug-resistant (MDR) strains of bacteria pose a major threat in clinical settings. Multidrug resistance can be due to various mechanisms but is primarily the result of over-expressed efflux pumps that extrude unrelated antibiotics before they reach the intended targets. The emergence of MDR due to efflux pumps has to lead to a diagnostic and therapeutic dilemma. Ethidium Bromide (EtBr)-agar cartwheel assay is a newly discovered simple, safe and cost-effective method to determine efflux pump activity. Objectives: The study aimed at the detection of efflux pump activity in MDR strains belonging to Enterobacteriaceae family using the EtBr cartwheel method as well as determining the antimicrobial susceptibility pattern of MDR Enterobacteriaceae. Materials and methods: A total of 95 MDR Enterobacteriaceae isolates from various clinical samples were included in the study. Identification and antimicrobial susceptibility were done following Clinical Laboratory Standards Institute(CLSI) 2019 guidelines. They were evaluated for efflux activity using the EtBr agar cartwheel method. Data analysis was performed using SPSS version 20. Results: All the 95 isolates were tested for efflux pump using the Ethidium Bromide agar cartwheel technique. The results showed that 47(49.47%) of the total isolates gave positive results. Among the 47 efflux pump, positive organisms majority were Klebsiellapneumoniae, followed by Escherichia coli and Proteus mirabilis. Conclusion: Laboratory detection of efflux pumps in bacteria can be effectively done using EtBr agar cartwheel assay. We conclude that over-expression of efflux pumps has led to an alarming rise in drug resistance and necessary steps should be taken to control this problem.
EnglishEthidium Bromide, Cartwheel, Efflux Pump, Multidrug resistance, Enterobacteriaceae, KlebsiellapneumoniaeINTRODUCTION:
Bacterial infections have again become a threat due to the rapid emergence of resistant bacteria caused by the overuse and misuse of antibiotics, thus endangering their efficacy. Bacteria resist the action of antibiotics through several mechanisms.1 Out of these, bacterial efflux pumps are becoming a major concern because they provide bacteria with the ability to drive away many structurally unrelated antibiotics, even before their effect begins to onset.2 These pumps are classified into five: ATP binding cassette superfamily (ABC), major facilitator superfamily (MFS), resistance nodulation cell division superfamily (RND), small multidrug resistance family (SMR), multi-antimicrobial extrusion protein family (MATE).3,4,5
The intestinal tracts of humans and animals form the natural habitat for Enterobacteriaceae which are a heterogeneous group of Gram-negative rods. Enterobacteriaceae cause a variety of human infections that can be broadly classified as either enteric diseases or extra-intestinal infections such as urinary tract infections, bacteraemia, and meningitis. Enterobacteriaceae acquired in the hospital environment are often resistant to many antimicrobial agents.6
The evaluation of efflux systems by conventional methods such as the retention of the fluorescent dye ethidium bromide (EtBr) or radio-labelled antibiotics requires specialised instrumentation not usually available in a clinical laboratory. Hence there is a need to develop a fast and cost-effective method for detecting efflux pumps in efflux mediated multidrug-resistant (MDR) bacteria. The EtBr agar cartwheel assay is a newly discovered simple, instrument-free, safe and cost-effective method utilised for the demonstration of efflux pump activity in bacteria. It employs EtBr as the pump substrate that allows the verification of the existence of an over-expressed efflux system. Thus, there is a maximum concentration of EtBr which is effectively extruded by the cells and higher EtBr concentrations will be retained; hence when the bacterial mass is exposed to ultraviolet (UV) light, fluorescence will be detected. The concentration of EtBr that is required to produce fluorescence in bacterial strains over-expressing efflux systems is considerably higher than that which produces fluorescence of the reference strain.5,7
The present study aimed to detect efflux pumps in MDR bacteria belonging to the Enterobacteriaceae family with the help of the EtBr agar Cartwheel assay in a tertiary care centre.
MATERIALS AND METHODS:
This cross-sectional observational study was carried out in the Department of Microbiology, Bangalore Medical College & Research Institute (BMCRI), Bengaluru from samples sourced from the attached hospitals. The sample size was taken as 95 as calculated with d(absolute precision)=8 and p(prevalence)=83%, using the formula: N=4pq/d2.8MDR Enterobacteriaceae isolates from clinical samples sent for culture and antimicrobial susceptibility testing were included in the study. SusceptibleEnterobacteriaceae, Gram-negative organisms other than Enterobacteriaceae and Gram-positive cocci were excluded from the study. Institutional ethical clearance was obtained. Demographic details like name, age, gender, place and other relevant medical details were obtained from request forms sent to the microbiology laboratory and from the medical records department.
Identification and anti-microbial susceptibility were done using VITEK 2 system as per Clinical Laboratory Standards Institute (CLSI) 2019 guidelines.9 MDR isolates were further tested for efflux activity using the Ethidium Bromide Agar Cartwheel method. Escherichia coli (E.coli) ATCC25922 was used as control.
EtBr-agar cartwheel method:
Bacterial strains were grown in 5 mL of appropriate liquid broth until they reached an optical density (OD) 0.6 at 600 nm. The OD of the cultures was adjusted with PBS to 0.5 McFarland standard. Tryptic soy agar plates containing EtBr concentrations ranging from 0 to 2.5 mg/L were prepared on the same day of the experiment and protected from light. The plates were then divided into as many as 12 sectors by radial lines (cartwheel pattern) as exemplified in Flowchart 1. OD adjusted cultures were inoculated on EtBr-agar plates starting from the centre of the plate and spreading towards the edges, as indicated by the arrowheads shown in Flowchart 1. Each plate included at least one reference strain that served as a comparative control. The number of reference strains to be included may be increased to two or more, depending on a given experiment. The swabbed EtBr-agar plates were then incubated at 37°C for 16 hours and examined under a suitable source of UV light, such as a hand-held UV lamp or a UV transilluminator. The minimum concentration of EtBr (MCEtBr) that produced fluorescence of the bacterial mass was recorded(Fig 1).5,7The absence of fluorescence determines the presence of active efflux pumps in MDR strains.
Statistical analysis: Data is entered into an excel spreadsheet and analysed using SPSS version 20. Data are presented as descriptive statistics and analysed using suitable parametric and non-parametric tests. Data is presented in the form of figures, tables, graphs or pie charts.
RESULTS:
A total of 95 Enterobacteriaceae organisms were isolated from various specimens of patients, of which 54(56.8%) were Klebsiellapneumoniae (K.pneumoniae), 27(28.4%) were E.coli, 8(8.4%) were Proteus mirabilis (P.mirabilis), 3(3.2%) were Enterobacter cloacae, 1(1.1%) was Enterobacteraerogenes, 1(1.1%) was Providenciastuartii and 1(1.1%) was Providenciarettgeri. (Table 1)
83 isolates were recovered from inpatients and 12 isolates were from the outpatient department. The distribution of the patients included in the study among various departments was as follows: 26(27.37%) in Surgical units, 15(15.79%) in Burns ward, 9(9.47%) in Neonatal Intensive Care Unit (ICU), 7(7.37%) in Paediatric units, 6(6.32%) in Obstetrics & Gynaecology (OBG) units, 5(5.26%) in Medicine units, 3(3.16%) in Dermatology units, 2(2.1%) each in Medical ICU, Burns ICU, Pulmonary Medicine units and Paediatric ICU, 1(1.05%) each in Psychiatry, Otorhinolaryngology, OBG ICU, Urology and Orthopaedic units. 10isolates (10.57%) were not traceable.
Specimens included in the study were: pus 48 (50.5%), urine 18 (18.9%), endotracheal aspirate 13(13.7%), Blood 5(5.3%), Sputum 5(5.3%), CSF 2(2.1%), High vaginal/cervical swab 2(2.1%) and fluid aspirates2 (2.1%).
Antimicrobial susceptibility pattern:
Antibiotic susceptibility to various antimicrobials was done by automated identification/ Antimicrobial susceptibility (ID/AST) method using VITEK-2 (Biomerieux). All 95 (100%) isolates were resistant to cefuroxime, cefuroxime axetil and ceftriaxone. 90 isolates (94.7%) were resistant to ciprofloxacin, followed by resistance to piperacillin/tazobactam (93.68%), amoxicillin/clavulanic acid (91.58%) and cefoperazone/sulbactam (85.26%). Least resistance was noted among the isolates to nitrofurantoin (6.3%) and colistin(8.4%). (Fig 2)
The mean age of patients was 33.21 ± 24.216, M: F ratio was 12:7.
E.coli(27) isolates were most resistant to 2nd and 3rd generation cephalosporins(100%) followed by 4th generation cephalosporins and fluoroquinolones(96.23%) followed by ampicillin (92.56%) with the least resistance to tigecycline and nitrofurantoin(0%).
K.pneumoniae(54) isolates were also most resistant to 2nd and 3rd generation cephalosporins and amoxicillin/clavulanic acid (100%) followed by piperacillin/tazobactam(98.15%) and cefoperazone/sulbactam (94.44%). Colistin resistance was lower among these isolates (3.70%).
P.mirabilis (8) isolates were most resistant to 2nd and 3rd generation cephalosporins, amoxicillin/clavulanic acid, imipenem, amikacin, gentamicin and ciprofloxacin(100%) followed by ampicillin (87.5%) and trimethoprim/sulphamethoxazole (75%). They were least resistant to nitrofurantoin (0%) and tigecycline (12.5%).
The organisms were also flagged for various mechanisms of resistance by VITEK-2. 75(78.94%) isolates were flagged for carbapenemase. 63 (66.31%) showed impermeability to carbapenems. 19(20%) were ESBL producers, 4(4.21%) showed impermeability to cephamycins and 1(1.05%) isolate showed acquired cephalosporins activity. (Table 2)
Efflux pump activity:
All the 95 isolates were tested for efflux pump using the Ethidium Bromide agar cartwheel technique. The results showed that 47(49.47%) isolates gave positive results out of which 6 did not show fluorescence even at 2.5mg/L(max concentration of EtBr used), 1 isolate did not show fluorescence at 2mg/L but fluoresced at 2.5mg/L and 40 did not fluoresce at 1mg/L only but fluoresced at 2 and 2.5mg/L. (Table 3)
The mean age of the patients who had infections due to efflux pump positive organisms was 34.02± 25.010 and the male: female (M: F) ratio was 30:17.
Among the 47 efflux pump positive organisms 26(55.32%) were K.pneumoniae, 13(27.66%) were E.coli, 5(10.67%) were P.mirabilis, 2(4.25%) were Enterobactercloaceaand 1(2.13%) were Enterobacteraerogenes (Table 1). The efflux pump positive isolates were mostly from pus (56.45%), followed by urine (19.15%).
13(27.7%) of the efflux pump positive isolates were from surgical cases and 7 (14.9%) were from the burns ward. 38(80.85%) isolates were recovered from inpatients and 9(19.15%) isolates were from the outpatient department. 9 (19.15%) isolates were from ICU.
Among the efflux pump positive organisms, some of the organisms were flagged for other mechanisms of resistance like carbapenemase, impermeability to carbapenems, ESBL and impermeability to cephamycins, by Vitek-2. (Table 2)
The most commonly used antimicrobials among the patients whose specimens yielded efflux pump positive isolates were ceftriaxone, piperacillin/tazobactam and amikacin.
DISCUSSION:
Management of infections is very challenging due to the emergence of multidrug resistance. There are very few available options among anti-microbial agents against MDR Gram-negative bacteria, thus posing a major public health threat. Since MDR is primarily the result of over-expressed efflux pumps that extrude unrelated antibiotics before they reach the intended targets, clinical laboratories should develop and implement new and improved methods for the timely identification of efflux mediated MDR phenotypes.
95 organisms were tested for efflux pump activity, which is very high as compared to studies conducted by Rana T et al. and Al Fayyadh Z et al. and Martins M et al..5,7,10
Efflux Pump Activity:-
In the present study, EtBr fluorescence was not observed in 47/95 (49.47%) MDR isolates, which suggested that these isolates contain efflux pump which effluxed out EtBr from the bacterial cell. 6 isolates showed over-expressed efflux systems by not showing fluorescence even at 2.5mg/L(highest concentration of EtBr used), 1 isolate showed intermediate efflux activity by showing fluorescence at 2.5mg/L but not at 2mg/L and 1mg/L while 40 showed mild efflux pump activity by showing fluorescence at 2 and 2.5mg/L.
In a study conducted by Martins M et al., 42 clinical isolates with a confirmed MDR phenotype were evaluated for efflux pump activity by the EtBr cartwheel method. The study included 10 Escherichia coli, 18 Enterobacteraerogenes, 10 Staphylococcus aureus, and 4 Enterococcus faecalis strains. The study findings revealed a presence of efflux activity in 36% of the isolates, which is comparable to the results of our study. Among the efflux pump positive organisms, maximum efflux activity was shown by E.coli(16.6%) species, whereas in our study K.pneumoniae exhibited maximum efflux activity (27.66%).7
In a study conducted by Al Fayyadh Z et al.10 which included 165 specimens from different sources, 93 isolates were identified as E.coli. About 40E.coli isolates were tested for the presence of efflux pump using the cartwheel method. 31 isolates (77.5%) in this study revealed positive results. In our study, the efflux pump activity was relatively lower (49.47%), the reason for which could be the presence of other mechanisms of multidrug resistance.
All 47 efflux pump isolates in the present study were noted to possess one or more of the other mechanisms of resistance: carbapenemase, ESBL, impermeability to cephamycins and impermeability to carbapenem, as revealed by Vitek-2. The other 48 isolates which did not show efflux pump activity also flagged for various other mechanisms of resistance mentioned above along with acquired cephalosporins.
A study by Suwantarat N et al.11shows that one of the major contributors to anti-microbial resistant bacteria in south-east Asia is MDRGram negative bacteria. Overuse of carbapenem therapy to treat these infections has led to the high prevalence of ESBLs in this region. To control the spread of MDRGNs in this region, it is pertinent to improve the infection control practices, have better laboratory detection facilities and advocate judicious use of anti-microbial agents.
Anti-microbial susceptibility pattern among Enterobacteriaceae:-
In our report, K.pneumoniae(28.4%) is the most common etiological agent of MDR infections followed by E.coli(8.4%). These organisms were most commonly isolated from pus (50.5%) and urine (18.9%) samples. The majority of them were obtained from Surgery (27.37%) and Burns department(15.79%).
But in a study conducted by Beyene D et al.12 in which 94.5% of the isolates were MDR, E.coliwas the most common etiological agent followed by K.pneumoniae. The majority of the isolates were from urine (62.5%) and by blood (28.4%) and 73% were from ICU.
The mean age of patients in our study was 33.21 ± 24.216 years and the male: female ratio was 12:7. But in a study conducted by M.A. Rajiet al.13, the mean age was 42.4 years with an insignificant difference between the isolates collected from males and females.
These differences could be due to variations in geographic areas, periods of study, target population and sample size.
The isolates encountered in the present study were most resistant to second and third-generation cephalosporins, fluoroquinolones, piperacillin/tazobactam and least resistant to colistin, tigecycline and amikacin (Fig 2). These results are consistent with the results of a study conducted by Charan et al.14where the organisms were most resistant to amoxicillin/clavulanic acid, 2ndand 3rdcephalosporins and carbapenems.
The antimicrobial susceptibility findings related toE.coli and K.pneumoniae are consistent with a study conducted by Lai CC et al.15
CONCLUSIONS:
Laboratory detection of efflux pumps in bacteria can be effectively done using EtBr cartwheel assay. This is a simple and instrument-free technique that can be performed in most laboratories. Based on the present study, it can be concluded that overexpression of efflux pumps has led to an alarming rise in multi-drug resistance and necessary steps should be taken to control this problem. This is expected to aid in controlling hospital-acquired infections and advocating rational use of antimicrobials.
ACKNOWLEDGEMENTS:
The authors express a deep sense of gratitude to faculty and residents, the Department of Microbiology, BMCRI for their guidance and technical assistance during the study. We also acknowledge the support from clinical departments and patients whose clinical specimens were included in the study.
CONFLICT OF INTEREST: Nil
SOURCE OF FUNDING: Research grant received from Rajiv Gandhi University of Health Sciences(RGUHS), Karnataka under the UG Short Term Research 2019 program.
Note: Isolate 13 shows no fluorosence at concentration of 1mg/L and 2mg/L and minimal fluorosence at 2.5mg/L as compared to other isolates. This indicates that isolate 13 contains efflux pumps.
Englishhttp://ijcrr.com/abstract.php?article_id=4084http://ijcrr.com/article_html.php?did=4084
Ventola CL. The antibiotic resistance crisis: part 1: causes and threats. P T. 2015;40(4):277-83.
Li XZ, Nikaido H. Efflux-mediated drug resistance in bacteria: an update. Drugs. 2009;69(12):1555-1623.
Poole K. Efflux pumps as antimicrobial resistance mechanisms. Ann Med. 2007;39(3):162-176.
Blair JM, Richmond GE, Piddock LJ. Multidrug efflux pumps in Gram-negative bacteria and their role in antibiotic resistance. Future Microbiol. 2014;9(10):1165-1177.
Rana T, Kaur N, Farooq U, Khan A, Singh S. Efflux as an arising cause of drug resistance in Punjab(India). Int J Biol, Pharm, Allied Sci. 2015;4(9): 5967-5979.
Jawetz E, Melnick JL, Adelberg EA, Carroll KC. Jawetz, Melnick and Adelberg’s Medical Microbiology. 27thed.New York, NY: McGraw-Hill Education;2016;231
Martins M, Viveiros M, Couto I. Identification of efflux pump-mediated multidrug-resistant bacteria by the ethidium bromide-agar cartwheel method. In Vivo. 2011;25(2):171-178.
Helmy OM, Kashef MT. Different phenotypic and molecular mechanisms associated with multidrug resistance in Gram-negative clinical isolates from Egypt. Infect Drug Resist. 2017;10:479-498. Published 2017 Dec 8.
CLSI. Performance Standards for Antimicrobial Susceptibility Testing. 29th edition.CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute;2019.
Al-Fayyadh ZH, Turkie AM, Al-Mathkhury HJF. New mutations in GyrAgene of Escherichiacoli isolated from Iraqi patients. Iraqi J Sci.2017;58(2B):778-788.
Suwantarat N, Carroll KC. Epidemiology and molecular characterization of multidrug-resistant Gram-negative bacteria in Southeast Asia. Antimicrob Resist Infect Control. 2016;5:15. Published 2016 May 4.
Beyene D, Bitew A, Fantew S, Mihret A, Evans M. Multidrug-resistant profile and prevalence of extended-spectrum β-lactamase and carbapenemase production in fermentative Gram-negative bacilli recovered from patients and specimens referred to National Reference Laboratory, Addis Ababa, Ethiopia. PLoS One. 2019;14(9):e0222911. Published 2019 Sep 25.
Raji MA, Jamal W, Ojemhen O, Rotimi VO. Point-surveillance of antibiotic resistance in Enterobacteriaceae isolates from patients in a Lagos Teaching Hospital, Nigeria. J Infect Public Health. 2013;6(6):431-437.
Mulla S, Charan J, Panvala T. Antibiotic sensitivity of Enterobacteriaceae at a tertiary care centre in India. Chron Young Sci. 2011;2(4):214-218.
Lai CC, Chen YS, Lee NY. Susceptibility rates of clinically important bacteria collected from intensive care units against colistin, carbapenems, and other comparative agents: results from Surveillance of Multicenter Antimicrobial Resistance in Taiwan (SMART). Infect Drug Resist. 2019;12:627-640. Published 2019 Mar 14.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareEfficacy of Modified Carbapenem Inactivation Method for Carbapenemase Detection and Comparative Evaluation with Polymerase Chain Reaction for the Identification of Carbapenemase-Producing Klebsiella pneumonia Isolates
English136139Bhat AsifaEnglish Benazir ShaziaEnglish Fomda Bashir AhmadEnglishEnglishCarbapenem resistance, Carbapenemases, mCIM, Phenotypic method, Polymerase chain reactionINTRODUCTION: Carbapenemases have become a frequent cause of drug resistance in Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii during the last decade.1 Multiple carbapenemase genes have been described till now. The common determinants contributing to carbapenem resistance include blaKPC (Ambler class A), blaNDM(Ambler classB), and blaOXA-48-like(Ambler class D) genes. These enzymes are routinely isolated from Klebsiella pneumoniae and Escherichia coli along with other Gram-negative non-fermenters like Pseudomonas aeruginosa and Acinetobacter spp.2 Infections due to carbapenemase-producing Gram-negative bacteria can cause serious illness leading to a prolonged period of hospitalization and increased mortality ratio. Therefore, monitoring the development of resistance against carbapenems is of utmost importance.3
Various phenotypic, as well as genotypic methods, have been used to detect carbapenemases. Modified Hodge test was a useful phenotypic test previously included in the CLSI guidelines but it had the disadvantage of giving false-positive results mostly with Enterobacter spp. harbouring AmpC enzymes and alterations in porin channels. It also suffered false-negative results in New Delhi Metallo-beta-lactamase(NDM) producing isolates.4 Other phenotypic tests like the Carba NP test requires the use of specific and exclusive reagents, also the interpretation of the Carba NP test is subjective and it has shown poor sensitivity for the detection of OXA-48-type carbapenemases.5,6 Genotypic assays can principally detect only known targets and thus the performance of such test could be seriously affected by the occurrence of mutations within the targets.4
Modified carbapenem inactivation method (mCIM) is included as a screening test for carbapenemase-producing Enterobacteriaceae in CLSI 2018.7 Compared to Carba NP, which has a rapid turnaround time of 2 hours, mCIM is time-consuming, requiring an overnight incubation for the detection of carbapenemases. But it is relatively simple and has shown sensitivity and specificity of more than 99%.8
The emergence and spread of carbapenem-resistant bacteria is an issue of great clinical and public health concern.4 Thus, the study was carried out to evaluate the usefulness of mCIM for the identification of carbapenem-resistant isolates in our hospital because the accurate diagnosis of infections due to carbapenemase-producing Gram-negative bacteria is important for epidemiological purposes, infection-prevention measures and expediting appropriate therapy in such infected patients.
MATERIAL AND METHODS
This prospective cross-sectional study was conducted in the Department of Microbiology, Sher-i- Kashmir Institute of Medical Sciences (SKIMS) India, a tertiary care institute from October 2019 to March 2020.
Clinical Isolates: 80 Gram-negative isolates recovered from various clinical samples (blood, pus, urine, sputum and other body fluids) were included in the study. The isolates comprised of Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa.
Antibiotic susceptibility was performed by Kirby-Bauer disc diffusion method according to CLSI guidelines and the isolates resistant to meropenem(10 µg) were selected.7 These isolates were subjected to a modified carbapenem inactivation method(mCIM). In addition, 20 blaKPC PCR positive and 15 blaKPC PCR negative Klebsiella pneumonia isolates were tested by mCIM separately.
mCIM testing: It was done according to CLSI 2018 guidelines.7 Using a sterile inoculating loop, 1µl of the test organism(Escherichia coli / Klebsiella pneumoniae) or 10µl of Pseudomonas aeruginosa was added into a tube containing 2 ml of tryptic soy broth(HIMEDIA); the bacterial suspension was vortexed for 10 to 15s. Aseptically, a 10µg meropenem disc (HIMEDIA) was added to this bacterial suspension and was incubated for 4 h ±15 min at 35°C ± 2°C in ambient air. Preceding the completion of the 4-hour carbapenem inactivation step, a 0.5 McFarland standard suspension of the mCIM indicator organism (Escherichia coli ATCC 25922, a carbapenem-susceptible strain) was prepared and inoculated on the Mueller-Hinton agar plate(HIMEDIA) using the method for standard disc diffusion susceptibility testing. The meropenem disc was then removed from the tryptic soy broth bacterial suspension using a 10µl inoculating loop which was dragged along the edge of the tube to remove excess liquid, and the disc was placed on the inoculated MHA plate. It was then incubated for 18 to 24 h at 35°C ± 2°C in ambient air.7
mCIM result interpretation: The test was interpreted according to CLSI 2018 guidelines.7 The zone of inhibition around each meropenem disc was measured. A zone diameter of 6 to 15 mm or presence of colonies within 16-18mm zone was considered as a positive result (i.e. carbapenemase production ), a zone diameter of more than or equal to 19 mm was considered a negative result (i.e. no carbapenemase production ) and a zone diameter of 16-18 mm was considered an indeterminate result.7 A small ring of a growth adjacent to the meropenem disc, representing carryover of the test organism from the Tryptic soy broth was ignored (Fig.1). For intermediate results, mCIM for the test isolate was repeated after checking for the purity of Escherichia coli ATCC 25922 indicator strain and the meropenem disc integrity by subjecting it to repeat disc diffusion test.
Polymerase chain reaction (PCR): Molecular identification of KPC-producing Klebsiella pneumoniae was done by bla KPC PCR using bacterial lysates prepared by removal of 200μl of overnight broth culture. The lysates were centrifuged at 12,000 × g for 2 min, and then re-suspended in 200μl of molecular-grade water followed by boiling at 95°C for 10 min, and discarding the cellular debris by centrifugation at 12,000 × g for 2 min at 4°C. 1μl of cell lysates were then subjected to PCR analysis using the following primers designed to identify all blaKPC genes (blaKPC-1 through blaKPC-7):
KPC forward (ATGTCACTGTATCGCCGTCT),
KPC reverse (TTTTCAGAGCCTTACTGCCC).
The reaction was set up in a PCR vial, after the addition of master mix, primers and the extracted DNA. 25μl of Master Mix contained 10X Taq buffer, 0.4mM dNTPs mix, 2mM Mgcl2, and 2U Proofreading Taq DNA polymerase.(Thermo scientific, USA). Lysates derived from blaKPC carrying Klebsiella pneumoniae strain 1705 and Escherichia coli ATCC 25922 were used as positive and negative controls respectively. The PCR was set up at the following conditions: 15 min at 95°C and 38 cycles of 1 min at 94°C, 1 min at 62°C, and 1 min at 72°C, which was followed by an extension step of 10 min at 72°C.9 The PCR products were analysed by electrophoresis on 2% agarose gel stained with ethidium bromide and visualized with UV light. The blaKPC gene gave a band at 893bp.
RESULTS: Out of the total 80 isolates tested for carbapenemase production by mCIM, 71 (88.7%) were carbapenemase producers. Initially, an indeterminate result was present in 12 isolates(8 Klebsiella pneumoniae and 4 Pseudomonas aeruginosa isolates). After repeating mCIM of these isolates 6 among 8 Klebsiella pneumoniae isolates were mCIM positive and 2 were mCIM negative. Among the 4 Pseudomonas aeruginosa isolates, 2 were positive and 2 were negative after repeating mCIM. The positivity of mCIM in different isolates is shown in Table-1.
While comparing mCIM of the blaKPC Klebsiella pneumoniae isolates, it showed 100% sensitivity in the detection of carbapenemase production in PCR positive Klebsiella pneumoniae isolates harbouring the bla KPC gene. (Table 2)
DISCUSSION
Resistance to carbapenems is a worrisome international public health problem.2 Rapid detection of carbapenemase-producing Enterobacteriaceae is important both for taking effective precautions against the infection and for starting the appropriate treatment procedure.3 Polymerase chain reaction is considered the gold standard for carbapenemase gene identification, but it has some limitations. False-negative PCR results can occur due to a carbapenemase gene not tested in the PCR reaction, or mutations affecting the annealing of primers. False-positive PCR results can be due to the detection of inactive genes (with no carbapenemase expression). Such results can delay infection-control measures or, oppositely, initiate them when they are not required.10
Different phenotypic methods also have their shortcomings. The sensitivity and specificity of these tests vary depending on the bacterial species, enzyme type and expression level of the gene that codes for the enzyme or carbapenem resistance.3
In our study, we evaluated the performance of the mCIM (recommended by CLSI 2018) which is a simple test and has been seen to have better sensitivity and specificity than other phenotypic methods for the detection of carbapenemases.
The overall positivity of mCIM for Enterobacteriaceae and non-Enterobacteriaceae (Pseudomonas spp.) in our study was 88.7%. 11.3 % of our isolates that were resistant to meropenem by disc diffusion were mCIM negative which could be because of the various other
mechanisms of resistance in these isolates rather than carbapenemase production. It was observed that the detection of carbapenemases was high (92.7%) in the case of Enterobacteriaceae (Klebsiella pneumoniae and Escherichia. coli). The overall sensitivity of mCIM for Enterobacteriaceae is 93% to 100% in a study by Pierce VM et al. 4 In the case of Pseudomonas isolates, the positivity of mCIM in our study was 80%. In a study by Luiz F et al., the sensitivity of mCIM was 81% for Pseudomonas isolates.11 In another multicentric study by Simner PJ et al. the sensitivity of the mCIM for detection of carbapenemase-producing Pseudomonas isolates across 10 sites was found to be 98.0%.12 However in a comparative study by Howard JC et al. the sensitivity of mCIM was found to be only 71.4%.13
Since PCR is the gold standard test for the detection of carbapenemases, we compared the results of mCIM and conventional PCR in a separate group of blaKPC gene-positive and negative isolates of Klebsiella pneumonia. All the 20 blaKPC PCR positive isolates were positive by mCIM, thus giving a sensitivity of 100% for this gene. However, in the case of 15 blaKPC PCR negative isolates, 4(26.6%) were positive which indicates the presence of a carbapenemase other than KPC carbapenemase. Further 11(73.4%) blaKPC PCR negative isolates were negative by this test also because these could have a different resistant mechanism other than carbapenemase production (porin mutations, efflux pumps etc).
CONCLUSION
The mCIM was inexpensive, easy to perform and interpret, supported by the overall excellent reproducibility of the results in Enterobacteriaceae. Comparing with PCR it was found to be an accurate method for the identification of carbapenemase production in Klebsiella Pneumoniae isolates. This test also shows good reproducibility of the results in Pseudomonas isolates. Thus the test aids in the rapid and reliable identification of carbapenemase-producing carbapenem-resistant Enterobacteriaceae in microbiological laboratories and helps in understanding the local epidemiology of resistance to carbapenems, thus serving as one of the important tools to prevent the spread of these drug-resistant pathogens.
Acknowledgement: We thank the staff of the Department of Microbiology, SKIMS Srinagar for their support during the study.
Conflict of interest: The authors declare that the research was conducted in absence of any conflict of interest.
Ethical Clearance: Not Required
Source of funding: No financial support to declare.
Author`s contributions: Author Benazir Shazia designed the study, wrote the protocol and performed the laboratory methods. Author Bhat Asifa wrote the first draft of the manuscript, performed the laboratory methods and the literature searches. Author Fomda BA managed the analysis of the study. All the authors read and approved the final manuscript.
Englishhttp://ijcrr.com/abstract.php?article_id=4085http://ijcrr.com/article_html.php?did=40851. Jing X, Zhou H, Min X, Zhang X, Yang Q, Du S et al. The Simplified Carbapenem Inactivation Method (sCIM) for Simple and Accurate Detection of Carbapenemase-Producing Gram-Negative Bacilli. Front. Microbiol. 2018; 9:2391.
2..McMullen AR, Yarbrough ML, Wallace MA, Shupe A, Burnham C-AD. Evaluation of Genotypic and Phenotypic Methods to Detect Carbapenemase Production in Gram-Negative Bacilli. Clin Chem. 2017 Mar;63(3):723–30.
3. Serapsüzükyildiz, Banuka¸ Skatepe, Havvaavciküçük¸ Sükranöztürk. Performance of Carba NP and CIM tests in oxa-48 carbapenemase-producing Enterobacteriaceae. ActaMicrobiologica et Immunologica Hungarica 2017; 64:1,9–16.
4. Pierce VM, Simner PJ, Lonsway DR, Roe-Carpenter DE, Johnson JK, Brasso WB et al. Modified carbapenem inactivation method for phenotypic detection of carbapenemase production among Enterobacteriaceae. J Clin Microbiol. 2017;55:2321–2333.
5. Papagiannitsis CC, Studentova V, Izdebski R, Oikonomou O, Pfeifer Y, Petinaki E, Hrabak J. Matrix-assisted laser desorption ionization-time of flight mass spectrometry meropenem hydrolysis assay with NH4HCO3, a reliable tool for direct detection of carbapenemase activity. J Clin Microbiol 2015;53:1731–1735.
Efficacy of Modified Carbapenem Inactivation Method 10
6. Tamma PD, Opene BNA, Gluck A, Chambers KK, Carroll KC, Simner PJ. A comparison of eleven phenotypic assays for the accurate detection of carbapenemase-producing Enterobacteriaceae. J Clin Microbiol. 2017;55:1046-1055.
7. Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing.22nd informational supplement (M100-S28). Wayne, PA: CLSI; 2018.
8. Pragasam AK, Veeraraghavan B, Bakthavatchalam YD, Gopi R, Aslam RF. Strengths and limitations of various screening methods for carbapenem-resistant Enterobacteriaceae including new method recommended by clinical and laboratory standards institute: A tertiary care experience. Indian J Med Microbiol 2017;35:116-9.
9. Schechner V, Straus-Robinson K, Schwartz D, Pfeffer I, Tarabeia J, Moskovich R et al. Evaluation of PCR-based testing for surveillance of KPC-producing carbapenem-resistant members of the Enterobacteriaceae family. J Clin Microbiol. 2009 Oct;47(10):3261-5.
10. Tijet N, Patel SN, Melano RG. Detection of carbapenemase activity in Enterobacteriaceae: comparison of the carbapenem inactivation method versus the Carba NP test. J Antimicrob Chemother. 2015;71(1):274–276.
11. Lisboa LF, Turnbull L, Boyd DA, Mulvey MR, Dingle TC. Evaluation of a modified carbapenem inactivation method for detection of carbapenemases in Pseudomonas aeruginosa J Clin Microbiol 2018;56(1):e01234-17.
12. Simner PJ, Johnson JK, Brasso WB, Anderson K, Lonsway DR, Pierce VM et al. Multicenter Evaluation of the Modified Carbapenem Inactivation Method and the Carba NP for Detection of Carbapenemase-Producing Pseudomonas aeruginosa and Acinetobacter baumannii. J Clin Microbiol. 2017 Dec 26;56(1):e01369-17.
13. Howard JC, Creighton J, Ikram R, Werno AM. Comparison of the performance of three variations of the Carbapenem Inactivation Method (CIM, modified CIM [mCIM] and in-house method (iCIM)) for the detection of carbapenemase-producing Enterobacterales and non-fermenters. J. Glob. Antimicrob. Resist. 2020 Jun 1;21:78–82.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareFetus Papyraceous with Successful Outcome of Other Twin at Term
English140142Kandela NirmalaEnglish P. Yamini Shoba VaniEnglishIntroduction: In multiple gestations, Fetus papyraceous is a rare obstetric complication, the occurrence of which in twin cases is 1 in 12,500. It may be associated with elevated maternal and foetal complications, including death caused by disseminated intravascular coagulation and organ damage. Objective: To record a case of uniovular twin pregnancy in the early third trimester with one twin foetus papyraceous, and the pregnancy continued until term with a good outcome of co-twin survival. Method: A 25-year-old Gravida 2, Para 1, Living 1 woman with a previous usual vaginal delivery and twin pregnancy with Fetus papyraceous was referred to our hospital at 39 weeks for healthy institutional delivery. Results: She was admitted and induction of labour was done with the stripping of membranes and watched the progression of labour along with strict maternal and fetal monitoring. She was monitored by serial ultrasounds with doppler, coagulation profile throughout the pregnancy once the fetus papyraceous was diagnosed which was showing within normal limits. She delivered vaginally of an alive healthy male baby of birth weight 2.5kg with APGAR score- at 1min-8 and 5min-10. Conclusion: Routine ultrasound testing with improved training and the use of modern ultrasound machines with the good resolution is needed for the detection of multiple gestations. This would allow for early detection of papyraceous foetuses during pregnancy, potentially avoiding obstetric complications and lowering the risk of mortality.
English Fetus papyraceous, Uniovular twins, Third trimester, Obstetric complications, Maternal coagulopathy, Twin pregnancyINTRODUCTION
Fetus papyraceous ( the paper doll fetus ) is a desiccated or mummified fetus, without signs of maceration, that has been flattened by a twin fetus and lies within the membranes of the surviving twin.1Fetus papyraceous is a rare condition but in recent times, with the increase in Assisted Reproductive Techniques, the incidence of multiple pregnancies is rising, which in turn also increased the incidence of fetal papyraceous. The reported incidence of fetus papyraceous is one in 12,000 pregnancies compared to 1:190 in twin pregnancies.2
If a foetus papyraceous is diagnosed antenatally, the surviving foetus should be evaluated serially using sonography, biophysical profile, doppler, and maternal coagulation factors. Antenatal zygosity and chorionicity testing are recommended. The maturity of the foetus and the type of the placenta decide the timing and protocol for terminating a pregnancy with a surviving twin. In many cases of fetus papyraceous, there are no complications to the mother or the surviving twin. Expectant management with close maternal and fetal surveillance is advised.
There can be maternal complications like pre-eclampsia, Disseminated intravascular coagulation, Thrombotic thrombocytopenic purpura and fetal complications like Low birth weight babies, prematurity, Hypoxic-ischemic encephalopathy, during labour: the prolonged second stage of labour, arrest of descent. Other complications can be aplasia cuties, microcephaly, hydrocephalus, eye anomalies, cleft lip, cleft palate, cardiac anomalies.
CASE HISTORY
A 25-year-old Gravida 2, Para 1, Living 1 with previous normal vaginal delivery with twin pregnancy with Fetus papyraceous referred to our hospital at 39 weeks for safe institutional delivery and need of SNCU facility. She conceived spontaneously, her regular antenatal check-ups done in another hospital. According to her medical records, this pregnancy was monochorionic diamniotic twin intrauterine gestation with one twin fetus papyraceous at 22 weeks of gestational age. Her LMP was on 18.03.2020, EDD on 25.12.2020. Her first and second trimesters were uneventful. She was monitored by serial ultrasounds with doppler, coagulation profile throughout the pregnancy once the fetus papyraceous was diagnosed which was showing within normal limits.
She was admitted to our hospital on 21.12.2020. At the time of admission, she was conscious, coherent, cooperative. Her temperature is normal, pulse rate 86 per min, Bp-110/70 mmHg. Heart and lungs within normal limits. On per abdomen examination uterus was Term gestation, relaxed, cephalic presentation, FHS- 142/min regular, On per vaginal examination cervix soft, long, Os was 1.5-2 cm dilated
INVESTIGATIONS:
Her Hb-10.7gm%, TWBC-9700/cu mm, platelet-2.9lakh/cu mm, Blood
Group: B+ve, HIV, HbsAg, VDRL- nonreactive, Complete urine examination-within normal limits, Random blood sugar-89mg/dl, PT-11.6, APTT-30, On admission doppler study done it was normal, twin-1: cephalic presentation, placenta-Fundo posterior, liquor-adequate for twin-1, FHR-148/min, BPD-8.78cm, HC-33.87cm, AC-31.88cm, FL-7.04cm, GA-36 wks 4 days, weight-2812 grs, twin2: intrauterine demise, CRL-8.31cm corresponding to 14-16 wks.
PROVISIONAL DIAGNOSIS: Gravida2, Para1, Living1 with 39 wks 3 days with fetus papyraceous with previous vaginal delivery she was admitted and induction of labour done with stripping of membrane and watched the progression of labour along with strict maternal and fetal monitoring, delivered vaginally of an alive healthy male baby of birth weight 2.5kg with APGAR score- at 1min-8 and at 5min-10.
DISCUSSION:
If antenatal visits with obstetric ultrasound are not carried out, any condition is difficult to detect, so diagnosed several times only after delivery. It is possible to detect multifetal childbirth with Transvaginal Sonography as soon as 4 weeks after conception. It is not always possible to detect papyraceous foetuses by ultrasound testing in the late second and third trimesters. The papyraceous foetus results from the failure of early twin pregnancy to fully reabsorb the dead foetus, with preservation of the foetus for at least 10 weeks, resulting in mechanical compression of the tiny foetus and fluid loss to resemble parchment paper. It can occur in uniovular and binovular twins. Because of the high level of vascular contacts (85-95%) and TTTS in the monochorionic placenta, intrauterine death is three times more frequent in uniovular twins.3
The loss of one twin in the first trimester does not appear to affect the development of the surviving twin, but the loss of one twin after the mid-trimester may increase the risk of IUGR, cerebral palsy, preterm labour, preeclampsia, haemorrhage, sepsis, consumptive haemorrhage, labour dystocia, and perinatal mortality in the surviving twin.4
Placental or fetal analysis frequently reveals chromosomal abnormalities. Chromosomal analysis of the surviving twin is generally normal. If fetus papyraceous is diagnosed antenatally, close monitoring of both maternal and fetal is of utmost importance with ultrasonography, biophysical profile. Doppler of surviving fetus and maternal monitoring with coagulation profile. Our patient was continuously monitored by serial ultrasounds with Doppler study and coagulation profile throughout the pregnancy once the fetal demise of one twin was diagnosed and delivered vaginally at term with no maternal and fetal complications.
In Jain D, Purohit RC has reported three out of five pregnancies could be extended to term and had no maternal and fetal complications.5 In Dahiya et al have reported two cases of fetus papyraceous delivered at term with no complications to the surviving fetus.6
Preterm labour, infection from a retained foetus, extreme puerperal haemorrhage, consumptive coagulopathy, and obstruction by a low-lying foetus papyraceous causing dystocia leading to caesarean delivery are all examples of maternal complications. To avoid serious complications, it's important to get a diagnosis as soon as possible. It's important to reassure the patient that in the vast majority of cases, a normal outcome is anticipated. Consumptive coagulopathy in the mother as a result of a late foetal death is an unusual complication. The release of tissue thromboplastin from the foetal circulation into the mechanical circulation has been proposed as a mechanism to explain coagulopathy associated with IUFD.7,8 The maternal coagulation mechanism is believed to be stimulated by thromboplastin, resulting in intravascular consumption of clotting factors and platelets. Fibrinogen is broken down into fibrin degradation products (FDPs) and fibrin-fribin dimers as the activation of the fibrinolytic pathways increases (D-dimers). There are three types of foetal death complications depending on the gestational period, vanishing twin syndrome in the first trimester, foetus papyraceus in the second trimester, and the macerated twin in the third trimester. The majority of pregnancies end in death during the second trimester.9 The length of time between foetal death and delivery determines the degree of compression; the larger the foetus, the more difficult it is to become a foetus papyraceous.10 Twin-twin transfusion syndrome, membranous or velamentous cord insertion, true cord knot, cord stricture, placental insufficiency, and congenital defects are some of the causes of intrauterine death of one fetus.11,12
Close monitoring is of critical importance. The coagulation profile should be tested every 2 weeks, and ultrasound, biophysical profile, and Doppler should closely track the surviving twin's well-being. Before deciding to continue the pregnancy, any abnormalities in the surviving twin should be ruled out.13,14 Prompt diagnosis of foetus papyraceous is therefore very necessary for the prevention of further complications and the successful outcome of the survival of the foetus. It is really necessary to assure the parents. An unusual recorded complication is maternal consumptive coagulopathy due to the foetal death of a single twin.15,16
CONCLUSION:
All twin pregnancies with one fetal demise should be managed in tertiary care centres with good neonatal support. A management plan should be individualized, For successful pregnancy outcomes careful fetal and maternal monitoring is required. For the detection of multiple gestations, routine ultrasound testing with better training and the use of modern ultrasound machines with good resolution is necessary. This will enable early pregnancy to be diagnosed with papyraceous foetuses and could avoid potential obstetric complications and decrease the risk of mortality and morbidity for the surviving foetus.
ACKNOWLEDGEMENT
The authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.
Conflict of interest-Nil
Financial support-Nil
Englishhttp://ijcrr.com/abstract.php?article_id=4086http://ijcrr.com/article_html.php?did=4086
Daw EG. Fetus vanescens, fetus compressus and fetus papyraceus. J Obstet Gynecol. 1992;12(6):375-6.
Usharani N, Suyajna D, Joshi D, Veena. Fetus papyraceous: A rare case report and review of the literature. Int J Sci Study. 2015;3:184.
Rahman H, Pathak R, Dubey S. Fetus papyraceous in uniovular twin; death of one twin in the early third trimester and successful outcome of other twins at term: a rare case report. Gen Med(Los Angel)2013;1:118.
Sandhya G. Reshika G, Fetus Papyraceous in Monochorionic Diamniotic Twins. J Obstet Gynaecol India. 2019Apr;69(Suppl 1):4043.
Jain D, Purohit RC. Review of twin pregnancies with single fetal death: management, maternal and fetal outcome. J Obstet Gynecol India. 2014;64(3):180-183. doi: 10.1007/s13224-013-0500-5.
Dahiya P, Bains R. Conservative management of fetus papyraceous: a report of two cases. Oman Med J. 2014;29(2):132-134.
Finley BE. Acute coagulopathy in pregnancy. Med Clin North Am. 1989; 73: 723-43.
Weiner AE, Reid DE, Roby CC, Diamond LK. Coagulation defects with intrauterine death from Rh are sensitization. Am J Obstet Gynecol 1950:60: 1015-22.
Daw E. Fetus papyraceus—11 cases. Postgrad Med J. 1983;59(695):598-600.
Benirschke K. Intrauterine death of a twin: Mechanisms, implications for surviving twin, and placental pathology. Semin Diagn Pathol 1993;10(3):222-31.
Akbar M, Ikram M, Talib W, Saeed R, Saeed M. Fetus papyraceous: the demise of one twin in the second trimester with the successful outcome of the second twin at term. Professional Med J. 2005;12:351-3.
Benirschke K. Intrauterine death of a twin: Mechanisms, implications for surviving twin, and placental pathology. Semin Diagn Pathol 1993;10(3):222-31.
Akbar M, Ikram M, Talib W, Saeed R, Saeed M. Fetus papyraceous: the demise of one twin in the second trimester with the successful outcome of the second twin at term. Professional Med J. 2005;12:351-3.
Hagay ZJ, Mazor M, Leiberman JR, Biale Y. Management and outcome of multiple pregnancies complicated by the antenatal death of one fetus. J Reprod Med 1986; 31(8): 717- 720.
Ong SS, Zamora J, Khan KS, Kilby MD. The prognosis for the co-twin following single-twin death: A systematic review. BJOG 2006;113(9):992-8.
Novak CM, Patel SV, Baschat AA, Hickey KW, Petersen SM. Maternal coagulopathy after umbilical cord occlusion for twin reversed arterial perfusion sequence. Obstet Gynecol. 2013 Aug;122(2 Pt 2):498-500.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareMagnitude of Polytrauma Injury Due to Motorised Two-Wheeler Vehicles Road Traffic Accident in Tertiary Care Trauma Centre
English143148Shukla ArvindEnglish Sheikh ZafarEnglish Ahirwar TanujEnglishIntroduction: Poly-trauma injury due to Two Wheelers road traffic accidents is emerging as an epidemic worldwide. Aims: Study the magnitude of poly-trauma injury due to Two Wheelers driver’s road traffic accident. Effect of use of the helmet in pattern and severity of injuries. Effects of alcohol intake on incidence and severity of injuries. Methodology: This was a prospective-epidemiological study. Study of 250 polytrauma patients (two-wheeler driver) admitted at the trauma centre, M.G.M. medical college and M.Y. Hospital Indore. All patients aged >18 years with a history of polytrauma injury due to road traffic accidents were included in the study. Results: GCS score was significantly higher in helmet users. Fewer helmet users had an AIS ≥3 over the head/neck, face, thorax, and extremities, compared with without helmet users. A lower Injury Severity Score was also observed in motorcyclists with helmet use. When analyzing four subgroups of trauma patients, the Patient wears a helmet and alcoholic (n=21) compare with the Patient not wear a helmet and alcoholic (n=97) Glasgow Coma Scale relationship (p-value EnglishInjury Severity Score, Abbreviated injury scale, Polytrauma, Trauma, Road Traffic Accident, Two-wheeler accidentINTRODUCTION
Road traffic accident represents a leading cause of death and permanent disability.1 such severely injured patients are termed as ‘polytrauma patients’. ‘Polytrauma’ is defined as having at least two severe injuries in different body regions that are potentially life-threatening. The severity of trauma is typically indicated by the Injury Severity Scores (ISS). 2
India has experienced a very rapid population increase from 48 million to 1.2 billion over the last five decades.3 Road transport is vital for growth because it provides mobility for both people and goods. It also exposes people to the chance of road accidents, injuries, and fatalities.4 Exposure to an adverse traffic climate is high in India due to the unparalleled pace of motorization and increasing urbanization fuelled by high economic process rates.5
Motorcycle accidents are a major cause of head injury. Evidence exists to suggest that the use of helmets can reduce the risk and occurrence of both head injuries and death due to motorcycle accidents, and in turn reduce hospitalization and morbidity.6
An important means of increasing the wearing of helmets in low- and middle-income countries is legislation; where helmet-wearing rates are low and a large number of people use motorized two-wheelers. In most low- and middle-income countries, especially in Asia, a motorbike is the common vehicle for the family. Helmet use among motorcycle road users is low. Young motorcycle users, in particular, are generally less likely to wear a helmet than those who are older.7
Impairment by alcohol is a crucial factor influencing both the danger of a road crash also because of the severity of the injuries that result from crashes. The frequency of drinking and driving varies between countries but it's almost universally a significant risk factoring for a road traffic crash. In many high-income countries, about 20% of fatally injured drivers have excess alcohol in their blood (i.e., above the legal limit). Studies in low-income countries have shown alcohol to be presented in between 33% and 69% of fatally injured drivers.8
MATERIAL AND METHODS -
This was a prospective-epidemiological study of polytrauma patients admitted at Trauma centre, M.G.M. Medical College and M.Y. Hospital Indore, M.P.
Study period- November 2018 to July 2020.
Sample size- 250 patients of polytrauma admitted at the trauma centre, M.G.M. Medical College and M.Y. Hospital Indore.
Inclusion Criteria -
1. All patients (two-wheelers driver) with polytrauma injury due to road traffic accident.
2.Patients > 18 years.
3. Patients or attender’s who give written informed consent.
Exclusion Criteria -
1. All patients where the mode of road traffic accident was not due to Two wheelers or not known.
2. Patients under the age of 18 years were excluded from the study as Abbreviated Injury Scale (AIS) and Injury Severity Score (ISS) perform differently in paediatric trauma patients compared to adult patients.
Written consent was obtained from the patient or attendant. A comprehensive history was taken from the Patient or the attendant and a questionnaire was filled for every patient. A set protocol was made for the management of polytrauma patients and the patient was evaluated according to it. ethical clearance number-EC/MGM/JUNE-19/07
Simple, rapidly manoeuvred’s, such as the administration of intravenous fluids, endotracheal intubation, and compressive dressings on sites of active emergency on the arrival of patients to trauma centre done.
Resuscitation primary priorities-
Airway
Breathing
Circulation - Haemorrhage control
Exposure of the patient
Examination
After resuscitation required investigations were performed:
Complete Blood Count, coagulation studies, blood type, and blood cross-match (if indicated). Urinalysis, urine toxicological screen, and Serum electrolyte values, creatinine level, and glucose values are often obtained for reference. Lipase or amylase level. Imaging studies (USG, X-RAY, CT Scan, MRI etc.)
Demographic data extracted included, gender, and age. Given the quantity and diversity of injuries, the motorcyclists presented with injuries were grouped into categories. Once categorized, the injuries were sorted into one among six body regions: head and neck, face, chest, abdomen, extremities (including pelvic girdle), and external body to align with regional AIS (anatomical score) scoring parameters and to permit comparison of regional injury frequency with severity. ISS (anatomical score) was categorized as mild (Englishhttp://ijcrr.com/abstract.php?article_id=4087http://ijcrr.com/article_html.php?did=40871. Ringburg, AN. Prevalence and prognostic factors of disability after major trauma. J. Trauma - Inj. Infect. Crit. Care.2011;70: 916–922.
2. Lefering R. Trauma score systems for quality assessment. Eur. J. Trauma. 2002;28:52–63.
3. Gupta, A, Gupta, E. Challenges in organizing trauma care systems in India. Indian J. Community Med.2009;34: 75–76.
4. Https://www.who.int/violence_injury_prevention/publications/road_traffic/helmet_manual.pdf. Helmets?: a road safety manual for decision-makers and practitioners.2006.
5. Https://nimhans.ac.in/wp-content/uploads/2019/02/UL_BR_b007_Summery-rprt.pdf. Advancing road Implementation is the key.
6. Liu, B. C. Helmets for preventing injury in motorcycle riders. Cochrane Database Syst. Rev.2008. doi:10.1002/14651858.CD004333.pub3.
7. Peden TT. Road safety. Youth road safety. 1. Accidents, Traffic – Prev. Control. 2. Wounds Inj. – Prev. Control. 3. Safety. 4. Adolescent. 5. Child. I.World Heal. Organ. ISBN 92 4 159511 6 (NLM Classif. WA 275) ISBN 978 92 4 159511 7 123–166 (2013) doi:10.1201/b16346.
8. Krug EG. Risk factors for road traffic injuries. Am J Public Heal. 2000; 9(23): 523–526 .
9. Jat AA. Peer Review Audit of Trauma Deaths in a Developing Country. Asian J Surg. 27, 58–64 (2004).
10. Menon A. Pattern of fatal head injuries due to vehicular accidents in Mangalore. J. Forensic Leg. Med.2008;15, 75–77.
11. Ward, R. E. Effects of ethanol ingestion on the severity and outcome of trauma. Am. J. Surg. 1992;144, 153–157.
12. Jurkovich GJ. The Effect of Acute Alcohol Intoxication and Chronic Alcohol Abuse on Outcome From Trauma. JAMA J. Am. Med. Assoc.1993;270: 51–56.
13. Hooten KG. Helmeted vs nonhelmeted: A retrospective review of outcomes from 2-wheeled vehicle accidents at a level 1 trauma center. Clin. Neurosurg. 2012;59: 126–130.
14. Sosin DM. Head Injury—Associated Deaths From Motorcycle Crashes: Relationship to Helmet-Use Laws. JAMA J. Am. Med. Assoc. 1990;264: 2395–2399.
15. Kraus JF. The Effect of the 1992 California Motorcycle Helmet Use Law on Motorcycle Crash Fatalities and Injuries. Am. Med. Assoc. 1994;272: 1506–1511.
16. Hotz GA. The impact of a repealed motorcycle helmet law in Miami-dade county. J. Trauma. 2002;52, 469–474.
17. Muller A. Florida’s Motorcycle Helmet Law Repeal and Fatality Rates. Am J Public Health. 2004;94: 556–558.
18. Notes N. Commentary: Motorcycle helmet law repeal: When will we learn ? or truly care to learn? Ann. Emerg. Med. 2006;47: 204–206.
19. Vaca F. Evaluation of the repeal of motorcycle helmet laws. Ann. Emerg. Med.2001;37, 229–230.
20. Vaca F. Motorcycle helmet law repeal - A tax assessment for the rest of the United States? Ann. Emerg. Med. 2001;37: 230–232.
21. Regel, G. MD. Treatment Results of Patients with Multiple Trauma: An Analysis of 3406 Cases Treated between 1972 and 1991 at a German Level I Trauma Center. 1995;38(1):70–78. doi:PMID 7745664.
22. Kumar Arvind MD. An epidemiological survey of fatal road traffic accidents and their relationship with head injuries. Indian J. Neurotrauma (IJNT).2005;5(2): 63–67 (2008).
23. Atri M. Chest trauma in Jammu region an institutional study. Indian J. Thorac. Cardiovasc. Surg. 200622, 219–222.
24. Anarase S. Clinical Profile of traumatic abdominal injuries?: Cross-sectional study at the tertiary care centre. 2019;11: 35–37.
25. Mubashir A. Non-Fatal Limb Injuries in Motorbike Accidents. J. Coll. Physicians Surg. Pakistan 2008,18: 635–638.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareEffect of Lower Limb Exercises on Core Muscles in Functional Activities in Low Back Pain Subjects
English149153Kotteeswaran KEnglish Veluri REnglish Neelamegan AEnglish Shalini SEnglishIntroduction: Low back pain is a common health problem in human beings and about 5 to 15% will develop low back pain (LBP). The clinical Findings of LBP suggest that lumbar mobility is decreased and the recruitment order of core muscles is altered. In the literature, there is no data about the effect of core muscle strengthening in the chronicity (short duration, long duration) of LBP. Aim: To find the effectiveness of lower limb exercises on core muscles in subjects with low back pain in reducing pain and improving functional activities. Methods: 30 patients with low back pain were selected based on the inclusion and exclusion criteria. The subjects were divided into two groups namely Group-A & Group-B with 15 subjects in each group. Group-A subjects received Lower Limb Exercises and Interferential therapy, Group-B subjects received Traditional low back Exercises and Interferential therapy. The outcome measures are the Numerical pain rating scale (NPRS) and Oswestry disability index (ODI). The statistics of this study all the values were tabulated and statistically analyzed by using paired and unpaired t-test. Result: Student t-test analysis revealed a significant difference (pEnglishCore muscle, Lower limb exercises, Traditional low back exercises, Functional activities, Low back painINTRODUCTION
Low back pain is one of the commonest musculoskeletal disorders, affecting up to 90% of people at some point in their lifetime. Up to 50% will have more than one episode of back pain.1 Low back pain (LBP) is not a specific disease, rather it is a symptom.
Low back pain is a common disorder involving the muscles, nerves, and bones of the back which affects nearly 60-80% of people throughout their lifetime. The prevalence rate of low back pain is reported to be high as 84%, and studies have quoted that 11-12% of the population is being disabled by low back pain. A precise cause of mechanical back pain can be identified in only 5-15 % percent of the time and the exact cause cannot be identified in 85-95% of the population.
Back pain is widely categorized into 2 types namely mechanical & non-mechanical. Mechanical pain is the general term that refers to any type of back pain caused by placing abnormal or increased or altered biomechanical stress over the stable spine. The high endurance muscles over the low back and core muscles and ligaments surrounding the spine provide the best protection against low back pain.3
The contraction of core muscles associated with the movement of the lower limb has been shown to contribute to the maintenance of the position of the center of mass over the base of support and the stability of affected joints.4 Agreeing with this model, several authors have identified contraction of the rectus abdominal muscle and the erector spinal muscle in advance of upper-limb flexion and extension.5 This muscle activity, occurring before or shortly after the onset of activity of the prime mover of the limb, is referred to as feed-forward because it cannot be initiated by feedback from the limb movement.6 Recent evidence indicates that the lumbar multifidus muscle (MF)7 and transversus abdominis muscle (TrA) may be involved in controlling spinal stability. Importantlyfound that the transversus abdominis muscle contracted before the other abdominal muscles when the trunk was loaded by applying a weight ventrally to a harness over the shoulders.8
Studies have evaluated only the feed-forward muscular response to the upper-limb movement.9 Due to the anatomical proximity and functional interrelationship between the hip and spine.10 However, we evaluated the movement of the lower limb for a more appropriate investigation of the lumbar spine. But it has been studied that the evaluation of lower limb movement in a standing position is complex because the body is required to deal with two distinct challenges to postural equilibrium. The body deals with this challenge by shifting the weight over the other leg before the movement of the limb.11
In the 1990s, intensive strengthening exercises were highlighted.12 More recently, new evidence demonstrating the effect of the segmental stabilizing exercises has been emerging. The approach of the segmental stabilizing exercise is considerably different from the traditional strengthening exercises.13
The Core Strength below can be utilized as a preventative rehabilitation program or if you are recovering from an injury. The program includes a strengthening section that should be done 3-4 times a week. The “core” is comprised of several groups of muscles including the transversus abdominus, multifidus, diaphragm and pelvic floor muscles and their primary function is to work together to produce maximum stability in the abdominal and lumbar back region, as well as coordinate the movement of the limbs and spine. Therefore, it is important to learn how to effectively co-contract these muscles while performing these rehabilitation exercises.
The traditional physiotherapy modalities used for the management of low back pain include Interferential Therapy, Transcutaneous electrical nerve stimulation, short wave diathermy, ultrasound and the exercise program selected for the rectus abdominus and oblique abdominal muscles. Interferential therapy is an electrotherapeutic modality used to treat pain. Interferential Therapy decreases musculoskeletal pain by increasing circulation, promoting efflux of pain-inducing chemicals from the site and bye gate control therapy.
The Oswestry Disability Index (ODI) is an index derived from the Oswestry Low Back Pain Questionnaire used by clinicians and researchers to quantify disability for patients with low back pain.14 The self-completed questionnaire consists of components like the intensity of pain, lifting, ability to care for oneself, ability to walk, ability to sit, sexual function, ability to stand, social life, sleep quality and ability to travel. Each question is scored on a 5 point Linkert scale with the first level indicating the least amount of disability and the last level is scored 5 indicating the most severe disability. The scores for all questions answered are summed and multiplied to obtain the index ranging from 0 to 100.
MATERIALS AND METHODS
The study was conducted in Saveetha Medical college, Physiotherapy outpatient department, with study design as a Quasi-Experimental study after obtaining approval from the Institutional ethical committee (029/02/2017/IEC/SU). Sampling method as systematic random sampling and a sample size of 30 subjects divided into two groups with 15 subjects in each group. subjects were included in the study based on the inclusion criteria as Both males and females are diagnosing back pain with an age of 18 to 40 years and subjects were excluded from the study if there was any (a) History spinal surgeries, (b) Deformities of spine and lower limb pathology, (c) Tuberculosis (TB) spine patients, (d) If they were treated due to other neurological problems, (e) They had acute inflammation, tumours and (f) if there were pregnant.
PROCEDURE
According to the inclusion and exclusion criteria before the study, the principal researchers explained the procedure to all the subjects and informed consent was obtained, using systemic random sampling30 subjects will be selected from Physiotherapy – outpatient department and will be allocated into two groups namely control and experimental group 15 subjects in each group. After recruitment on eligibility, informed consent will be obtained on explaining the treatment to be given. Group A experimental group - is treated with lower limb exercises combined with interferential therapy and it is termed as the experimental group. Group B control group is treated with traditional low back exercises combined with interferential therapy. The pain was measured on the Numerical pain rating scale (NPRS) and low back pain disability was assessed by the Oswestry disability index (ODI). The values were
considered as the pre-test. After 4 weeks of treatment again pain is measured using the Numerical pain rating scale (NPRS) and low back pain disability is assessed using the Oswestry disability index (ODI) and the values obtained were considered as post-test values.
GROUP-A: - Lower Limb Exercises15 subjects were included in this group and each subject was positioned on the treatment table. The interventional exercises given to this group are Bilateral straight leg raising, Dead bug, Prone flutters, Bird dog using 1kg weight cuffs, Pelvic bridging, Side plank and Knee hug.
Bilateral straight leg- raising: -
Patient position: Patient is supine lying with the hips at 50 degrees and knees extended using with 1Kg weight cuff on both sides and lift leg bilateral.
Bird Dog
Bird Dogs are an excellent way to strengthen multiple muscles in the core. They not only target the abdominals but also challenge erector spinae along the spine, glutes.
Patient position: Activate your stomach muscles by getting onto your hands and knees so your low back flattens like a tabletop. Without allowing your pelvis to tilt, lift the opposite arm and leg in the air with a 1kg weight cuff until each is fully extended. hold the position for 5 to 10 seconds and repeat with the opposite limbs.
Dead Bug
This exercise targets the abdominal muscles to maintain core stability.
Patient position: While lying on your back, lift both legs in the air and bend your hips and knees to 90-degree. Squeeze your stomach muscles and instruct patients to keep their backs flat against the ground. Now gradually straighten one leg in the air using with 1kg weight cuff as you raise the alternate arm overhead. Then repeat with the opposite arm and leg.
Prone Flutters
This exercise challenges the multifidus muscles in the low back which is referred to as the primary stabilizer of the spine.
Patient position: Lie on your stomach with arms extended overhead. Lift right arm and left leg simultaneously in the air and use with 1kg weight cuff. Repeat with the opposite arm and leg.
Pelvic bridging
Bridges activate several different core muscles including your gluteus maximus and transversus abdominus.
Patient position: The patient is in the hook-lying position, have the patient press the upper back and feet into the mat, elevate the pelvis, and extend the hips.
Side Plank
Side planks target the oblique muscles and the gluteus Medius, an important core muscle on the side of the pelvis.
Patient position: Lie on the right side with knees straight and legs stacked on top of each other. With the right elbow positioned under the shoulder, lift the body off the ground until the spine is straight and hold this position for 5 to 10 seconds. Repeat the exercise on the left side.
Knee hug
Patient position: Lie on back with legs extended and back straight. Keep hips level and lower down on the floor. Bend both knees and hugs the knees towards the chest, placing hands on the back of the thigh.
GROUP-B: Traditional low back exercises: 15 subjects were included in this group and each subject was positioned on the treatment table. The interventional exercises given to this group are traditional low back exercises.
These exercises are done and training up to four weeks with 10 seconds (Hold & Relax) 10 repetitions maximum of each exercise, 3 sessions a week for four weeks. Interferential therapy patients of both groups were administered interferential therapy for 3 sessions a week for four weeks. The duration of the treatment is 15 minutes. The placement of the electrode is in the low back region.
Outcomes measures are Numerical pain rating scale (NPRS) and Oswestry disability index (ODI) was taken before the intervention and after the end of the 4th week and considered as pre & post values. Statistically, results were obtained.
STATISTICAL ANALYSIS
The collected data was analyzed using descriptive and inferential statistics. To all parameters mean and standard deviation (SD) were used. Paired t-test was used to analyze significant changes between pre-test & post-test measurements. An unpaired t-test was used to analyze significant changes between the two groups.
RESULTS
The statistical analysis made with the quantitative data revealed a significant difference between pre-test and post-test values of the Numerical Pain Rating Scale (NPRS) and Oswestry disability index (ODI)
Pre-test and Post-test values of Group A
The pre-test mean value of NPRS is 8.20 with a standard deviation of 0.86 and the post-test mean value of NPRS is 2.40 with a standard deviation of 0.51, this shows that NPRS scores are gradually increasing with the P-value (Englishhttp://ijcrr.com/abstract.php?article_id=4088http://ijcrr.com/article_html.php?did=4088
Arya RK. Low back pain –signs, symptoms, and management.J Int Ass. Curr Med. 2014;15(1):30-41.
Leon Chaitow. muscle Energy Techniques. 2010. 2nd edition, 44-55.
Venu Akuthota, Scott F. Nadler. Core strengthening. Arch Phys Med Rehab. 2004;85(3):86-92.
Bouisset S, Zattara M. A sequence of postural adjustments precedes voluntary movement. Neurosci Lett.1981;22:263-270.
Friedli WG, Hallet M, Simon SR. Postural adjustments associated with rapid voluntary arm movements. Journal of neurology, neurosurgery and psychiatry. 1984;47:611-622.
Aruin AS, Latash ML. Directional specificity of postural muscles in feed-forward postural reactions during fast voluntary arm movements. Exp Brain Res. 1995; 103:323-332.
Wilke HJ, Wolf S, Claes LE. Stability increase of the lumbar spine with different muscle groups: a biomechanical in vitro study.Spine. 1995; 20:192-198.
Cresswell AG, Ckundstrom H, Thorstensson A. Observations on intra-abdominal pressure and patterns of abdominal intra-muscular activity in man. Acta Physiol Scand.1992;144:409-418.
Belen'kii V, Gurfinkel VS, Paltsev Y. Elements of control of voluntary movements. Bzojzika. 1967; 12: 135-141.
Paquet N, Malouin F, Richards CL. Hip-spine movement interaction and muscle activation patterns during sagittal trunk movements in low back pain patients. Spine.1994;19:596-603.
Mouchnino L, Autrey R, Massion J, Pedotti A. Coordination between equilibrium and head-trunk orientation during leg movement: a new strategy built up by training. J Neurophysiol.1992;67:1587-1598.
Carpenter DM, Nelson BW. Low back strengthening for the prevention and treatment of low back pain. Med sci Sports Exerc. 1999;31:18-24.
Richardson A, Snjider C. The Relation Between the Transversus Abdominus Muscles, Sacroiliac Joint Mechanism and low back pain. Spine. 2002; 27: 399-405.
Fairbank JCT, Couper J, Davies JB, O'Brien JP. The Oswestry low back pain disability questionnaire. Physiotherapy. 1980; 66:271-3.
Deepali sheth, James Ghagare. Variation in beliefs towards low back pain between physiotherapy and nursing students. Int J Curr Res Rev. 2018;10(9):11-14.
Jorge P. Fuentes, Susan Armijo Olivo, David J M Agee, Douglas P. Gross. Effectiveness of Interferential Current Therapy in the management of musculoskeletal pain: A Systematic Review and meta-analysis. Phys Ther. 2010;90(9):1219-38.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareKAP Survey Regarding Clinical Research Among Medical Undergraduates in a Tertiary Care Teaching Hospital
English154160Vemuri Veena RaniEnglishBackground: Clinical research is necessary for the advancement of better health care. Training in clinical research forms a very important part of medical education. This starts in the second MBBS with an introduction to the basics of clinical research as per their syllabus. To date, very few surveys were done on the knowledge, attitude, perception, and practice of Second MBBS students about clinical research. A Knowledge Attitude Practices survey helps reveal misconceptions regarding the subject chosen. Methodology: After ethics committee approval, a prevalidated questionnaire was administered as a Google Form to the second MBBS students and, data were analyzed using descriptive statistics on Microsoft Excel. Results: Out of 104 students who were sent the questionnaire 89 answered, with a response rate of 85.59%. Knowledge was tested with 10 questions of which 5 were multiple choice and 5 were yes or no response. Knowledge was found to be moderate with a mean percentage score of 55.9%. Perception of the students towards clinical research was found to be a positive one overall, with 10 questions out of 12 having a mean above 3. Only 67.42% of students were aware of the presence of an Institutional Ethics Committee. Conclusion: There is a positive attitude towards clinical research and moderate knowledge but, there are still some misconceptions that can be corrected with structured intervention with aspects of ethical research and also by involving more undergraduate students in minor research projects.
EnglishKAP, Second MBBS, Clinical research, Undergraduates, Clinical trials, SurveyIntroduction
Training in clinical research constitutes a very essential part of medical education. For a Medical student, research can be mandatory, elective, or extracurricular1. Charles Best was a medical student when he with the help of his supervisor, Frederick Banting, discovered insulin. Paul Langerhans a medical student proved that insulin is secreted by pancreatic islets of Langerhans. Alan Hodgkin won the Nobel Prize in 1972 in biomedical research work on nerve transmission which was done as an undergraduate.1 Research experience can provide a boost to the career of medical students1. In India, undergraduates are not much involved in clinical research though it forms a mandatory part of post-graduation medical courses. Knowledge on the history of clinical trials and the importance of trials in the development of better health care need to be emphasized at the undergraduate level. It is essential to inculcate reasoning skills and to develop a positive attitude amongst students towards scientific research from the beginning of their medical career. 2 Clinical trials are important for the future practising physician, to perform and present their research and also to select the relevant articles for evidence-based medicine, which directly or indirectly contributes to the advancement of the health care system. (GCP) Good clinical practice awareness is equally important in budding young clinical investigators. The Exposure to terms and explanations regarding the clinical trials begins with the second MBBS curriculum. There are basics of clinical research in the Pharmacology syllabus along with different types of clinical trials and evidence-based medicine and its importance. The students during their time in the second MBBS are encouraged to take up some research projects. This is done as they are considered the next generation of doctors. However, there are a smaller number of studies done on the second-year MBBS students regarding their attitude, perception, and practices of clinical research3. Assessment of their Knowledge regarding the clinical research, overall attitude on research and practise is essential for timely intervention if any misconceptions surface. There is an increase in research as seen in India since the Covid19 pandemic spreading in the country and the requirement of better research into the treatment modalities available.
A Knowledge, Attitude, and Practices (KAP) survey is a quantitative method that provides access to quantitative and qualitative information.4 KAP surveys reveal misconceptions or misunderstandings and potential barriers to behaviour change.4
The present study was therefore undertaken to help in the assessment of the medical students’ knowledge and attitude towards clinical research using this method.
Aims and Objectives: To evaluate the Knowledge, Attitude, Practices towards clinical research in medical undergraduates in a tertiary care teaching hospital.
Methodology: A questionnaire was developed after an online literature search of previously done similar studies. The Questionnaire contained 28 questions divided into four parts -
(1)The demographic data like age, sex, and year of study was part of the questionnaire and entered as Categorical values
(2) Questions for evaluation of Knowledge were scored as 1 for correct answer and 0 for the wrong answer. These were 10 in number, out of which 5 were multiple-choice questions and 5 were seeking a Yes or No response
(3) There were 12 questions related to Perception towards the trials and the answers to these were sought in a 5 point Likert scale from strongly agree (5) to strongly disagree(1), The questions on perception of clinical research were selected as both positive and negative statements and Likert scale was accordingly modified.
(4) The questions related to attitude as a future clinician and research scientist were three in number. These were meant to know whether they would take part in clinical trials as a doctor or as a volunteer. The questions for evaluating knowledge were mainly based on the syllabus which is taught to the students during their lectures. Two questions were added to know the interest of the students in general regarding the history of clinical trials.
The questionnaire was not designed to quantify the overall knowledge of the student, more to gauge their minimum understanding of clinical trials and whether they are aware of trials happening in their institute. After taking the requisite permissions from the Institutional ethics committee, a Cross-sectional survey with the developed pre-validated questionnaire was conducted in Terna Medical College, Nerul, in September 2020. The period was chosen to guarantee that the students had exposure to not only the lectures on clinical research but also to the patients and treatment options available in the Hospital. The questionnaire was administered to 104 students of the second MBBS as a Google form. Validation was done by a discussion with the senior faculty of the department and an online literature search of similar types of studies. The students were informed that the participation was voluntary and that confidentiality will be maintained.
Statistical Analysis
The collected data was entered into the Microsoft Office Excel software and was tabulated in percentage and frequency. The data was analyzed mainly as mean and Standard deviation (SD) and for categorical variables, analysis was done as percentages.
Results
A total of 104 Second MBBS students were administered the questionnaire and the overall response rate was 85.58 % (N = 89). Of the 89 respondents, 45(50.56%) were male and 44 (49.44%) Female. The distribution of the age group of the respondents is seen in figure 1.
The focus of the study was mainly perception of research and overall, the students had a positive attitude towards clinical research which can be seen in table 1, as the mean above 3 is seen for 10 questions. 43 students (48.31%) were neutral to the statement regarding the perception about the results of clinical research being genuine. This can be taken as a negative perception towards clinical research as these students were not ready to commit themselves to either agree or disagree. 41 (46.06%) students were neutral to the statement regarding the patients gaining more from clinical research, this can be considered more as a negative perception than a positive one as they are not able to decide. However, 97.75% of the students agreed that clinical research provides better health care for patients. 47% of the students felt that the pharmaceutical industry gains financially from clinical research yet all the students agreed that clinical research is necessary for new drug development. 97.75 % of the students agreed that confidentiality is an important aspect of clinical research. To the statement that research should be done on animals rather than humans 32(35.95%) of the students were neutral and 29 (28.09%) of the students disagreed with this statement. These two figures when combined in total 61(68.54%) students disagreed that the use of animals was better instead of humans for clinical research.
In table 2, regarding the students’ attitude towards clinical research as a future clinician/researcher, 88(98.9%) of the students were ready to take care of patients who are involved in clinical research, but only 54(60.67%) were ready to volunteer as a patient in clinical research.
The basic knowledge of clinical trials was assessed as part of the questionnaire. Out of 89 students, 32 students scored 70% and above and 70 students scored 50% and above. The mean percentage score was 55.9%, the knowledge was moderate. Table 3 has all the questions asked to test the basic knowledge and awareness of the students regarding clinical research. Of the 5 multiple choice questions only one question, question number 4, was answered wrongly by 41(46.07%) students. It is a significant number since the question is important as it is required to know who is included in the special population. The awareness of the students regarding the history of clinical research and the importance of GCP guidelines of clinical research is good (60 students (67.42%)). Only 60 students (67.42%) of the students were aware that there is an Ethics committee in their institute.
Discussion
A Second-year medical graduate is aware of the theoretical aspect of clinical trials as it is part of their pharmacology syllabus. They start forming their opinions accordingly. A few of them may already be interested in student research projects and some may conduct clinical trials in the future. This study helps in gauging their attitude towards medical research and helps in understanding any misconceptions.
Although several studies were done on the attitude of medical students regarding clinical research, most of them were on post-graduate students. The second-year MBBS is the year when the students get exposed to clinical research in their curriculum and therefore, they start forming opinions regarding the same. The knowledge of clinical research and how it has evolved during the years to include the principles of confidentiality, consent, and autonomy of the patient as well as beneficence is important to understand how to approach ethical research. In the survey, the students were found to have a moderate knowledge of clinical research with a mean percentage score of 55.9% which was slightly better than that of a similar study conducted by Khan H et al.,2006, on Pakistani medical undergraduate students knowledge was found to be moderate, mean percentage score was 49%. 5 However, that study was conducted on a greater number of students and involved different years of MBBS students, and they found that there was an increase in the knowledge with an increase in the number of years of medical college. The study done previously in Kalaburagi, Gulbarga institute of medical education by Priyadarshini et al., 2017,7 which was an intervention conducted about clinical research followed by a KAP study on the third-year MBBS students had shown a positive attitude of the students and an increase in their knowledge after the intervention.7 Attitude wise this was reflected in our study also, except when it was about the results of the clinical research being genuine. Since these students are still in the second MBBS and considerably less exposed to the research and the clinical subjects as well, there are some misconceptions expected regarding the clinical research being done in the health care setup. This can be remedied by timely intervention and encouraging them to take up small research projects as a structured mentorship program.In a study conducted on medical undergraduate students by Alaa Althubaiti in 2014, in Saudi Arabia where there is a structured Medical Research Program(MRP) the second-year MBBS students were expected to submit their research proposals and had a supervisor to help them through the activities.8 They found that the second-year medical students were more interested in choosing clinically-oriented projects, were less satisfied with the Medical Research Programme and the author was of opinion that there can be more interdisciplinary projects, to increase the students’ interest in research 8. A similar setup in our medical colleges might improve the interest in research among medical undergraduates. The inclusion of research work in medical education can promote physicians' use of evidence-based medicine and their involvement in clinical trials. A study conducted in southern India by Saraschandraet al., 2014, on medical students found that the majority of medical students (72.5%) expressed interest in being a part of the research team of the institution and publish their research.9
In a study conducted by Rajashree N.et al., 2019, among the resident doctors, 60% of students have an interest in training in biomedical research10. In a similar study conducted by Madhavrao C et al., 2016, in Kulasekharam, medical postgraduates gave 50% correct responses for all questions based on knowledge of principles of research indicating they had good knowledge of the principles of research, which could be because the resident doctors are expected to attend the research methodology workshop and also because most of them by then is expected to start a research project.11 Similar findings were also noted by Pawar et al., 2012, in Mumbai, they evaluated the awareness about medical research among resident doctors in tertiary care hospitals, 58% of the residents had the conceptual knowledge of research hypothesis, 76% received adequate training in research but only 4% published the research work in various journals and 50% were engaged in carrying out research other than their dissertation work.12 Our study was conducted on the second MBBS students and they are the future resident doctors, the attitude found now can be changed and when they become resident doctors there are chances that more students will be doing research other than their dissertation. Good training is known to always improve the awareness and skill of medical students and help them develop a positive attitude towards research.
There are several limitations of the study. The knowledge regarding clinical research and its history is too vast. Using only ten questions may not be enough. However, if the questionnaire becomes too lengthy the students’ responses may become limited and the answers become more through random guessing. The perception towards the clinical research is positive among the students as of now, developing this is crucial since it can help them in undertaking a research project by themselves now or in the future. The questions regarding the perception could have contained more negative statements to balance the positive ones. The study population could have included the third MBBS students and interns also to get a better understanding of the change in attitude towards research.
Conclusion
The study was trying to learn the perceptions of second MBBS students towards clinical research and found that there is a positive attitude in general but there are still some misconceptions regarding published results of the clinical research. These misconceptions can be corrected by a structured intervention with aspects of ethical research and also by involving more students in minor research projects to help them understand the methodology. There is a necessity of conducting regular workshops on research methodology and also start mentoring system for the same. The limitations of the study were that the third MBBS students and interns were not involved if this can be done then a better picture of the changing attitude can be understood. This can help increase the interest and participation of medical students in clinical research.
Financial Support
The author received no financial support for the research, authorship, and/or publication of this article.
Author’s Contribution
The author was involved in the conception and design of the research, data collection, data analysis and interpretation, drafting the article and critical revision as well as final approval of the version to be published.
Conflict of Interest
The author declares that there is no conflict of interest.
Acknowledgements
The author would like to thank all the medical undergraduate students for taking the time to fill out the form and submit it. The author acknowledges the immense help received from the scholars whose articles are cited and included in references of this manuscript. The author is also grateful to authors/editors/publishers of all those articles, journals from where the literature for this article has been reviewed and discussed.
Englishhttp://ijcrr.com/abstract.php?article_id=4089http://ijcrr.com/article_html.php?did=4089
Metcalfe D., Involving medical students in research, J R Soc Med. 2008;101(3):102-3.
Vodopivec, Ana Vujaklija, Maja Hrabak, Ivan Kres?imirLukiæ, AnaMarus?iæ, MatkoMarus?iæ, Knowledge about and Attitude towards Science of First-Year Medical Students, Croat Med J 2002, 43, pg. 58-62
Sandeep Sachdeva, Neha Taneja, Nidhi Dwivedi Knowledge, attitude and practices studies conducted amongst medical students of India, Int J of CMed and Pub H, September 2018;5(9):3913-3918
KAP survey model (Knowledge Attitudes and Practices).pdf,https://www.spring-nutrition.org/publications/tool-summaries/kap-survey-model-knowledge-attitudes-and-practices, accessed in December 2019.
Khan H, Khawaja MR, Waheed A, Rauf MA, Fatmi Z. Knowledge and attitudes about health research amongst a group of Pakistani medical students. Bio-Med Cen Med Edu. 2006;6(54):1-7.
Aslam F, Shakir M, Qayyum MA: Why Medical Students Are Crucial to the Future of Research in South Asia, PLoS Med. 2005;2: 11:1110-1111.
Priyadarshini M. Deodurg, Harish G. Bagewadi, B.V. Patil, Asha P. Dass, Knowledge, attitude & perceptions of 3rdterm medical students towards clinical trials in a medical college in southern India, Ind Jof Phar and Pharmac, July-Sep. 2017; 4 (3):125-129.
Althubaiti A., February 2015, Undergraduate Medical Research Programme: A Cross-Sectional Study of Students' Satisfactions, Perceived Challenges, and Attitudes. Glo J of HSci.2010;7(5):117–123.
Saraschandra Vallabhajosyula, Ranjitha S Shetty, Suma Nair, Knowledge, Attitude and Practice towards Medical Research among Students of a Medical College in Southern India, J of Res in Med Edu& Eth, July 2014; 4(2):220-225
Rajshree N. Mandhare, Venkatesh V. Khadke, Saleem B. Tamboli, (November 2019)Knowledge, attitude and practices towards medical research among resident doctors at a tertiary care hospital, Int J of Basic& Clin P. 2017; 8(11):2517 – 2522
Madhavrao C., Mythili Bai K., Rema Menon N., Sharath Babu K., Prathab Asir A. Knowledge, Attitude and Practices towards principles of research among medical postgraduates in a teaching tertiary care centre, Int J Cur Res Rev.2006; 8(2):1-6.
Pawar DB, Gawde SR, Marathe PA. Awareness about medical research among resident doctors in a tertiary care hospital: A cross-sectional survey. Per in Clin Res.2012; 3(2): 57–61.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareA Panorama of the Applications of Midazolam in Dentistry and Recent Advances
English161166Jason ASDEnglish ManishaEnglish Samuel VAEnglishThe prevalence of dental fear is ubiquitous and so is the need; to remove fear and anxiety. Depression of the individual’s consciousness during the treatment aids tremendously in a positive patient outcome. It also contributes to a better overall oral health of the community. All the sedative agents of old have either caused more harm than good or failed in their effectiveness. With the introduction of midazolam in1975 sedation has not only become safe but also highly effective. Midazolam acts by enhancing the activity of the GABA receptors in the central nervous system. Alongside the sedative effect, the drug shows anxiolytic, muscle relaxant, anticonvulsant, hypnotic and amnesic properties. Literature supports the use of midazolam as an emergency drug for seizures, for conscious sedation and as a part of the pre-anaesthetic medication. Midazolam has been used extensively to achieve positive behaviour in children undergoing dental therapy. Certain side effects have been reported with the use of this drug. With modern delivery systems such as Mucosal Atomization Device (MAD), the rapidity of onset of the drug is enhanced along with a reduction of the dose. This review article stands as a testimony to the use of midazolam in dentistry.
EnglishDental Fear, Anxiety, Midazolam, Sedation Dentistry, Conscious Sedation, Mucosal Atomization DeviceINTRODUCTION
Fear is an unpleasant feeling often caused due to the awareness of danger or hurt.1The most pragmatic way to define fear is as the neurophysiological processes that prepare an organism to perform innate or learned responses to cope with danger.2,3Dental fear has been a significant contributor to the evasion of dental health care.4,5,6
Anxiety precedes fear, wherein anxiety occurs before the presence of a stimulus that, more often than not, is threatening.7,8Anxiety alters reality which leads to patients experiencing a change in the quality of pain perceived by them and instils an everlasting pain-tinted dental experience.9 the dentist has to identify the aspects of the dental setting which would likely aggravate the anxiety, the need for the current appointment and the previous dental experiences of the patient.7,10,11The components of pharmacological anxiolysis include sedation and general anaesthesia.12Factors to be considered are the risks of the pharmacological management versus benefit, selection of the appropriate drug, the level of anxiety, dentist’s expertise, presence of equipment and emergency care.13
Sedation is defined as the use of a drug or combination of drugs to depress the central nervous system, thus reducing patients’ awareness of their surroundings.14Conscious sedation has been employed as a means to remove fear and anxiety from dental care and it is considered of paramount importance. Anxiolysis is a drug-induced state during which patients respond normally to verbal commands.15,16It is mandatory to note that the use of conscious sedation should be taken bearing the patient’s thorough medical and dental history. Barbiturates were a few of the earliest sedative agents used for conscious sedation. With the introduction of benzodiazepines (Midazolam), conscious sedation included anxiolysis along with profound amnesia. They are considered the gold standard in sedation and are regarded as very safe drugs.17
The dentist must alleviate the anxiety and fear as it can cause exhaustion post-treatment and a ripple in the normal facets of one’s daily activities including personal, social interactions and sleep deprivation.18,19Midazolam as a sedative has made a significant contribution towards conscious sedation. A plethora of studies backs midazolam in terms of efficiency, ease of administration and safety. This article provides a meticulously prepared agglomerate of the scientific literature with regards to the use of midazolam for conscious sedation in dental practice.
HISTORY
The need for the removal of fear and pain from the dental office has existed as long as the existence of the art of dentistry. In the 15th century ether was used as the first anaesthetic agent alongside, a distillate of sulphuric acid and diethyl ether called ‘sweet oil of vitriol’ which was widely used in dentistry.20The 17th century saw the discovery of nitrous oxide by Joseph Priestley. Humphrey Davy commented on the uses of nitrous oxide in surgeries and its potency in alleviating pain.21The first benzodiazepines were created by Hoffmann-La Roche and Leo Sternbach in 1955. Diazepam (Valium) was discovered a little later but grew very famous. Molecular changes were made to meet the demands and also counteract any undesirable quality.22Midazolam was created in 1975 by Walser and Fryer.23
CHEMICAL STRUCTURE
Midazolam is a water soluble, crystalline yellow to white salt.24The IUPAC name for midazolam hydrochloride is 8-chloro-6-(2-fluorophenyl)-1-methyl-4H-imidazo[1,5-a][1,4]benzodiazepine hydrochloride and the molecular formula is C18H13ClFN3 • HCl.25 In low pHthe salt is hydrophilic and has an open diazepine ring which closes shut at high pHto form the physiologically active lipophilic product as in Figure 1.It has a molecular weight of 325.8 g/mol.24
MECHANISM OF ACTION
Midazolam is a short-acting benzodiazepine with pharmacological uses such as anxiolytic, amnestic, muscle relaxant and sedative uses.26The mechanism of action of midazolam as a sedative is based on its effect on the GABA (gamma-aminobutyric acid) receptors. It works by enhancing the affinity of the GABA to the GABA receptor.21GABA is a major inhibitory neurotransmitter present in the central nervous system.27Benzodiazepines do not have a direct agonistic activity on GABA rather it has a boosting effect on the action of GABA.26The GABA receptors are classified into GABAa and GABA receptors. GABAa receptors have subtypes α1 and α2. Of these α1 subtype mediates sedation, anti-convulsant and amnesia activity while the α2 subtype mediates anxiolysis and muscle relaxation. They do not act on GABA receptors.
Midazolam has both hydrophilic and lipophilic properties depending on the pH of the solution. When midazolam is absorbed it has to bio transform through both the microsomal oxidation and glucuronide conjugation. First, it gets hydroxylated with the help of cytochrome CYP3A4, CYP3A5.28Through the hydroxylation process two pharmacologically active agents namely, α-hydroxymidazolam and 4-hydroxymidazolam are formed. They undergo rapid glucuronide conjugations to form pharmacologically inactive compounds.29Midazolam gets bounded to the plasma protein and is well distributed.30
PHARMACOKINETICS
Absorption
Midazolam is available in its salt form which is hydrophilic and maintains its hydrophilicity at a low pH. The oral midazolam tablet often stays hydrophilic due to the low pH in the stomach. With the change in pH in the gastrointestinal tract to the physiological pH, the ring structure of midazolam closes forming the lipophilic form.31Midazolam is absorbed through the gastrointestinal tract following oral administration, with peak effect 30-90 minutes after administration. Owing to the first pass metabolism only 40-50% of the administered dose reaches circulation.32Midazolam has shown rapid onset and increased bioavailability of 90% through the intramuscular route.33The intranasal route of administration has shown superiority in the onset duration and ease of use when compared with the oral route.34It is important to consider the painless quality of the intranasal route compared to the intramuscular and the intravenous routes.35
Distribution
Midazolam distribution is higher among obese people as it gets distributed to the adipose tissue. The volume of distribution has been found to be 1-2.5 l/kg.36The distribution is greater in women compared to men.37Midazolam has a good affinity to plasma proteins and is mostly bound to them only about 4% of the given dosage is available as free faction.38
Elimination
Metabolites of midazolam in the form of α-hydroxymidazolam and glucuronide conjugate are excreted by the kidney through urine. Almost all of the midazolam gets conjugated, less than 0.5% gets excreted unchanged. The plasma clearance seemed to increase in patients in supine position owing to the 40-60% increase in the hepatic blood flow.24
PHARMACODYNAMICS
The action of midazolam in the body is chiefly based on its highly sedative potency. Besides its sedative nature, it has antiepileptic properties, acts as a muscle relaxant and causes anterograde amnesia. Once the effect wears off, the patient’s cognitive and psychomotor skills are retained.37Minimal cardiovascular changes are evoked by this drug. Midazolam could decrease vascular resistance.39Midazolam causes an increase in the frequency of respiratory rate with a decrease in tidal volume.40It leaves the cortisol and renin responses unaltered during surgical stress. It preserves the blood flow to the brain and myocardium while reducing flow to the liver and kidneys.41
SIDE EFFECTS
Midazolam like any other drug is a slave to the side effects it manifests. The side effects are cardiac arrest, heart rate variations, a fall in blood pressure, convulsions, anaphylaxis, thrombosis, laryngospasm, bronchospasm, respiratory depression, gastrointestinal changes, xerostomia, hiccups, increased appetite, jaundice, drowsiness, confusion, dysarthria, urinary retention or incontinence, blood disorders, muscle weakness, visual disturbances including diplopia, salivation changes, skin reactions along with any skin changes in the intravenous route injection site. When given through the intranasal route, midazolam is known to produce a burning sensation, irritation to the nasal mucosa and lacrimation.24,25,42 When taken orally there is a delay in onset and there is no IV access for a reversal agent in case of overdose.43
DRUG INTERACTION
Drug interactions between midazolam and other drugs are chiefly governed by the cytochrome P450 oxidase system in the liver where midazolam gets metabolized. Drugs such as cimetidine, ranitidine, omeprazole, macrolides and oral contraceptives inhibit the metabolism of midazolam causing reduced clearance and increased half-life.36,44,45 Rifampin is a cytochrome P450 enzyme inducer that increases the clearance of midazolam.46
DISCUSSION
Midazolam has shown anxiolytic, sedative, muscle relaxant, anticonvulsant, hypnotic and amnesic properties which can be exploited in the dental setting.26,47, 48, 49
Midazolam as an emergency drug in the dental office
Seizures are commonly encountered in the dental office with a worldwide prevalence of 0.5-0.9% The management of epilepsy is achieved through the depression of the central nervous system which could be achieved with benzodiazepines.50Midazolam has been included in the additional emergency drugs for the management of dental emergencies.51,52The muscle relaxant property of midazolam has been exploited in the rapid sequence intubation for establishing a patent airway in the emergency department in dosage of 0.1mg/kg.53,54Besides these the property of amnesia, anxiolysis and sedation play their role in making midazolam a must-possess emergency drug.27,55
Midazolam as a pre-anaesthetic agent in the pediatric population
Children in the initial stage of anaesthesia could experience unpleasantness, have anxiety and suffer from separation from parents leading to hypersalivation, breath-holding and laryngospasm.56Besides these, there could be traumatic experiences deeply rooted in the child’s mind from the induction room.57, 58
Midazolam is chosen as a pre-anaesthetic medication as it is predictable and has good patient acceptance. It is consistent and has few side effects which are the ideal characteristics of a premedicament.59Various drug dosages have been tried by various authors when using midazolam as a pre-anaesthetic agent.60 The most effective dosage and safest dose for children has been identified as 0.75mg/kg considering the age and weight of the child.61
Midazolam in conscious sedation
Conscious sedation in dentistry plays a major role in achieving a positive psychological effect on the patient while also preserving the consciousness and the responsiveness to verbal commands.7Midazolam is one of the most commonly used benzodiazepine drugs.62 In conscious sedation, the consciousness of the patient remains uncompromised as compared to general anaesthesia and deep sedation; hence it provides a wide margin of safety.15
A few reported disadvantages of nitrous oxide inhalation include expensive equipment, patients should breathe through their nose and interference of nasal mask with maxillary injection techniques.63 Chronic exposure to nitrous oxide showed devastating effects on the health of the dental personnel. It could decrease the fertility of female doctors and assistants and cause a 1.7 fold increase in liver disease among men. Midazolam for conscious sedation is available in various routes such as oral, intravenous and intranasal.64 Oral midazolam is the go-to technique among the pediatric population. A 0.5 mg/kg dosage is given 20 minutes before the procedure which causes significant anxiolysis and results in a more positive environment.65 Besides, midazolam causes anterograde amnesia changing the postoperative perspective of the patient towards dental treatment.66
Studies indicate intravenous midazolam given at 0.06mg/kg dosage produced adequate anxiolysis. The onset was significantly faster. 5 minutes post-administration the effects of sedation started to manifest. The children administered IV midazolam showed lesser movement in-between treatments, cried less and mostly fell asleep during the entire procedure.67 The intranasal route has the benefits such as a large surface area of the nasal mucosa and the drug escapes the first-pass metabolism. Though various anatomic, physiologic and drug characteristics play a major role in the absorption one of the most important criteria is that the drug needs to be lipophilic for absorption to occur through the mucosa.68 Literature claims the intranasal route to be effective in terms of ease of use and reduced duration of onset with a dosage of 0.3-0.5mg/kg.69-73
The intranasal use of midazolam has been enhanced with the introduction of MAD® (Mucosal Atomization Device, Wolfe Tory Medical Inc., Salt Lake City, UT, USA) Figure 2. The MAD® atomizes the drug into particles of 30-100 microns. Particles this small are readily absorbed through the nasal mucosa. The soft plug gives a neat seal, reducing the run-off. The procedure is painless and less cumbersome compared to the other injection techniques.74The use of this spray has proven to be more efficient in terms of acceptability and the induction of sedation compared to intranasal drops and the oral route.75,76 The use of such a device is explicit in the emergency setting and to attain anxiolysis before diagnostic scans chiefly due to the ease of administration and quick onset.74,77
CONCLUSION
Of the many challenges that confront the dentist, the obliteration of fear from the dental setting proves fit to test the mettle of the dentist. Midazolam has made sedation easy for patients and dentists alike. Midazolam is very safe for use in the pediatric population, where the need to remove fear is even more important to develop a positive attitude in children, which would drastically improve their overall oral health. With the introduction of newer technologies, the figments of painless, fearless dentistry have come closer to reality.
ACKNOWLEDGEMENT
The authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.
SOURCE OF FUNDING
Not applicable as there is no source of funding
CONFLICT OF INTEREST
The authors declare no conflict of interest.
AUTHOR’S CONTRIBUTION
Samuel VA conceptualized the work. Data collection was carried out by Jason ASDand Manisha. The article was drafted by Jason ASD with support from Manisha and Samuel VA. Critical revision of the article was done by Manisha and Samuel VA. The final approval of the version of the article to be published was done by Samuel VA.
Englishhttp://ijcrr.com/abstract.php?article_id=4090http://ijcrr.com/article_html.php?did=4090
Webster's third new international dictionary of the English language. 10th ed. Springfield (Massachusetts): Merriam-Webster; 2002 Fear; p. 924
Keifer OP Jr, Hurt RC, Ressler KJ, Marvar PJ. The Physiology of Fear: Reconceptualizing the Role of the Central Amygdala in Fear Learning. Physiology (Bethesda). 2015;30(5):389-401.
Adolphs R. The Biology of Fear. Curr Biol. 2013;23(2): R79-93.
Pohjola V, Lahti S, Vehkalahti MM, Tolvanen M, Hausen H. Association between dental fear and dental attendance among adults in Finland. Acta Odontologica Scandinavica. 2007;65(4):224-30.
Ramakrishnan M, Banu S, Ningthoujam S, Samuel VA. Evaluation of knowledge and attitude of parents about the importance of maintaining primary dentition - A cross-sectional study. J Family Med Prim Care. 2019 Feb;8(2):414-8.
Ravikumar D, Gurunathan D, Karthikeyan S, Subramanian E, Samuel VA. Age and Environment Determined Children's Preference Towards Dentist Attire - A Cross-Sectional Study. J Clin Diagn Res. 2016 Oct;10(10): ZC16-9.
Appukuttan D. Strategies to manage patients with dental anxiety and dental phobia: a literature review. Clin CosmetInvestig Dent. 2016;8:35-50
Diagnostic and Statistical Manual of Mental Disorders. DSM-III. American Psychiatric Association: Washington, D.C.1980. Psychol Med 1981;11(1):215.
Weisenberg M, Aviram O, Wolf Y, Raphaeli N. Relevant and irrelevant anxiety in the reaction to pain. Pain. 1984;20(4):371-83.
Jöhren P, Jackowski J, Gängler P, Sartory G, Thom A. Fear reduction in patients with dental treatment phobia. Br J OralMaxillofac Surg. 2000;38(6):612-6.
Sharna N, Ramakrishnan M, Samuel V, Ravikumar D, Cheenglembi K, Anil S. Association between Early Childhood Caries and Quality of Life: Early Childhood Oral Health Impact Scale and Pufa Index. Dent J. 2019;7(4):95.
Folayan M, Faponle A, Lamikanra A. A review of the pharmacological approach to the management of dental anxiety in children. Int J Paediatr Dent. 2002;12(5):347-54.
Newton T, Asimakopoulou K, Daly B, Scambler S, Scott S. The management of dental anxiety: time for a sense of proportion?. BrDentJ 2012;213(6):271-4.
Morita T., Tsuneto, S., Shima Y. Definition of sedation for symptom relief: a systematic literature review and a proposal of operational criteria. J Pain Symptom Manag. 2002:24(4), 447-53.
An Updated Report by the American Society of Anesthesiologists Task Force on Sedation and Analgesia by Non-Anesthesiologists. Practice Guidelines for Sedation and Analgesia by Non-Anesthesiologists. Anesthes. 2002 Apr 1;96(4):1004–17.
Holroyd I. Conscious sedation in pediatric dentistry. A short review of the current UK guidelines and the technique of inhalational sedation with nitrous oxide.Paediatr Anesth. 2008 Jan;18(1):13-7.
Lauven PM. Pharmacology of Drugs for Conscious Sedation. Scand J Gastroenterol. 1990 Jan 1;25(sup179):1–6.
Cohen S, Fiske J, Newton J. The impact of dental anxiety on daily living. Br Dent J. 2000;189(7):385-90.
Moore R, Brodsgaard I. Dentists' perceived stress and its relation to perceptions about anxious patients. Community Dent Oral Epidemiol. 2001;29(1):73-80.
Robinson DH, Toledo AH. Historical development of modern anaesthesia. J Invest Surg. 2012 Jun;25(3):141-9.
Haridas RP. Horace Wells’ Demonstration of Nitrous Oxide in Boston: Anesthesiology. 2013 Nov;119(5):1014–22.
Wick JY. The History of Benzodiazepines. Consult Pharm. 2013 Sep 1;28(9):538–48.
Walser A, Flynn T, Fryer RI. Quinazolines and 1,4-benzodiazepines. LXXXV syntheses of 3-substituted lmidazo[1,5-a] [1,4]benzodiazepines. J HeterocyclChem. 1978;15(4):577–83.
PubChem [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004-. PubChem Compound Summary for CID 4192, Midazolam; [cited 2021 Apr. 8].
Sabarathinam S, Vijayakumar TM. RP-hplc method development and validation of midazolam: A cyp3a4 probe drug. ResJPharmTechnol. 2020;13(8):3565-8
Richter JJ. Current Theories about the Mechanisms of Benzodiazepines and Neuroleptic Drugs: Anesthesiology. 1981 Jan;54(1):66–72.
Braestrup C, Squires RF. Brain-specific benzodiazepine receptors. Br J Psychiatry. 1978 Sep;133:249–60.
Wandel C, Böcker R, Böhrer H, Browne A, Rügheimer E, Martin E. Midazolam is metabolized by at least three different cytochrome P450 enzymes. Br J Anaesth. 1994 Nov;73(5):658–61.
Heizmann P, Eckert M, Ziegler WH. Pharmacokinetics and bioavailability of midazolam in man.Br J Clin Pharmacol. 1983;16 Suppl 1:43S-9S.
Olkkola KT, Ahonen J. Midazolam and Other Benzodiazepines. Modern Anesthetics. Berlin, Heidelberg: Springer Berlin Heidelberg.HandbExpPharmacol. vol. 182.; 2008. p. 335–60.
Burstein AH, Modica R, Hatton M, Forrest A, Gengo FM. Pharmacokinetics and Pharmacodynamics of Midazolam After Intranasal Administration. J Clin Pharmacol. 1997 Aug;37(8):711–8.
Kanto JH. Midazolam: the first water-soluble benzodiazepine. Pharmacology, pharmacokinetics and efficacy in insomnia and anaesthesia. Pharmacotherapy. 1985 Jun;5(3):138–55.
Taylor JW, Simon KB. Possible intramuscular midazolam-associated cardiorespiratory arrest and death.Drug Intell Clin Pharm. 1990 Aug;24(7–8):695–7.
Musani I, Chandan N. A comparison of the sedative effect of oral versus nasal midazolam combined with nitrous oxide in uncooperative children. EurArch Paediatr Dent. 2015;16(5):417-24.
Li A, Yuen VM, Goulay-Dufaÿ S, Sheng Y, Standing JF, Kwok PCL, et al. Pharmacokinetic and pharmacodynamic study of intranasal and intravenous dexmedetomidine. BrJ Anaesth. 2018;120(5):960-8.
Nordt SP, Clark RF. Midazolam: A review of therapeutic uses and toxicity. J Emerg Med. 1997 May 1;15(3):357–65.
Dundee JW, Halliday NJ, Harper KW, Brogden RN. Midazolam. Drugs. 1984 Dec 1;28(6):519–43.
Reves JG, Fragen RJ, Vinik HR, Greenblatt DJ. Midazolam: pharmacology and uses. Anesthesiology. 1985 Mar;62(3):310–24.
Boralessa H, Senior DF, Whitwam JG. Cardiovascular response to intubation. A comparative study of thiopentone and midazolam. Anaesthesia. 1983 Jul;38(7):623–7
Power SJ, Morgan M, Chakrabarti MK.Carbon dioxide response curves following midazolam and diazepam.Br J Anaesth.1983 Sep;55(9):837–41
Daneshmend TK, Jackson L, Roberts CJ. Physiological and pharmacological variability in estimated hepatic blood flow in man. Br J Clin Pharmacol. 1981;11(5):491–6.
Kowalczuk J. British National Formulary for Children 2005. Qual Saf Health Care. 2006 Feb;15(1):76.
Papineni McIntosh A, Ashley PF, Lourenço-Matharu L. Reported side effects of intravenous midazolam sedation when used in paediatric dentistry: a review. Int J Paediatr Dent. 2015 May;25(3):153–64.
Olkkola KT, Aranko K, Luurila H, Hiller A, Saarnivaara L, Himberg JJ, et al. A potentially hazardous interaction between erythromycin and midazolam. Clin Pharmacol Ther. 1993;53(3):298–305.
Abernethy DR, Greenblatt DJ, Divoll M, Arendt R, Ochs HR, Shader RI. Impairment of diazepam metabolism by low-dose estrogen-containing oral-contraceptive steroids. N Engl J Med. 1982 Apr 1;306(13):791–2.
Ohnhaus EE, Brockmeyer N, Dylewicz P, Habicht H. The effect of antipyrine and rifampin on the metabolism of diazepam.Pharmacol Ther. N Engl J Med .1987:42: 148-56.
Kupietzky A, Houpt MI. Midazolam: a review of its use for conscious sedation of children. Pediatr Dent. 1993 Aug;15(4):237–41
Bergman SA. The Benzodiazepine Receptor.Anesth Prog.1986;33(5):213–9.
Greenblatt DJ, Shader RI, Abernethy DR. Drug therapy. Current status of benzodiazepinesN Engl J Med. 1983 Aug 18;309(7):410–6.
Turner MD, Glickman RS. Epilepsy in the Oral and Maxillofacial Patient: Current Therapy. J Oral Maxillofac Surg. 2005 Jul;63(7):996–1005.
Haas DA. Emergency drugs. Dent Clin North Am. 2002 Oct;46(4):815-30.
Haas DA. Management of Medical Emergencies in the Dental Office: Conditions in Each Country, the Extent of Treatment by the Dentist.Anesth Prog. 2006;53(1):20–4.
Wroblewski BA, Joseph AB. Intramuscular midazolam for treatment of acute seizures or behavioural episodes in patients with brain injuries.JNeurol Neurosurg Psychiatry. 1992 Apr;55(4):328–9.
Sagarin MJ, Barton ED, Sakles JC, Vissers RJ, Chiang V, Walls RM; National Emergency Airway Registry Investigators. Underdosing of midazolam in emergency endotracheal intubation. Acad Emerg Med. 2003 Apr;10(4):329-38.
Malinovsky JM, Populaire C, Cozian A, Lepage JY, Lejus C, Pinaud M. Premedication with midazolam in children. Effect of intranasal, rectal and oral routes on plasma midazolam concentrations. Anaesthesia. 1995;50(4):351–4.
De Soto H. The Pediatric Anesthesia Handbook. Anesthesiology. 1997 Nov 1;87(5):1266.
Mathai A, Nazareth M, Raju RS. Preanesthetic sedation of preschool children: Comparison of intranasal midazolam versus oral promethazine.Anesth EssaysRes. 2011;5(1):67–71.
Kain ZN, Hofstadter MB, Mayes LC, Krivutza DM, Alexander G, Wang SM, et al. Midazolam: Effects on Amnesia and Anxiety in Children. Anesthesiology. 2000 Sep;93(3):676–84.
Coté CJ, Cohen IT, Suresh S, Rabb M, Rose JB, Weldon BC, et al. A comparison of three doses of a commercially prepared oral midazolam syrup in children.Anesth Analg. 2002 Jan;94(1):37–43.
Kaviani N, Shahtusi M, Haj Norousali Tehrani M, Nazari S.. Effect of Oral Midazolam Premedication on Children’s Co-operation Before General Anesthesia in Pediatric Dentistry.JDent(Shiraz). 2014 Sep;15(3):123–8.
McMillan CO, Spahr-Schopfer IA, Sikich N, Hartley E, Lerman J. Premedication of children with oral midazolam. Can J Anesth. 1992 Jul;39(6):545–50.
Finder RL, Moore PA. Benzodiazepines for intravenous conscious sedation: agonists and antagonists. Compendium. 1993 Aug;14(8): 976-80.
Mohan R, Asir VD, Shanmugapriyan, Ebenezer V, Dakir A, Balakrishnan, et al. Nitrous oxide as a conscious sedative in the minor oral surgical procedure. J Pharm Bioallied Sci. 2015 Apr;7(Suppl 1): S248–50.
Howard WR. Nitrous oxide in the dental environment: assessing the risk, reducing the exposure. J Am Dent Assoc. 1997 Mar;128(3):356–60.
Wan K, Jing Q, Zhao JZ. Evaluation of oral midazolam as conscious sedation for pediatric patients in oral restoration. ChinMed Sci J. 2006 Sep;21(3):163–6.
Twersky RS, Hartung J, Berger BJ, McClain J, Beaton C. Midazolam enhances anterograde but not retrograde amnesia in pediatric patients. Anesthesiology. 1993 Jan;78(1):51–5.
Tyagi P, Tyagi S, Jain A. Sedative effects of Oral Midazolam, Intravenous Midazolam and Oral Diazepam in the Dental Treatment of Children. J Clin Pediatr Dent. 2013 Apr;37(3):301–6.
Grassin-Delyle S, Buenestado A, Naline E, Fairy C, Blouquit-Laye S, Couderc LJ, et al. Intranasal drug delivery: An efficient and non-invasive route for systemic administration: focus on opioids. Pharma col Ther.2012 Jun;134(3):366–79.
Peerbhay F, Elsheikhomer A. Intranasal Midazolam Sedation in a Pediatric Emergency Dental Clinic. Anesth Prog 2016;63(3):122-30.
Lee-Kim SJ, Fadavi S, Punwani I, Koerber A. Nasal versus oral midazolam sedation for pediatric dental patients. J Dent Child (Chic). 2004 May-Aug;71(2):126-30.
Özen B, Malamed SF, Cetiner S, Özalp N, Özer L, Altun C. Outcomes of moderate sedation in paediatric dental patients. AustDentJ. 2012;57(2):144-50.
Malinovsky JM, Lejus C, Servin F, Lepage JY, Le Normand Y, Testa S, et al. Plasma Concentrations Of Midazolam After I.V., Nasal Or Rectal Administration In Children. Br J Anaesth. 1993;70(6):617-20.
Kogan A, Katz J, Efrat R, Eidelman LA. Premedication with midazolam in young children: a comparison of four routes of administration. Pediatr Anesth. 2002;12(8):685-9.
Corrigan M, Wilson SS, Hampton J. Safety and efficacy of intranasally administered medications in the emergency department and prehospital settings.Am JHealth-SystPharm. 2015 Sep 15;72(18):1544–54.
Primosch RE, Guelmann M. Comparison of drops versus spray administration of intranasal midazolam in 2 and 3-year-old children for dental sedation.Pediatr Dent J. 2005 Oct;27(5):401–8.
Fallahinejad Ghajari M, Ansari G, Soleymani AA, Shayeghi S, Fotuhi Ardakani F.Comparison of Oral and Intranasal Midazolam/Ketamine Sedation in 3?6-year-old Uncooperative Dental Patients. J Dent Res Dent Clin Dent Prospects. 2015;9(2):61-5.
Hollenhorst J, Münte S, Friedrich L, Heine J, Leuwer M, Becker H, et al. Using Intranasal Midazolam Spray to Prevent Claustrophobia Induced by MR Imaging. Am J Roentgenol. 2001;176(4):865-8.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareProtective Effect of Citrus reticulata and Citrus Sinensis against Diabetes Associated Alzheimer's Disease: Identification of a Better Model
English167178Navya RYEnglish Madhuri DEnglish Chandrasekhar KBEnglishBackground: Stress became a global challenge that leads various chronic diseases especially neuro-degeneration diseases such as Alzheimer’s disease. Polyphenolic compounds were reported to possess protective effects against the cellular stress and can be used in the management of stress associated chronic diseases. Objectives: Our current work is aimed to design a better model to induce Alzheimer’s disease through Diabetes and to screen the protective effect of Citrus reticulata and Citrus sinensis against diabetes-associated Alzheimer’s disease. Methods: A comparative study was carried out on Streptozotocin - Nicotinamide induced Diabetes and High fat diet-induced Diabetes. Various biochemical, behavioural and histological parameters are considered to evaluate the best model for the diabetes-induced Alzheimer’s disease along with the protective effect of selected Citrus reticulata (Tangerine oil) and Citrus sinensis (Orange oil) against diabetes-associated memory deficits. Results: Results showed that the high-fat diet model succeeded to create diabetes-associated memory impairment compared to Streptozotocin - Nicotinamide model. Detailed investigation of all the selected parameters of Tangerine and Orange oil groups by comparing with a standard group showed statistically significant (p>0.0001) improvement in the Alzheimer’s disease. Conclusion: To conclude, all the biochemical, behavioural and histological data declared that the high-fat diet model is the best model for studying diabetes-associated memory deficits in animals. It is also apparent that the oil of Citrus sinensis is more potent than Citrus reticulata to give protection against oxidative stress and subsequent improvement of memory and other physiological parameters. The antioxidant property of the oils may be responsible for the reported activity.
EnglishDiabetes, Alzheimer’s disease, Animal model, Citrus sinensis, Citrus reticulataINTRODUCTION
Alzheimer’s disease (AD) is one of the most prevailing causes of death in the elderly population. Reports have suggested that by 2050, more than 11 crores of the world population would be suffering from AD. 1 One of the most common risk factors for AD is Diabetes Mellitus. Studies have also forecasted that by 2050, more than 33 crores population of the world would suffer from Diabetes. Among them, more than 7 crores population will be in India. Since AD and Diabetes are interlinked, the present study was carried out to find out a mono therapeutic approach for both AD and Diabetes. 2 Antioxidants provide ameliorating effect against degenerative disorders. Since natural antioxidants are comparatively safer than synthetic ones, we employed extracts from the peels of citrus fruits as they are rich in antioxidants and also one of the widely consumed fruits. 3 The flavonoids of citrus fruits especially polymethoxyflavones have wide therapeutic activity and are abundantly found in Citrus sinensis (sweet orange) and Citrus reticulata (mandarin oranges). 4,5 The present study was also designed to develop a better model to induce Alzheimer’s disease through Diabetes. A comparative study was therefore carried out on Streptozotocin - Nicotinamide induced Diabetes and high fat diet-induced Diabetes.
MATERIALS AND METHODS
Collection and Preparation of extracts
The volatile oils of Citrus reticulata (Tangerine oil) and Citrus sinensis (Orange oil) were directly procured from katyani exports, New Delhi. An o/w emulsion of Tangerine and Orange oil was prepared by bottle method, using Tween 80 as emulsifier at 1:3 ratios. Later to the organic phase, water was added little by little with vigorous shaking until a final concentration of 250mg/ml was obtained.
Animals
6 weeks old male Wistar rats weighing 50-80 g and adult male Wistar rats weighing 160 – 200g were procured from the Central Animal House facility of CES college of Pharmacy. The animals were housed in polyacrylic cages [38´23´10cm] with not more than 4 animals per cage under the temperature of 25 ± 2 °C and relative humidity 45–55% and maintained on a 12:12 h light: dark cycle and had free access to food and water. Approval No.: IAEC/ CESCOP/ 2017-15.
Induction of Diabetes associated Alzheimer’s disease by STZ – Nicotinamide model
The fasting blood glucose levels were determined before the start of the experiment. Diabetes was induced in overnight fasted rats by a single i.p injection of 45mg/kg of Streptozotocin (STZ). Two hours before STZ injection, 100mg/kg of Nicotinamide was administered orally. Hyperglycaemia was confirmed by elevated glucose levels in plasma after 48 hours by using the Glucose oxidase (GOD)-peroxidase (POD) method. 6
Induction of Diabetes associated Alzheimer’s disease by High Fat Diet model
Initially, a 35% fat diet was given for 2 months. Since it was not enough for raising lipids and glucose levels, the high-fat diet was continued for another 2 months with 45% fat. After continuing the diet for 16 weeks, diabetes and hyperlipidemia induction was confirmed by estimation of Serum glucose and lipid levels. 7
Grouping of animals
Animals were divided randomly into seven groups (Table 1), each group containing 12 animals that were equally distributed for both models. Doses were selected based on previous studies.
Bodyweight: The body weight of animals was determined once every 7 days to analyze the effect of STZ, HFD and citrus extracts.
Biochemical parameters: Serum was collected and used to estimate Glucose (Glucose oxidase aminophenazone or GOD- PAP method), Cholesterol (cholesterol oxidase/peroxidase aminophenazone or CHOD-PAP method), Triglycerides (GPO-TOPS method), and HDL (Precipitation method) as per kit. Samples were analysed using Semi-auto Analyzer (MISPA EXCEL, Chemistry Analyzer). Mathematically VLDL and LDL were calculated using the formula: VLDL = Triglycerides ÷ 5 and LDL = (cholesterol – (HDL+VLDL)).
Behavioural studies
Morris Water Maze: In this experiment, the time required to locate the hidden platform i.e. escape latency was measured. On the 5th day, the hidden platform was removed and the rat was placed randomly from one of the three quadrants and the percentage of time spent in the target quadrant was measured as an index of memory retention. The test was performed every week from induction of hyperglycemia till drug treatment for 28 days. 8
Elevated Plus Maze: In this experiment, the total number of entries into open arms and the total time spent in open arms were recorded manually for 5 minutes. Entry into an arm was considered when all the four paws were placed inside. The training was given for four consecutive days and the test was done on the 5th day of every week from induction of hyperglycemia till drug treatment for 28 days. 9
Brain homogenate was prepared according to the standard protocols and used to estimate acetylcholinesterase, lipid peroxidation, reduced glutathione, catalase and superoxide dismutase levels. 10
In vivo antioxidant studies
Lipid Peroxidation: The malondialdehyde content, a measure of lipid peroxidation, was assayed by Willls method with little modifications. The absorbance of the sample mixture was quantitatively measured at 532nm and it is expressed as the number of moles of malondialdehyde per mg protein using an extinction coefficient of 1.56×105 /M cm. 11
Estimation of reduced glutathione: Reduced glutathione was assayed by the method of Jollow et al. The yellow colour developed was read immediately at 412 nm and the reduced GSH levels were expressed as nmol/mg protein. 12
Estimation of superoxide dismutase: Cytosolic superoxide dismutase activity was assayed by the method of Kono. The auto-oxidation of hydroxylamine was observed by measuring the change in optical density at 560 nm for 2 min at 30/60 s intervals. Superoxide dismutase activity was expressed as units/mg of protein. 13
Estimation of Catalase: Catalase activity was assayed by the method of Claiborne (1985). Changes in absorbance were recorded at 240 nm. Catalase activity was expressed as units/mg of protein. 14
Estimation of Acetylcholinesterase levels in the brain: Cholinergic dysfunction was assessed by quantitative measurement of acetylcholinesterase levels in the brain were performed according to the method of Ellman et al. (1961). The change in absorbance was measured at 412 nm for 2 min. Results were calculated using the molar extinction coefficient of the chromophore (1.36×104 M−1 cm−1) and expressed as µmol/min/mg protein. 15
Estimation of insulin levels in the brain: This experiment was done according to the protocol described by Tamas Csont. The optical density was measured at 450 nm within 30 minutes and the values were expressed as µIU/ml. 16
Histopathology
Neurodegeneration: 30-μm thickness sections taken from cortex and hippocampus, were deparaffinized and hydrated to water. Later stained for 3-5 minutes in Hematoxylin, Eosin (HE stain) and processed using water, 95% alcohol and xylene followed by microscopic examination under 45x. 17
Amyloid-beta plaques deposition: This procedure is done according to Yamaguchi. The ThS-stained brain sections were mounted on slides and then cover-slipped. All histochemical samples were photographed with a Zeiss laser scanning microscopes 700 (Carl Zeiss AG, Oberkochen, German), and results were analyzed using Image J software (National Institutes of Health, Bethesda, MD, USA).18
Screening of β-secretase in Alzheimer’s disease: A multi-well microtiter-plate based colourimetric assay for the screening of BACE1 inhibitors was followed as per Mancini et al. Extracts prepared were used in this assay to screen for beta-secretase inhibitors. Standardization of bioassay was carried out to adjust various components to get optimum results and reading. Absorbance values measured at 410 nm were corrected via the corresponding blank sample. 19
Establishment of HeLa cell culture: The HeLa cell line was purchased from National Centre for Cell Science (NCCS) Pune, Maharashtra, India. The processed and suspended cells were observed under an inverted microscope and stored in a CO2 incubator with the cap of the flask slightly uncapped for CO2 to reach the cells. 20
Statistical Analysis
The results were expressed as Mean ± SEM. Statistical analysis was calculated using Two-way ANOVA followed by post hoc Tukey’s test for multiple comparisons and statistical significance was set at p < 0.05. P > 0.05 was considered non significant (ns). The analysis was carried out using Graph Pad Prism software of version 8.4.3. Values are represented as **** - p0.0001) when compared to disease control (Figure 1a&1b).
Serum glucose levels
When the animals were treated with HFD and STZ - Nicotinamide, there was a significant increase (p>0.0001) in the serum glucose levels of disease control when compared to that of normal control. By the end of the treatment, all the standard and treatment groups showed significant reduction (p>0.0001) in the serum glucose levels compared to disease control. Serum glucose levels were found to be slightly high in STZ – Nicotinamide model when compared to that of the HFD model (Figure 1c&1d).
Lipid Profile
Animals treated with HFD and STZ - Nicotinamide, showed a significant increase (p>0.0001) in the serum cholesterol, Triglyceride, VLDL and LDL levels of disease control when compared to that of normal control. By the end of the treatment, all the standard and treatment groups of HFD showed significant reduction (p>0.0001) in the serum cholesterol, Triglyceride, VLDL and LDL levels compared to disease control.
Whereas, in the STZ model, only the groups treated with CRHD, CSLD, CSHD showed significant reduction (p>0.0001) in the serum triglyceride, VLDL and LDL levels compared to disease control (Figures 1e -.1l)
Animals treated with HFD and STZ - Nicotinamide, showed a significant decrease (p>0.0001) in serum HDL levels of disease control when compared to that of normal control. By the end of the treatment, all the standard and treatment groups of HFD showed a significant increase (p>0.0001) compared to disease control. Whereas, in the STZ model, only the groups treated with CRHD, CSLD, CSHD showed a more significant increase (p>0.0001) followed by a slight increase when treated with standard and CRLD (p>0.01) when compared to disease control (Figure 1m&1n).
Effect on Behavioural Parameters:
Morris water maze: In the HFD model, the escape latency (s) of the control group decreased significantly over the trial days. Extract (low and high doses) treated groups showed significantly (p>0.0001) decreased escape latencies (s) after 7 days of treatment except for CRLD, which became significant after 21 days of treatment. There was a significant difference between the low and high doses after 21 days of treatment. Citrus sinensis showed comparatively better escape latency than the Citrus reticulata at given doses (Figure 2a&2b). Similarly, In the HFD model, the time spent in the target quadrant for the control group increased significantly (p>0.0001) over the trial days. All the test groups exhibited improved spatial memory after 14 days of treatment. Citrus reticulata showed comparatively better improvement in spatial memory than the Citrus sinensis at given doses. Surprisingly, there is no significant improvement in the STZ model (Figure 2c&2d).
Elevated plus-maze: In the HFD model, the number of entries and time spent in the open arms for the control group increased significantly over the trial days. Extract (low and high doses) treated groups showed significant (p>0.0001) increased performance after 7 days of treatment. There was a significant difference between the low and high doses even after 7 days of treatment. Citrus sinensis showed comparatively better performance than the Citrus reticulata at given doses. But, there is no significant improvement in the STZ model (Figure 2e – 2h).
Effect on Brain weight
After the completion of the last day of treatment, animals were euthanized and the brain was isolated. The isolated brain was rinsed with ice-cold normal saline to remove the blood and other connective tissues. Wet weight was measured. In both HFD and STZ – Nicotinamide models, when compared to normal control, all other groups showed a slight reduction in the brain weight was not significant (Figure 3a&3b).
Effect on in vivo antioxidant activity
Animals treated with HFD and STZ – Nicotinamide, showed a significant decrease (p>0.0001) in endogenous CAT, GSH and SOD levels and an increase (p>0.0001) in lipid peroxidation when compared to normal control. After treatment for 28 days with standard, CRLD, CRHD, CSLD and CSHD, lipid peroxidation was significantly decreased (p>0.0001) when compared to disease control in both the models. In HFD and STZ – Nicotinamide model, when compared to disease control, all groups showed a significant increase (p>0.0001) in SOD levels. In STZ – Nicotinamide model, there was no significant increase in brain Catalase and GSH levels when compared to disease control. Whereas in HFD, only groups treated with CRHD and CSHD showed a slight significant increase (p>0.01) in Catalase levels when compared to disease control, followed by CSLD (p>0.05). Groups treated with CRHD, CSLD, CSHD showed a significant increase (p>0.0001) in brain GSH levels, followed by CRLD (p>0.001) and standard group (p>0.05) when compared to disease control of the HFD model (Figure 3c-3j).
Effect on Brain Acetylcholinesterase levels
Animals treated with HFD and STZ – Nicotinamide, showed a significant increase (p>0.0001) in acetylcholinesterase levels when compared to normal control. After treatment for 28 days with standard, CRHD, CSLD and CSHD, acetylcholinesterase levels were significantly decreased (p>0.0001) when compared to disease control in both the models. In the case of groups treated with CRLD, the STZ – Nicotinamide model showed a significant decrease (p>0.0001) but the HFD model showed less significance (p>0.05) when compared to disease control (Figure 3k&3l).
Effect on Brain Insulin levels:
Animals treated with the HFD model showed a significant increase (p>0.0001) in insulin levels when compared to normal control. After treatment for 28 days with standard, CRHD, CSLD and CSHD, insulin levels were significantly decreased (p>0.0001) when compared to disease control in the HFD model. In the case of the STZ model, CSHD only showed a significant decrease (p>0.0001) but the HFD model showed less significance (p>0.05) when compared to disease control (Figure 3m&3n).
Histopathology:
Neurodegeneration in HFD and STZ induced diabetes-associated cognitive decline (DACD):
From the histopathological results, it was evident that HFD has caused predominant neurodegeneration when compared to that of normal control and treatment with citrus extracts has reduced the extent of neurodegeneration when compared to the disease group. On the other hand, STZ – Nicotinamide did not cause any prominent neurodegeneration when compared to normal control. No difference was seen among all the other treated groups of STZ – Nicotinamide model when compared to disease control (Figure 4a&4b).
Amyloid-beta Plaques in HFD induced diabetes-associated cognitive decline (DACD):
By using fluorescent staining, Amyloid-beta plaque deposition in the HFD model was carried out as predominant neurodegeneration was observed. Disease control showed predominant amyloid plaque deposition when compared to normal control. After treatment with standard, CRLD, CRHD, CSLD and CSHD, clearance of amyloid plaques was observed. When compared to all other groups, CSHD showed better clearance of amyloid plaques(Figure 4c).
Effect on beta-secretase activity:
The in-vitro bioassay has been performed with purified BACE enzyme and substrate L-BAPNA for optimization of substrate concentration, time duration of incubation and volume of crude extract. Standard data is represented in Figure 5a&5b. It was found that the best amount of substrate Na-Benzoyl- L -arginine 4-nitroanilide hydrochloride (L-BAPNA) was 50mM, time for incubation was 60 minutes and the best volume was about 2 L of extract that provide inhibition. Figure 5a shows the values of the BACE-L-BAPNA reaction mixture without the administration of any herbal extract. It is representing the standardization of the concentration of substrate. Figure 5b shows the same experimental setup for the standardization of time. This showed the maximum absorbance at 60 minutes and then the saturation in absorbance in respect to time. Figure 5c & 5d shows the experimental setup of BACE and L-BAPNA with the administration of plant extract of test substances.
CONCLUSION
To curb the results, it can be concluded that the HFD model efficiently induced Diabetes associated Cognitive Decline than STZ– Nicotinamide model and can be declared as a best-fit model for screening Diabetes associated Alzheimer’s disease. From the results, it is also evident that an emulsion of the volatile oil obtained from Citrus sinensis showed a better protective effect when compared to Citrus reticulata in the selected In vivo models along with standard groups. Histopathological examination of the brain of the treated animals exposed the physiological and pathological changes during the treatment. Biochemical parameters also supported the protective effect of the plants against the diabetes-induced AD model. The free radical scavenging propensity of the volatile oils of the plant gives protection against oxidative damage and maybe the reason for the restoration of the memory and other physiological and histological parameters.
Acknowledgement
Authors are thankful to CES college of Pharmacy, Kurnool for providing the necessary facilities.
Author Contribution:
Navya Reddy Y performed the work and wrote the manuscript, Madhuri D and Chandrasekhar KB guided the work, prepared and reviewed the manuscript.
Conflict of Interest: The authors declare that there are no conflicts of interest.
Source of Funding: The authors declare that there are no funding sources to carry out this work.
Englishhttp://ijcrr.com/abstract.php?article_id=4091http://ijcrr.com/article_html.php?did=4091
Qiu, Chengxuan. Epidemiology of Alzheimer's disease: occurrence, determinants, and strategies toward intervention. Dialogue Clin Neurosci. 2009;11(2):111-28.
Rowley SP, William R. Diabetes 2030: Insights from Yesterday, Today, and Future Trends. Popul Health Manag. 2017;20 (1):6-12.
Neeraj M, John P, Sheena S, Joydeep S. Role of free radicals and antioxidants in human health and disease. Int J Curr Res Rev. 2013;05 (19):1-2.
Zou Z, Xi W, Hu Y, Nie C, Zhou Z. Antioxidant activity of Citrus fruits. Food Chem. 2016; 196:885–896.
Ghulam Mustafa Kamal, Muhammad Yasin Ashraf, Abdullah Ijaz Hussain Andleeb Shahzadi, Muhammad Ismail Chughtai. Antioxidant potential of peel essential oils of three Pakistani citrus species: Citrus reticulata, Citrus sinensis and Citrus paradisii. Pak J Bot. 2013;45 (4):1449-1454.
Szkudelski T. Streptozotocin–nicotinamide-induced diabetes in the rat. Characteristics of the experimental model. Expt Biol Med. 2012;237(5):481–490.
Wang Z, Fan J, Wang J, Li Y, Xiao L, Duan D, Wang Q. Protective effect of lycopene on high-fat diet-induced cognitive impairment in rats. Neurosci Lett. 2016;Aug 3;627:185-191.
Vorhees CV, Williams MT. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat Prot. 2006;1(2):848–858.
Itoh J, Nabeshima T, Kameyama T. Utility of an elevated plus-maze for the evaluation of memory in mice: effects of nootropics, scopolamine and electroconvulsive shock. Psychopharmacol. 1990;101(1):27–33.
Simeonova Rumyana, Vitcheva Vessela, Kondeva-Burdina Magdalena, Popov Georgi, Shkondrov Aleksandar, Manov Vassil, & Krasteva Ilina. Alcesefoliside protects against oxidative brain injury in rats. Rev Brasil de Farmacog. 2019;29(2):221-227.
Wills ED. Mechanisms of lipid peroxide formation in animal tissues. Biochem J. 1966;99(3):667-676.
Jollow DJ, Mitchell JR, Zampaglione N, Gillete JR. Bromobenzene induced liver necrosis. Protective role of glutathione and evidence for 3, 4-bromobenzene oxide as a hepatotoxic metabolite. Pharmac. 1974;1:151–169.
Kono Y. Generation of superoxide radical during autoxidation of hydroxylamine and an assay for superoxide dismutase. Arch Biochem Biophys. 1978;186:189–195.
Claiborne A. Catalase activity. In: Greenwald R.A., editor. Handbook of Methods for Oxygen Radical Research. CRC Press Inc. Boca Raton. 1984; 283–284.
Ellman Gl, Courtney KD, Andres VJR, Feather-Stone Rm. A new and rapid colourimetric determination of acetylcholinesterase activity. Biochem Pharmacol. 1961;7(5):88–95.
Csont T. Determination of serum insulin level by ELISA. Practical course: Basic biochemical methods and ischemic heart models. Biochem Pharmacol. 2013; 6(2):3-4.
Ikonomovic MD, Buckley CJ, Abrahamson EE. Post-mortem analyses of PiB and flutemetamol in diffuse and cored amyloid-β plaques in Alzheimer’s disease. Acta Neuropathol. 2020;140:463–476.
Yamaguchi H, Shen J. Histological Analysis of Neurodegeneration in the Mouse Brain Necrosis. 2013;1004:91–113.
Yan R, Vassar R. Targeting the β secretase BACE1 for Alzheimer’s disease therapy. Lancet Neur. 2014;13(3):319–329.
Sierant, Malgorzata. Evaluation of BACE1 Silencing in Cellular Models. Int J Alzheimer's Disease. 2009;14:257403.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareStudy of Cardiac Biomarkers in Patients with Severe Sepsis and Septic Shock
English179185Ashwathi VEnglish Virendra CPEnglishIntroduction: Sepsis is having a rapid advancement as a disease process requiring immediate adjustments in therapy. Corrrect identification of disease severity is absolutely important for treatment, reducing and preventing complications, envisaging prognosis and mortality. Objective: The objective of the present study is to study clinical and laboratory parameters of patients with severe sepsis and septic shock. We have also planned to calculate Acute Physiology and Chronic Health Evaluation-II score (APACHE-II). We have undertaken an Echocardiographic evaluation of cardiac functions. Assessment of cardiac biomarkers like Troponin-T and creatine phosphokinase myocardial band (CPK-MB) have also been attempted in this study. Methodology: This was a prospective, observational descriptive cohort study. The Sample size was calculated based on the Prevalence of Severe Sepsis and Septic Shock. Result: In the present study, it was observed that higher CPK-MB levels and positive Troponin-T were associated with significant mortality. Raised CPK-MB levels were associated with sepsis and septic shock. Positive Troponin-T and raised CPK-MB levels also indicate myocardial injury leading to coronary insufficiency in patients with the diagnosis of sepsis and septic shock. Conclusion: Troponin is frequently elevated in critically ill patients; more research is desirable on the diagnostic and prognostic significance and its possible implication in patients with sepsis septic shock.
EnglishAcute Physiology and Chronic Health Evaluation-II, Troponin-T, Creatine phosphokinase myocardial band, Septic shockINTRODUCTION
Sepsis is having a rapid advancement as a disease process requiring immediate adjustments in therapy. Correct identification of disease severity is absolutely important for treatment, reducing and preventing complications, envisaging prognosis and mortality.1 Mortality rates depend on the severity of the disease and the depreciation of the health status of critically ill patients. It is crucial to determine the cause for the underlying infection and the manifestation of organ dysfunction. The presence of predisposing conditions increase the morbidity and mortality rates as the severity of the disease process intensifies, extremes of age, diabetes mellitus, trauma, surgery, history of organ transplantation should be ascertained. Florence Nightingale in 1863, first noticed that the evaluation of outcomes in severely ill patients was an issue.2 The prognostication of outcome in severely ill patients was based on the insight and adjudication of the physician, since the beginning of time. The drastic expansion of the intensive care units, in modern times, has commanded a quantifiable measurement and analysis of the outcomes to augment practices based on data and substantiation. The norm of calculating and assessing through disease severity scores came into existence 25 years back and was created to get an indication for risk stratification of critically ill patients. Subsequently, several disease severity scoring systems have been established considering the diverse conditions and the aetiology of the disease. Hence a vital part of the management of all critical cases is evaluating the prognosis of these patients.1The scoring systems are used for risk stratification, thereby segregating the critically ill patients and classifying them into a specific risk category based on clinical and laboratory parameters. For the improvement of treatment, standards of care and the outcome in patients, it is essential to use these scoring systems in the ICUs.3 Knaus et al in 1985 stemmed the APACHE II score which is a disease severity scoring system for the evaluation of morbidity and mortality in ICU patients.4 based on data collected on the day of admission in the ICU the scores are calculated e.g. SAPS (Simplified Acute Physiology Score), APACHE. All scoring systems usually comprise of two parts: an estimated probability of morbidity and mortality, and a severity score, which is a number (the severity of the condition rises with a higher score).5,6 The standard process of determining the severity of sepsis is by the calculation of Acute Physiology and Chronic Health Evaluation II score ( APACHE II). Practicing physicians must comprehend the significance of disease severity scores and utilize these scoring systems in daily practice.7
OBJECTIVES
To study clinical and laboratory parameters of patients with severe sepsis and septic shock.
To calculate Acute Physiology and Chronic Health Evaluation-II score (APACHE-II).
Echocardiographic evaluation of cardiac functions (LV systolic function, diastolic function and resting Regional Wall Motion Abnormality).
To assess cardiac biomarkers like Troponin-T and creatine phosphokinase myocardial band (CPK-MB) at the time of admission and to find its relation with the outcome of sepsis with septic shock.
MATERIAL AND METHODS
This was a prospective, observational descriptive cohort study. The study was conducted in the Intensive care unit of the Krishna Institute and Medical Research Centre (KH&MRC), Karad, Maharashtra, India. The study duration was from October 2018 to March 2020. (18 months). The study was approved by Institutional Ethics and Protocol Committee (IEC) [Protocol No: 0248/2018-2019]. The Sample size was calculated based on the Prevalence of Severe Sepsis and Septic Shock.
Z = standard constant value at 95% CI= 1.96
P= proportional rate of sepsis in general population= 25%
Q = no proportion = 75%
L = allowable error = 10%
N = (1.96)2(25) (75)/ (10)2
= 3.84 x 1875/100
= 7200/ 100
= 72
All participants were included in this study after a written and informed consent was taken from them or their relatives.
Inclusion Criteria
Patients above18 years of age were admitted to the Medical intensive care unit with the diagnosis of sepsis and septic shock.
Exclusion Criteria
Patients with chronic renal disease.
Patients with systemic diseases- (Diabetes Mellitus, Hypertension, HIV disease, Chronic Obstructive Pulmonary Disease, Collagen Vascular Disease etc)
Patients with severe anaemia. ( Haemoglobin Englishhttp://ijcrr.com/abstract.php?article_id=4092http://ijcrr.com/article_html.php?did=4092
Iwashyna TJ, Ely EW, Smith DM, Langa KM. Long-term cognitive impairment and functional disability among survivors of severe sepsis. J Ame Med Ass. 2010;304(16):1787–1794.
Fleischmann C, Scherag A, Adhikari NK, Hartog CS, Tsaganos T, Schlattmann P et al. International Forum of Acute Care Trialists. Assessment of Global Incidence and Mortality of Hospital-treated Sepsis. Current Estimates and Limitations. Am J Respir Crit Care Med. 2016;1(2);193(3):259-72.
Linde-Zwirble, WT, Angus, DC. Severe sepsis epidemiology: sampling, selection, and society. Crit Care. 2004; 8: 222–226.
Knaus WA, Draper EA, Wagner DP, Zimmerman JE. APACHE II: a severity of disease classification system. Crit Care Med. 1985;13(10):818-29.
Vincent J-L, Moreno R: Scoring systems in the critically ill. Critical Care. 2010, 14:207.
Rapsang AG and Shyam DC. Scoring systems in intensive care unit A compendium. Ind J Critic Care Med. 2014;18(4):220-8.
Lakhani J D. SOFA vs APACHE II as ICU scoring system for sepsis: A dilemma. J Integr Health Sci. 2015;3:3-7
Cerra FB. The systemic septic response: multiple systems organ failure. Crit Care Clin. 1985;1:591-607.
Bone RC, Sibbald WJ, Sprung CL. The ACCP-SCCM Consensus Conference on sepsis and organ failure. Chest. 1992;101: 1481-3.
Levy MM, Fink MP, Marshall JC, et al. 2001 SCCM/ESICM/ACCP/ATS/SIS International Sepsis Definitions Conference. Crit Care Med. 2003;31:1250-6.
Soong J, Soni N. Sepsis: recognition and treatment. Clin Med. 2012;12(3):276-80.
Fa-Chao Chen, Yinchuan Xu, Zhao-cai Zhang. Multi-biomarker strategy for prediction of myocardial dysfunction and mortality in sepsis. J Zhejiang University Sci B. 2020. 21(3): 537-548.
Havaldar AA. Evaluation of sepsis-induced cardiac dysfunction as a predictor of mortality. Cardiovasc Ultras. 2018.30;16(1):31
Claudia Spies, Volker Haude,Fitzne R. Serum Cardiac Troponin-T as a prognostic marker in early sepsis. Crit Care Med. 1998; 4:1055-1063.
Jos FF, Dirk W, Donker D, Cristian S, Marlies E. Koster-Brouwer, Ivo W. Soliman, et al. Myocardial Injury and Long-Term Outcome in Sepsis. Circ Cardiovasc Qual Outc. 2018;11:e004040.
Røsjø H., Varpula M., Hagve TA. et al. Circulating high sensitivity troponin T in severe sepsis and septic shock: distribution, associated factors, and relation to outcome. Intensive Care Med. 2011;37:77–85.
Choon-Ngarm T, Partpisanu P. Serum cardiac troponin-T as a prognostic marker in septic shock. J Med Assoc Thai. 2008;91(12):1818-21.
Landesberg G, Jaffe AS, Gilon D, Levin PD, Goodman S, Abu-Baih A, Beeri R, Weissman C, Sprung CL, Landesberg A. Troponin elevation in severe sepsis and septic shock: the role of left ventricular diastolic dysfunction and right ventricular dilatation. Crit Care Med. 2014 Apr;42(4):790-800.
Burton E, Sobel MD, William SE. Serum enzyme determination in diagnosis and assessment of MI. Circul. 1972;2:1-28.
Katz AM. Physiology of the heart. New York Raven Press; 1977:99-10.
Vallabhajosyula S, Sakhuja A, Geske JB, Kumar M, Poterucha JT, Kashyap R, et al. Role of Admission Troponin-T and Serial Troponin-T Testing in Predicting Outcomes in Severe Sepsis and Septic Shock. J Am Heart Assoc. 2017 Sep 9;6(9):e005930.
Frencken JF, van Baal L, Kappen TH, Donker DW, Horn J, van der Poll T et al. Members of the MARS Consortium. Myocardial Injury in Critically Ill Patients with Community-acquired Pneumonia. A Cohort Study. Ann Am Thorac Soc. 2019;16(5):606-612.
Deep Chand Raja, Sanjay Mehrotra, Avinash Agrawal, Abhishek Singh, Kamlesh Kumar Sawlani, Cardiac Biomarkers and Myocardial Dysfunction in Septicaemia. J App Phy. 2017;65:14-19.
Sharma D, Gupta P, Srivastava S, Jain H. Sensitivity and specificity of cardiac troponin-T in the diagnosis of acute myocardial infarction. Int J Adv Med. 2017;4:244-246.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12HealthcareVegetable Preservatives (Essential Oils) of Guava (Psidium guajava L), an Alternative for Use in the Food Industry
English186191Proano-BJEnglish Racines-OMEnglish Moncayo MPEnglish Urresta VPEnglish Vasquez CWEnglishIntroduction: The food industry uses synthetic preservatives in order to extend the shelf life of products and avoid their deterioration. However, some of these preservatives can affect people’s health. In order to counteract this, industries are replacing them with those of vegetable origin. Guava is one option, because of its bioactive compounds. Objective: The purpose of this study was to substitute synthetic preservatives with natural compounds to offer consumers a high-quality product that guarantees their health. Method: This study evaluated the effect of seven concentrations of guava essential oils and ascorbic acid on the microbial activity (Staphylococcus aureus, Escherichia coli and Salmonella) of Frankfurter-style chicken sausages over a period of 30 days. Therefore, finding a viable solution to reduce the contamination levels of Frankfurter-style chicken sausages and to propose a natural alternative as preservative in these meat products. The collected data was analysed by means of ANOVA. Results: Of the results obtained, the application of 1000 ppm of guava essential oil alone or in combination with 700 ppm of ascorbic acid was best at inhibiting the presence of these microorganisms in the sausages, compared with the synthetic preservative (BHT). Conclusion: It is important to mention that the number of microorganisms present in the sausages were within the ranges stipulated by Ecuadorian regulations. Therefore, the obtained results demonstrated the potential of guava essential oil (Psidium guajava L) in the processed food industry, constituting a viable alternative to replace those of artificial origin.
English Antimicrobial, Antioxidant, Chicken sausage, Guava essential oil, Natural preservatives, Ascorbic acid Introduction
The food industry tends to create products with synthetic preservatives to prevent food from deteriorating, extend shelf life, inhibit the growth of microorganisms and prevent the alteration of physical-chemical and organoleptic properties.1Studies related to the intake of food items containing synthetic preservatives reveal that consumers may develop health problems, such as cancer, age-related issues, vascular diseases and degenerative diseases. This is because free radicals accumulate in the body. For this reason, the global food industry is encouraging the consumption of healthy, safe and high-quality products through the use of natural preservatives of vegetable origin,2 for instance vitamins and essential oils extracted from plants. Essential oils are considered secondary metabolites that have antimicrobial, antiparasitic, insecticide, antiviral, antifungal and antioxidant properties.3,4
Guava is a tropical fruit that is distributed throughout the Americas. In Ecuador, it is even found in the Andean valleys.5Guava essential oil is obtained from the leaves, which contain bioactive compounds, such as phenolic acids, flavonoids and carotenoids, which provide greater antioxidant capacity.6,7,8 The antioxidant effect of essential oils is less than that of vitamins, especially vitamin C.9,10,11Thus, vitamin C, when combined with essential oils, enhances their properties due to a synergistic effect. In food, vitamin C acts by eliminating free radicals. It slows down the chain reactions that occur upon contact with oxygen and therefore prevents food spoilage.12,13
Given that there are bacteria, moulds and yeasts that deteriorate food, it is necessary to inhibit microbial activity with natural compounds, which have the ability to halt their multiplication.6,7,8 In this context, the antioxidant effect of guava essential oil in combination with ascorbic acid in chicken sausages was tested. There is evidence that some plant compounds have anti-microbial action, since they decelerate the growth of microorganisms in processed foods. Hence, a viable technological alternative is to replace synthetic preservatives with natural compounds to offer consumers a high-quality product that guarantees their health.
Materials and Methods
The sausages were prepared under strict hygienic practices at the Food Processing facilities of UDLA (Universidad de las Américas) using this formulation: chicken meat (40 %), chicken fat (15 %), soy protein (13 %), corn starch (7 %), salt (3 %), spices (3.5 %), sugar (2 %), carrageenan (1 %), iced water (15 %) and the proposed antimicrobial growth agents. The obtained emulsion was packed in the appropriate casings and a heat treatment was applied by immersion in hot water (82 °C until a 73 °C internal temperature was achieved) with a subsequent bath in cold water to cool the sausages down before packaging. A total of 882 chicken sausages were prepared with the desired concentrations of the proposed microbial growth inhibitors, divided into 3 repetitions that were carried out 1 month from each other. Each sausage weighed 10 g and was individually vacuum-packed for further storage. In order to contrast the antimicrobial effect of the ascorbic acid (AA) and guava essential oil (GEO), BHT (butylated hydroxytoluene) was considered as a control. The sausages were stored at a cold temperature (4 °C) and the microbial growth in the sausages was assessed every 5 days over a period of a month (days 0, 5, 10, 15, 20, 25 and 30). Seven treatments were performed, as shown below in Table 1.
According to the Ecuadorian Food Legislation14 described in Table 2, a meat product must comply with health standards in order to be released by the industry. In this table, the method used to assess the variables is mentioned. In our study, the variables for microbial growth were: Mesophilic aerobes count (cfu/g), Escherichia coli presence (cfu/g), Staphylococcus aureus count (cfu/g) and Salmonella presence (cfu/25g).
From each sausage, 1 g was randomly obtained for the microbiological and chemical analyses. These samples were cultivated in specific media to check for microbial presence. The mesophilic aerobes assessment was performed by obtaining as stated 1 g samples and each sample was introduced into 9 ml of peptone water. An aliquot of the solution was inoculated in PCA (plate count agar) and further incubated at 37 °C for 48 h. All whitish-yellowish round colonies were counted in the tripartite petri dishes. Another sausage was used for the following analysis: 1 g sample + 9 ml of peptone water was used for Staphylococcus aureus count. This solution was inoculated into Mannitol Nutrient Agar tripartite petri dishes and further incubated at 37 °C for 48 h. All yellowish round colonies were counted. As for the E. coli assessment, another sausage was used to obtain the 1g random sample (immersed into 9 ml of peptone water) and the solution was further inoculated into Eosin Blue Metilated Agar and incubated at 37 °C for 48 h. Metallic green-colored bacteria with black-blueish centers were taken into account if present in the agar.
Meanwhile, for Samonella, SS Agar (Salmonella-Shigella Agar) was used. It was necessary to carry out a pre-enriched step with peptone water and then an enriched step with Muller Kauffman tetrathionate broth and later with Rappaport-Vassiliadis Soya broth. Finally, 100 microliters of this enriched broth that already contained the sample was placed on the SS agar at 37 ºC for 24 hours. Tripartite petri dishes were inoculated and all pink and bright red bacteria present were counted.
The cfu were counted and the following formula was used:
In order to assess the chemical properties of the sausages, the variables taken into account were pH and peroxide level. pH determination was accomplished using a Fished Scientific Accume potentiometer in each of the samples taken. This value was compared to the Ecuadorian Food Legislation standard that recommends a maximum of 6.2. For the peroxide level in the samples, an MQuant Peroxide semi-quantitative Test (Merck) was used with a peroxide level range of 0; 5; 2; 5; 10; and 25 mg/l H2O2.
Results
Mesophilic aerobes
When analyzing the growth data of mesophilic aerobes in the products, it was determined that there are significant differences between treatments starting at day 15 (Table 3).
ns: no statistical differences; * Statistical differences (5%); ** Statistical differences (1%).
Mesophilic aerobes appeared from day 5 onwards in the product. However, from day 15, they increased consistently up to 30 days in all treatments (Table 4). Treatment T7, which contained 1000 ppm of guava essential oil, was the best at inhibiting the growth of this type of microorganism, since it presented the lowest amount of cfu / g of mesophilic aerobes (133 cfu/g), followed by T5 with more than 3 times the amount of the pathogen (767 cfu), and also T6 (1000 ppm of guava essential oil + 700 ppm of ascorbic acid) with 3033 cfu / g. The same trend occurred for the evaluations carried out at 20, 25 and 30 days (Table 4). For its part, the control (T2) containing the synthetic preservative BHT exceeded the amount recommended by Ecuadorian regulations, increasing from 9133 to 21967 cfu/g between days 15 and 30.
Means followed by the same letter in each column are statistically equal (Tukey 5%).
Staphylococcus aureus
The treatments under study affected the growth of Staphylococcus aureus as well as the aforementioned microorganism from day 15 onwards (Table 3). The amount of cfu of Staphylococcus aureus increased as the storage time of the products increased for all treatments (Table 5). Only T7 had less than 1000 cfu of Staphylococcus aureus, which complies with the provisions of the INEN standard. However, T6 did not exceed that amount by much, hence treatments 6 and 7 did not have significant statistical differences (letter c).
Escherichia coli and Salmonella
In the 30 days of investigation, neither E.coli nor Salmonella cfu grew
Peroxides
Regarding peroxides, the effect of the treatments was determined on the evaluated product during the entire evaluated period (Table 3). The average and standard deviation of the peroxide data at days 20, 25 and 30 can be seen in Table 6. From day 20, differences were identified between treatments
Discussion
Mesophilic aerobes
It is important to note that the amount of this microorganism present in the product during the time evaluated in T7 is within the parameters stipulated by Ecuadorian regulations,14which indicate that the amount must be equal to or less than 5 x 105 cfu / g for sausages, therefore we can indicate that they are suitable for human consumption.
It is important to indicate that food can contain bacteria (mesophilic aerobes), molds and yeasts, and depending on the amount of these microorganisms present, it can be evaluated whether or not a product is suitable for human consumption1.In this study, it can be indicated that the T7 sausages are safe for consumption during the 30 days of evaluation. Furthermore, this indicates that the processing and storage processes were adequate.The inhibition of mesophilic aerobes in chicken sausages with antimicrobial emulsions, which contained the essential oil of guava monoterpenes, 1,8 cineol,a- terpenil and p- cimen, among others, delayed the growth of microorganisms14,15and therefore increased the product’s shelf life.16
Treatments T6 presented the lowest averages of cfu / g of mesophilic aerobes over the 30 days. This coincides with the study by17, who determined in an in vitro study that the minimum inhibitory amount of guava essential oil in chicken sausages should be 800 ppm. The presence of ascorbic acid in T6 also helped to control the proliferation of bacteria.13
In our investigation, it was determined that all the treatments were within the parameters of the INEN Standard for sausages as regards mesophilic aerobes. In chicken sausages, the antimicrobial solutions did not totally inhibit mesophilic aerobes; however, the decrease was due to the guava essential oil in combination with ascorbic acid.
Staphylococcus aureus
The growth of Staphylococcus aureus in processed foods limits their useful life. The presence of this bacterium is considered an indicator of sanitary control1, because it can produce toxic infections in the consumer caused by thermostable toxins.1In chicken sausages, the proliferation of bacteria took place from day 0 to day 30, exceeding the admissible limits set by the INEN standard (1,000 cfu / g). The only treatment that maintained the product’s useful life until day 30 was T7. This is corroborated by the studies published by,18,19who reported that extracts of Psidium guava perform antimicrobial activity on gram-positive bacteria such as Staphylococcus aureus, determining that the minimum inhibitory concentration is between 500 and 1,000 ppm of guava essential oil. Another research group20 also found that guava extract is antibacterial due to its constituents and that it limits the growth of Staphylococcus aureus. Additionally21,22confirmed that the active compounds of guava essential oil as thermenoids provide an antimicrobial effect and inhibit some Staphylococcus aureus strains.23,24,25
The T2 treatment, which contains BHT (chemical preservative), inhibits the presence of S. aureus up to day 20. Therefore, the T7, which contains only guava essential oil, had the best results.8Rakmaia26 demonstrated that the antimicrobial activity of guava essential oil with a minimum inhibitory amount of 500 μg / ml controlled the growth of S. aureus thanks to the presence of monoterpenes such as limonene.
Escherichia coli and Salmonella
The presence of bacteria such as Escherichia coli and Salmonella spp. indicates that a product is contaminated and is unsuitable for human consumption. The Frankfurter-style chicken sausages with antimicrobial emulsions did not present colony-forming units of Escherichia coli and Salmonella sp during the thirty days of investigation. All the treatments inhibited the growth of Escherichia coli. This was due to the presence of components like flavonoids in guava,26,27 which causes the denaturation of the membrane and inhibits the proliferation of Escherichia coli.28Furthermore, studies from Bermudez et al.3confirmed the effectiveness of guava essential oil against E. coli in meat and bone meal previously contaminated with this bacterium.
Studies by Dhiman et al.8also revealed that a minimal inhibitory concentration (0.78 μg / ml of the P. guajava extract) exhibited the bacterial activity of E. coli. During the thirty days of research, there was no contamination by Salmonella spp. in the chicken sausages: all treatments inhibited this bacterium. This is consistent with the in vitro investigation of guava essential oil through the disc diffusion method, the result of which was inhibition of 9 mm.29
Arima et al.31 identified two new flavonoid glycosides, morin-3- O- α- L- lixopyranoside and morin-3- O- α- L-arabopyranoside, which with a minimum inhibition concentration of 200 μg / ml were able to inhibit Salmonella bacteria. Furthermore, guava essential oil’s anti-bacteriostatic activity against Salmonella is attributed to the presence of flavonoids.27
However, there are studies in which the effect of guava essential oil on the inhibition of gram-negative bacteria, such as Escherichia coli could not be verified. One group of investigators extracted oil from Psidium guava through various processes and demonstrated that there was no inhibition of Escherichia coli due to the permeable structure of this bacterium’s membranes, which are composed of an external lipopolysaccharide that restricts the entry of the essential oil extract.20
In addition, the inhibition of these bacteria was attributable to the effect of the scalding temperature in the formulation of the sausages, as confirmed by,30 who established that in the elaboration of sausages it is necessary to use scalding or a heat treatment. This process reduces the number of microorganisms present in the samples because it reaches a temperature of 70-75 ºC, guaranteeing the safety of the food with respect to these bacteria. In this case, the sausage production was controlled by scalding, reaching an internal temperature of 70 ºC and a water temperature of 75 °C, guaranteeing the safety of the food with respect to these bacteria.By not presenting colony-forming units of Escherichia coli and Salmonella spp. over the 30-day period, the chicken sausages were within the parameters of the INEN Standard,14 which establishes that they must be less than 3 cfu/g for Escherichia coli and that the colony-forming units must be completely absent for Salmonella spp.
Peroxides
Peroxides have an oxidizing capacity in food. They are compounds that produce lipid rancidity, which causes food to deteriorate and shortens its useful life.31From day 20 to day 30, there were significant changes between treatments, because peroxides formed due to a lipolysis process (Table 3). However, only treatments 1 and 2 exceeded the limits established by,31which suggest that a peroxide index of 10 meq / L or above in meat products causes oxidative rancidity and deterioration.
Treatments 3 to 7 controlled lipid rancidity, which agrees with,32 who determined that the presence of solutions with essential oils in meat products preserves the product by postponing the oxidation that causes its deterioration.
Conclusion
The studied treatments over the 30 days had different effects on the control of the microorganisms evaluated in the chicken sausages. The use of guava essential oil alone and in combination with ascorbic acid were the treatments that best controlled those microorganisms, having an even better effect than the synthetic preservative used as a control. In addition, they had the best action against the product's peroxides, obtaining the lowest averages.
Acknowledgements
The author acknowledges the immense help received from the scholars whose articles are cited and included in references to this manuscript. The author is also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.
Conflict of Interest: Nil
Source of Funding: Nil
Authors’ Contributions:
Janeth Proaño-Bastidas: Conceptualization of the research, methodology and writing- original draft preparation, review and editing.
Wilson Vasquez-Castillo: Data curation and statistical analysis. Writing-review and editing.
Mauricio Racines-Oliva: Data curation and statistical analysis. Writing-review and editing.
Pablo Moncayo Moncayo: Data validation and project administration.
Paula Urresta Valencia: Laboratory work.
Englishhttp://ijcrr.com/abstract.php?article_id=4093http://ijcrr.com/article_html.php?did=4093
AndinoF, Castillo Y. Food microbiology: Practical approach to food safety.Estelí Nicaragua:National University of Engineering; 2010.
Inouye S, Takizawa T, Yamaguchi H. Antibacterial activity of essential oils and their major constituents against respiratory tract pathogens by gaseous contact. Antimicrob Chemother. 2001 May; 47 (5): 565-573.
Sacchetti G, Maietti S, Muzzoli MV, Scaglianti M, Manfredini S. Comparative evaluation of 11 essential oils of different origin as functional antioxidants: antiradicals and antimicrobials in food. Food Chem. 2005 August; 91: 621-632.
Bermúdez-Vásquez MJ, Granados-Chinchilla F, Molina A. Chemical composition and antimicrobial activity of the essential oil of Psidium guajava and Cymbopogon citratus. Agron. Mesoam. 2019 January; 30 (1): 147-163.
Abdelrahim SI, Almagboul AZ, Omer MEA, Elegami A. Antimicrobial activity of Psidium guajava L. Phytother Res. 2002 December;73 (7-8): 713-715.
Ogunwande IA, Olawore NO, Deleke KA, Ekundayo O, Koenig WA. Chemical composition of the volatile oil from Psidium guajava L. leaves growing in Nigeria. Flavour Fragr J. 2003 March 03; 18: 136-138.
Chen HC, Sheu MJ, Lin LY, Wu CM. Chemical composition of the essential oil of Psidium guajava L. leaf from Taiwan. J. Essent. Oil Res. 2011 December 28;19 (4): 345-347.
Metwally AM, Omar AA, Ghazy NM, Harraz FM, Sohafy SM. Monograph of Psidium guajava L. leaves. Pharmacogn. J. 2011 April; 3, (21): 89-104.
Dhiman A, Nanda A, Ahmad S, Narasimhan B. In vitro antimicrobial activity of methanolic leaf extract of Psidium guajava L.J Pharm Bioallied Sci.2011 June 03; 3(2): 226.
Yaaser MR, Rashad OB. Evaluation of the antioxidant and antibacterial properties in two types of Yemeni guava cultivars. Biocatal. Agric. Biotechnol. 2018 October; 16: 90-97.
Carvalho AV, Lima LCD. Quality of kiwis minimally processed and subjected to treatment with ascorbic acid, citric acid and calcium chloride. Pesqui. Agropecu. Bras2002; 37(5): 679-685.
Sangha O, Stucki G. Vitamin E in therapy of rheumatic diseases. Z Rheumatol 1998 July 31; 57 (4): 207-214.
Núñez A. Antioxidant therapy, oxidative stress and antioxidant products: challenges and opportunities. Cuban Rev Public Health. 2011; 37 (suppl.): 644-60.
INEN 1338. INEN Standard Raw, Cured, Precooked Meat Products, Requirements Quito: Ecuadorian Institute for Regularization, 2012.
Hsin-ChunC, Ming-JenS, Li-YunL, Chung-MayW. Chemical composition of the essential oil of Psidium guajava L. leaf from Taiwan. J. Essent. Oil Res.2011 November 18; 19:345-347.
Gutierrez RM, Mitchell SR. Solís R. Psidium guajava: A review of its traditional uses, phytochemistry and pharmacology. J Ethnopharmacol 2008 April 17; 117 (1): 1-27.
De Souza L, DaméLF, Hörnke Alves G, Ziemann MA, AlvesMR.Evaluation of the bactericidal activity of essential oils of guava, pitango and arazá leaves. Rev. Cuba. de Plan Medi.2011;16(4), 324-330.
INEN 1529-14. Microbiological control of food Staphylococcus aureus, Quito,1998.
Sanches, NR, Garcia Cortez DA, Schiavini MS, Nakamura CV, Dias Filho BP. An evaluation of antibacterial activities of Psidium guajava (L.). Braz Arch. 2005 May 01;48(3): 429-436.
Malaviya A, Mishra N. Antimicrobial activity of tropical fruits. Bri Int J. 2011; 3 (1): 1-4.
Gonçalves FA, Andrade Neto M, Bezerra A, Macrae JN, Sousa OVD. Fonteles-Filho, AA and Vieira, RH et al. GUAVA antibacterial activity, Psidium guajava Linnaeus, leaf extracts on enteric bacteria causing diarrhea isolated from Seabob shrimp, Xiphopenaeuskroyeri (Heller), Rev Inst Med Trop São Paulo.2008 February; 50 (1):11-15.
Barahona BA. Evaluation of the in vitro antibacterial activity of two extracts of medicinal plants oregano (Lippia graveolens hbk) and guava (Psidium guajava), on Escherichia coli; causing colibacillosis in domestic birds (Gallus gallus) (Doctoral dissertation, Universidad de San Carlos de Guatemala. 2016
Mahfuzul MD, Bari ML, Inatsu Y, Juneja VK, Kawamoto S. Antibacterial activity of extracts of guava (Psidium guajava L.) and neem (Azadirachta indica A. Juss.) Against foodborne pathogens and spoilage bacteria. Foodborne Pathog Dis.2007 November 27; 4 (4):481-488.
Soliman FM, Fathy MM, Salama MM, Sabre FR.Comparative study of the volatile oil content and antimicrobial activity of Psidium guajava L. and Psidium cattleianum Sabine leaves. Boletín de la Facultad de Farmacia, Universidad de El Cairo. 2016 December; 54 (2): 219-225.
Martínez MJ, Molina N, Boucourt E. Evaluation of the antimicrobial activity of Psidium guajava L. (Guayaba). Rev. Cuba. de Plantas Medicinales 1997 April; 2 (1):12-14.
Rakmaia J, Cheirsilpa B, Mejutob J, Simal-Gándarac CJ. Torrado-Agrasarc A. Antioxidant and antimicrobial properties of encapsulated guava leaf oil in hydroxypropyl-beta-cyclodextrin. Ind Crop Prod. 2018 January; 111: 219-225.
Daniel VA, Moreno JE, Hidalgo DC, Martinez JRV, Borges-Argaez R, Farfan MC et al. Antimicrobial activity and chemical composition of the essential oils ofMalvaviscusarboreuscav, Pimenta dioica (L.) merr., Byrsonimacrassifolia (L.) Kunth and Psidium guajava l, Trop. Subtrop. Agroecosyst.2013;16 (3).
Rattanachaikunsopon P, Phumkhachorn P. Contents and antibacterial activity of flavonoids extracted from Psidium guajava plants, Rev. Cuba. de Plantas Medic. 2010; 4(5): 393-396.
Emmanuel A, Kubmarawa D, Sara GY, Wahu A. Phytochemical detection, antioxidant and antimicrobial activities of essential oils and ethanol extract of Psidium guajava leaf. Asian J. Phys. Chem. Sci. Ess. 2019 1-8,
Arima H, Danno GL. Isolation of antimicrobial compounds from guayaba (Psidium guajava L.) and its structural dilution, Biosci. Biotechnol. Biochem. 2002; 66 (8):1727-1730.
CODEX STAN 210. Norma del CODEX para grasas y aceites no regulados por normas individuales1999 ; 1-14.
AlarcónJ, Panez R, Romos P, Valle E, Yon A. Determination of the Index of Peroxides in Oils and Fats. Oil and fat technology. Federico Villareal National Univers. 2019.
Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12Healthcare
Impact of Back Massage on Physical and Psychological Measures in Chronically Ill Patients
English192196Sngeeta PatilEnglish Prabhuswami HiremathEnglish Mahadeo ShindeEnglish
Introduction: The significance of massage in providing nursing care is frequently overlooked. Massage therapy has been shown to have beneficial effects, both physically and psychologically, on the whole person. Aims: The purpose of this study was to investigate the effects of giving chronically ill patients a back massage on their physiological and psychological markers while they were getting care at a tertiary care centre. Methods and Material: The purpose of this study was to investigate the influence that back massage has on the physiological and psychological parameters of patients who suffer from chronic illnesses. 1. To determine the effect that back massage has on the physiological and psychological aspects of patients who are suffering from chronic illness. Methodology For the purpose of this study, a one-group, pre- and post-test quasi-experimental design was used to serve as the investigation’s research methodology. Result: This inquiry will focus on collecting samples from 50 chronically ill patients of both sexes between the ages of 16 and 60 who have been hospitalised to Krishna Hospital in Karad. The patients’ ages range from 16 to 60. The results showed that after three days of back massage, the mean score for anxiety decreased from 47 to 35, the score for stress decreased from 16 to 9, and the score for the Patient Health Questionnaire dropped from 58 to 39. After receiving a back massage for three days, the patient’s average pulse decreased from 82 to 75, the average respiration rate decreased from 26 to 19, the patient’s systolic blood pressure decreased from 141 to 129, and the patient’s diastolic blood pressure decreased from 95 to 83. Conclusion: The results of this study indicate that massage therapy is a safe and effective treatment for patients in intensive care units to lower the severity of patients’ physical and mental health problems. As a consequence of this, regular application of back massage in the context of therapeutic therapy is strongly recommended.
EnglishEffectiveness, Back Massage, Physiological, Psychological, Tertiary care, Severity of patients’.http://ijcrr.com/abstract.php?article_id=4644http://ijcrr.com/article_html.php?did=4644Radiance Research AcademyInternational Journal of Current Research and Review2231-21960975-52411317EnglishN2021September12Healthcare
To Evaluate the Effectiveness of a Self-Instructional Module on First-Year Nursing Students in Covid-19 Pandemic
English197201Sangeeta PatilEnglish Vaishali R. MohiteEnglish Namrata C. MohiteEnglish Mahadeo ShindeEnglish
Introduction: During the COVID 19 pandemic, people had less opportunity to contact with one another socially. In some areas of the world, students were even barred from attending school or colleges. Aims: The purpose of this study was to research and evaluate the efficacy of a self-instructional module on social anxiety among first-year nursing students participating in the COVID-19 programme. Material and Method: The components and procedures: An experimental investigation was carried out to determine whether or not a self-instruction module is beneficial in lowering levels of social anxiety. A total of one hundred samples were collected using straightforward sample methods in accordance with inclusion criteria. Self-instructional module as well as a questionnaire that was developed by the individual and then validated by specialists. (Score equals Mild Level of Social Anxiety when between 1 and 25, Moderate Level of Social Anxiety when between 26 and 50, and Severe Level of Social Anxiety when between 51 and 75. The design consisted of one group undergoing a pre-test and a post-test. A pre-test had been completed, and a self-instruction module had been distributed to every student. After waiting a week after the initial test, the same questionnaire was used. Statistics, both descriptive and inferential, were used to analyse the data. Results: The majority of the students in this experimental research project on Scio demographic factors are between the ages of 18 and 19 years old, 56 (56%) from rural area, from urban area 63(63%). Internet-based sources of information make up 72 percent of the total. 9 percent of students had light social anxiety, 79 percent had moderate social anxiety, and 12 percent of students had severe social anxiety in the level of social anxiety as a pre-test. After the post-test, one hundred percent of students reported mild anxiety, whereas none of the students reported mild or severe anxiety. There was no discernible correlation found with any of the Scio demographic factors. Conclusion: The students were able to better meet their intellectual and emotional needs, as well as experience a reduction in their levels of social anxiety, by engaging in self-directed learning.
EnglishCovid-19 Pandemic, Social anxiety, Self-instructional module, Education, Influenza, Adolescencehttp://ijcrr.com/abstract.php?article_id=4645http://ijcrr.com/article_html.php?did=4645
1. Mukhtar K, Javed K, Arooj M, Sethi A. Advantages, Limitations and Recommendations for online learning during COVID-19 pandemic era. Pak. J. Med. Sci. Q. 2020 May;36(COVID19- S4):S27.
2. Muthuprasad T, Aiswarya S, Aditya KS, Jha GK. Students’ perception and preference for online education in India during COVID-19 pandemic. Social Sciences & Humanities Open. 2021 Jan 1;3(1):100101.
3. Nair AB, Patil S, Mohite N, Sajeev AS, Mohan A, Lal AM. Effectiveness of self-instructional module on level of knowledge on reduction of social anxiety among first year nursing students in Covid-19 Pandemic. J. Pharm. Negat.2022 Oct 12:591-5.
4. Khandagale C, Dumbray S. A study to assess the effectiveness of self-instructional module on reduction of social anxiety among adolescents. Asian J Nurs Res.. 2017 Aug 9;7(3):348-56.
5. Pokhrel S, Chhetri R. A literature review on impact of COVID-19 pandemic on teaching and learning. Higher Education for the Future. 2021 Jan;8(1):133-41.
6. Islam MA, Barna SD, Raihan H, Khan MN, Hossain MT. Depression and anxiety among university students during the COVID-19 pandemic in Bangladesh: A web-based cross-sectional survey. PloS one. 2020 Aug 26;15(8):e0238162.
7. Paw?owska IJ, Paw?owski L, Krzy?aniak N, Koci? I. How to teach pharmacology to medical students during the COVID-19 pandemic?.
8. Lischer S, Safi N, Dickson C. Remote learning and students’ mental health during the Covid-19 pandemic: A mixed-method enquiry. Prospects. 2022 Oct;51(4):589-99.
9. Eatesamipour R, Moghadam KR, Amirpour B. Effectiveness of Paradox Therapy on COVID-19 Anxiety in Adult Population in Jahrom. Mod. Care J.2021 Oct 31;18(4).
10. Savitsky B, Findling Y, Ereli A, Hendel T. Anxiety and coping strategies among nursing students during the covid-19 pandemic. Nurse education in practice. 2020 Jul 1;46:102809.
11. Alici NK, Copur EO. Anxiety and fear of COVID?19 among nursing students during the COVID?19 pandemic: A descriptive correlation study. Perspectives in psychiatric care. 2021 Jan 1.
12. Monterio S, Kurian A, Noushad EA, Sara AB, Dilna CP, Dilna M, Nair RR, Tomy T, Vaishnavi T. A Study to assess the level of social anxiety among adolescents in a selected college in Mangaluru. Int. J. Nurs. Educ. 2020;8(3):337-40.
13. Madhu S, Sathish DK, Kumar GV, Kumar P. A descriptive study to assess the level of anxiety and attitude in returning back to school after lockdown due to covid-19 pandemic among GNM students studying at JSS School of nursing Chamarajanagar. Int. J. Nurs. Educ. 2021;9(1):27-32.
14. Temiz Z. Nursing students’ anxiety levels and coping strategies during the COVID-19 pandemic. Int Arch Nurs Health Care. 2020;6:150.
15. Hamaideh SH, Al?Modallal H, Tanash MA, Hamdan?Mansour3 A. Depression, anxiety and stress among undergraduate students during COVID?19 outbreak and” home?quarantine”. Nursing Open. 2022 Mar;9(2):1423-31.