<?xml version="1.0"?>
<xml><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>Latest Genetic Diagnostic Technologies&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>01</FirstPage><LastPage>02</LastPage><AuthorList><Author>Anshda Bhatnagar</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract/><AbstractLanguage>English</AbstractLanguage><Keywords/><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3428</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3428</Fulltext></URLs></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>Occupational Aspects among Dental Surgeons in Chennai: A Letter to the Editor&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>03</FirstPage><LastPage>03</LastPage><AuthorList><Author>Debasish Kar Mahapatra</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract/><AbstractLanguage>English</AbstractLanguage><Keywords/><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3429</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3429</Fulltext></URLs></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>Factors Affecting Social Support and Resilience on Police Officer&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>04</FirstPage><LastPage>10</LastPage><AuthorList><Author>Sungsim Lee</Author><AuthorLanguage>English</AuthorLanguage><Author> Sookyoung Jeong</Author><AuthorLanguage>English</AuthorLanguage><Author> Youngsoon Choi</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: According to survey the highest priority job with most stress on or off duty is the for the security and that is for the police officers. Since the police organization has clear hierarchical order between rigid command lines, conflict of opinions between bosses and co-workers, harassment of senior executives, and pressure for promotion can be factors of work-related stress. Objective: The purpose of this study was to provide basic data on mental health by identifying factors affecting the resilience of police officer. Method: With the consent of the Subject the data collection was done from October 1 to November 30, 2019. 150 participants were included in the final analysis. The demographic characteristics, resilience, and social support were considered in the questionnaire. The descriptive statistics, t-test, ANOVA, Pearson&#x2019;s correlation and multiple regression using SPSS 21.0 statistical program were used for analysis of the collected data. Results: The results of this study showed that the difference in resilience, according to general characteristics as gender, place of psychological distress and gender, age, position, working department, total work experience and subjective health state in social support. Resilience showed a static positive correlation with social support, emotional support, informative support, material support, evaluation support. Conclusion: Based on the above results, regression analysis showed that factors affecting resilience were gender, material support and emotional support the factors used in the analysis explained 30.5% of resilience.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Social support, Resilience, Police officer, Health</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
The police of Korea have been established for the 75th anniversary in 2020. The number of police officers in the country amounted to 10,364. Among them, 45,129 police officers (41.2%) were police officers in Frontline and police box, a large number of police officers are working for public welfare.1,2 The police officer&amp;#39;s main task is to protect the lives, bodies and property of the people, to prevent crime, to suppress and investigate, to collect police information, to control traffic, and to maintain common goodwill and order.3 About 41% of the current police officers work in frontline zones and police boxes, and the 112 reports are the first to report the incident and take action on the site. In the process, they exposed to risks and unpredictable outbreaks, which repeated 24 hours a day, seven days a week, and work in constant tension. As you can see from this situation, police officers are suffering from heavy work such as arrest and handling of 112 reports and suffer from various stresses.3&#xD;
&#xD;
&#xA0; According to the survey of job stress by occupations conducted by the National Employment Information Service in 2013, the highest priority job was the police officer.4 Also, police officers may suffer direct harm to their lives or bodies due to the nature of their work or take responsibility for the consequences of the measures are wrong. Therefore, police officers must have high psychological pressures and tensions from the moment they go to the scene of the incident to the end of all actions, including the arrest and a convoy of criminals after arrival.4&#xD;
&#xD;
As such, there are various risk factors and conflicts at the scene of the incident, and police officers are at the centre and no one can replace them. Police officers have to deal with these various risk factors and conflict relationships, and in complex and ambiguous situations, they are always required to respond quickly to situations and deal with crises, thus experiencing various conflicts and job stress.4 The police are constantly patrolling to prevent crimes and encounter terrible and cruel scenes in the violent incidents such as murders, struggling to pursue criminal arrests, and risk the injuries at the traffic enforcement and accident scenes. They are experiencing high levels of stress due to increasing civil infringement crimes and violent incidences, increasingly powerful incidents, citizens&amp;#39; rescue requests, and witnessing incidents.5,6 &#xD;
&#xD;
Since the police organization has clear hierarchical order between rigid command lines, conflict of opinions between bosses and co-workers, harassment of senior executives, and pressure for promotion can be factors of work-related stress; this can lead to conflicts between supervisors, colleagues and subordinates, or weaken fellowship.7,8 Personal stressors may also include family time and lack of personal leisure time, physical safety and health concerns, and adequacy of work.8 As the voice of concern for the mental health of police officers is increasing, there is little or no national measures or support for this.9 Police officers&amp;#39; job stress was associated with increased anxiety, depression, somatic symptoms, post-traumatic stress symptoms, psychological exhaustion, chronic pain, alcohol abuse, and inappropriate aggressive behaviour.10&#xD;
&#xD;
Social support means &#x201C;resources provided by others&#x201D; in a broad sense.11 Caplan (1974) defined social support as a "continuous collection of individuals who provide opportunities for feedback to identify expectations of themselves and others.12 In the concept of social support, Park Ji-won (1985) included various dimensions such as social support network, support type, and support desire. Besides, they defined the degree of support, confidence, and confidence in their social relations that reflects the degree of support provided in real situations, the degree of recognition that they can provide through members of the social network, and the degree of satisfaction of support needs.13 The concept of social support is the act of mitigating the negative effects of stressful situations, which defined as positive resources that individuals can get from interpersonal relationships, and the social supporters include family members, friends, teachers, and colleagues.12&#xD;
&#xD;
Social support acts as a major mechanism to enhance an individual&amp;#39;s positive development and adaptive ability (attitude) by improving their various internal functions and protecting them from external negative influences.11 According to Wakjer, Michael, Stanley Wasserman &amp; Barry Wellman, social support acts as an indirect function to protect and cushion the individual from the stressful effects or negative effects of the problem they face, increasing the positive emotions of the individual regardless of the situation, and a direct function of improving general adaptation by increasing well-being and control over the environment.14 Resilience is all your effort to control your urges for effective adaptation when faced with a variety of stressful situations.15,16 Respond flexibly, without stiffness or frustration in stressful situations, it is a dynamic ability to return to the original level of self-control.15-17 Resilient people adapt well to stressful situations with high confidence and positive emotions, while less resilient people are persistent or distracted by excessive or under control.18 For example, when someone exposed to the same stressful situation, someone will quickly overcome it; some people may have difficulty in a state of maladjustment. In a dangerous situation that threatens mental health, protecting yourself and turning it into an opportunity for growth to increase your ability to move forward is a way to prevent risks such as depression.3&#xD;
&#xD;
This resilience is a concept that focuses on the individual&amp;#39;s ability and resources to adapt to the situation and flexibly, rather than individual defects or weaknesses. It can be inferred that in various circumstances, it is possible to overcome the problems caused by the flexible problem-solving ability and the negative emotions according to the situational needs.3 However, as a measure to mitigate the negative effects of police officers under stress, studies on social support and resilience are insufficient.&#xD;
&#xD;
Therefore, this study confirms the degree of social support and resilience of police officers and the relationship between social support and resilience. Also, this study conducted to identify factors influencing resilience and to use them as basic data in establishing a support system for social support needed to improve the mental health of police officers.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
Research design &#xD;
&#xD;
This study is descriptive research using structured questionnaires to investigate the effect of social support on the resilience of police officer.&#xD;
&#xD;
Subjects&#xD;
&#xD;
This study, conducted for a police officer in G city and Y city in Gangwondo Province. The purpose of this research understood and it conveniently extracted to those who voluntarily agreed to participate in the research. The number of samples was calculated by using G*Power 3.1.5 program for multiple regression analysis, the significance level was calculated as 0.05, the power was 0.95, the effect size was 0.15, and the final sample size was 138 people. 160 copies distributed in consideration of the number of dropouts, and 155 copies collected. Among them, 150 data used for the final analysis except for five cases where the response was insufficient.&#xD;
&#xD;
Research tools&#xD;
&#xD;
Social support&#xD;
&#xD;
Social support tools developed by Park were used.19 The tool consists of the subdomain of emotional support, informative support, material support, and evaluative support. 25 questions, a 5-point Likert scale, means that the higher the score, the higher the social support. The Cronbach&amp;#39;s value in the study of Park was 0.95, and the Cronbach&amp;#39;s value by this study was 0.98.&#xD;
&#xD;
Resilience&#xD;
&#xD;
Resilience means a combination of capabilities and characteristics that includes a process of dynamic interaction, allowing individuals to recover from their original state, adapt successfully and adapt to their physical condition despite stress or to interact dynamically.20 It was Baek translated the Resiliency measurement tool developed by Connor and Da vidson (K-CD-RISC: Korean Connor Da vidson Resilience Scale).21,22 The tool consists of five sub-factors: robustness, persistence, optimism, support, and spirituality. It was composed of a 5-point Likert scale with totally of 25 items. Cronbach&amp;#39;s &#x3B1; value stood at 0.93. Cronbach&amp;#39;s &#x3B1; value in this study came to 0.94.&#xD;
&#xD;
Data collection &#xD;
&#xD;
Data collection made through the one-to-one interview with each individual with a researcher and three research assistants, who trained in advance, from October 1, 2019, to November 30. A structured questionnaire used in subjects with the written consent of participating in the research. 160 copies distributed in consideration of the number of dropouts, and 155 copies collected. Among them, 150 data used for the final analysis except for five cases where the response was insufficient.&#xD;
&#xD;
Data analysis&#xD;
&#xD;
The collected data analyzed using the SPSS 21.0 program. The details are as follows. The collected data analyzed using the SPSS 21.0 program as follows. Resilience and social support level, according to the demographic characteristics of the subjects analyzed with descriptive statistics, t-test, ANOVA, and post-test used for Scheff&amp;#39;s test. The correlations between resilience and social support analyzed using Pearson&amp;#39;s correlation. The effects of the resilience analyzed by multiple regression.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
Differences in resilience and social support according to the characteristics of the subjects &#xD;
&#xD;
Resilience differences in general characteristics were statistically significant with is gender (t=3.58, p</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3430</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3430</Fulltext></URLs><References>[1]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Lee SH, Kim DH. The relation of job stress and depression of police officers who worked in local patrol division: Focusing on the moderating effects of resilience. Korean Asso. Police Sci Rev 2017;16(3):281-310.&#xD;
&#xD;
[2]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Park YJ. High stress job. National Police Agency. Korea. 2013.&#xD;
&#xD;
[3]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Park SS. A study on the effect of stress on the turnover of police. Korean Assoc Pub Safety Crim Justi 2002;13:99-135. &#xD;
&#xD;
[4]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Kim JH, Kim JK. The relation of a type of traumatic events and posttraumatic stress disorder (PTSD) symptoms of police officers: focusing on the moderating effects of stress coping style. Korean Police Stud Rev 2013;12(3):27-50.&#xD;
&#xD;
[5]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Kim SY, Gu JT, Yoon GC. Analysis of job stress levels and causal factors of front line police officers. Korean J Public Admin 2002;41(1):123-147.&#xD;
&#xD;
[6]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Joseph JK, Nagarajamurthy B. Stress in police officers. Int Org Sci J Humanities Soc Sci 2014;19(10):39-40.&#xD;
&#xD;
[7]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Lee JH. Effect of police officer&#x2019;s stress coping strategy on job stress and attitudes toward seeking professional counseling. Unpublished master&#x2019;s thesis). Kyonggi University, Kyonggi, Korea. 2013:84.&#xD;
&#xD;
[8]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Gershon RR, Lin S, Li X. Work stress in aging police officers. J. Occupat Env Med 2002;44(2):160-167. &#xD;
&#xD;
[9]&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Lee KJ. Effect of social support to baby boomer on self-efficacy and retirement attitude (Doctoral dissertation). Daegu Haany University. Gyeongsangbukdo. Available from http://www. riss. kr/link. 2015:96.&#xD;
&#xD;
[10]&#xA0;&#xA0;&#xA0;&#xA0; Jang DSL. An analysis of influence of self-efficacy and social support on job satisfaction and organizational commitment. (Doctoral dissertation). Kookmin University. Korea 2016:11.&#xD;
&#xD;
[11]&#xA0;&#xA0;&#xA0;&#xA0; Lim YH. The mediating effect of career decision-making self-efficacy on the relationship between social support awareness and career preparation behavior of career-break women. Master&#x2019;s Thesis. Korea University. Korea. 2012:89.&#xD;
&#xD;
[12]&#xA0;&#xA0;&#xA0;&#xA0; Ryu JS. The structural relationships among social support, family resilience, self-determination, commitment to career choice and career preparation behavior of undergraduate students. The Graduate School Chungbuk National University. 2012:131.&#xD;
&#xD;
[13]&#xA0;&#xA0;&#xA0;&#xA0; Kang MH, Lee SY. The mediating effects of hope and ego-resilience on the relationship between adolescents&amp;#39; academic stress and psychological well-being. Korean J Youth Stud 2013 Jun;20(20):265-293.&#xD;
&#xD;
[14]&#xA0;&#xA0;&#xA0;&#xA0; Block JH, Block J. The role of ego-control and ego-resiliency in the organization of behavior. In Minnesota symposia on child psychology.&#xA0; 1980;13:39-101.&#xD;
&#xD;
[15]&#xA0;&#xA0;&#xA0;&#xA0; Howard S, Johnson B. Tracking student resilience. Children Australia. 1999;24(3):14-23.&#xD;
&#xD;
[16]&#xA0;&#xA0;&#xA0;&#xA0; Block J, Kremen AM. IQ and ego-resiliency: conceptual and empirical connections and separateness. J Pers Soc Psych 1996;70(2):349.&#xD;
&#xD;
[17]&#xA0;&#xA0;&#xA0;&#xA0; Park JW. A study to development a scale of social support. Unpublished doctoral dissertation, Yonsei University, Seoul. 1985. &#xD;
&#xD;
[18]&#xA0;&#xA0;&#xA0;&#xA0; Lee KH, Lee SW. Concept analysis of resilience. Korean J Stress Res 2005;13(1):9-18.&#xD;
&#xD;
[19]&#xA0;&#xA0;&#xA0;&#xA0; Baek HS, Lee KU, Joo EJ, Lee MY, Choi KS. Reliability and validity of the Korean version of the Connor-Davidson Resilience Scale. Psychiatry investigation. 2010;7(2):109.&#xD;
&#xD;
[20]&#xA0;&#xA0;&#xA0;&#xA0; Connor KM, Davidson JR. Development of a new resilience scale: The Connor?Davidson resilience scale (CD?RISC). Depression Anxiety 2003;18(2):76-82.&#xD;
&#xD;
[21]&#xA0;&#xA0;&#xA0;&#xA0; Bae JM. The relationships among job stressors, job satisfaction and organizational commitment of police officials-focusing on moderating effects of social support. Fire Sci Engg 2014;28(6):99-107.&#xD;
&#xD;
[22]&#xA0;&#xA0;&#xA0;&#xA0; Yoon, HS. The mediating effect of social support on the relationship between ego-resiliency and job enthusiasm in the police. Police Sci Inst 2017;31(3):311-350.&#xD;
&#xD;
[23]&#xA0;&#xA0;&#xA0;&#xA0; Kwon HR, Joo JJ. Validation of police officer Ego-resilience scales &amp; measurement. KAPSR 2017;19(19):245-273.&#xD;
&#xD;
[24]&#xA0;&#xA0;&#xA0;&#xA0; Kaufmann GM, Beehr TA. Interactions between job stressors and social support: Some counterintuitive results. J Appl Psychiat. 1986;71(3):522.&#xD;
&#xD;
[25]&#xA0;&#xA0;&#xA0;&#xA0; Baruch-Feldman C, Brondolo E, Ben-Dayan D, Schwartz J. Sources of social support and burnout, job satisfaction, and productivity. J Occupat Health Psychol 2002;7(1):84.&#xD;
&#xD;
[26]&#xA0;&#xA0;&#xA0;&#xA0; Lee, JY., Choi YY.&#xA0; The effect of cognitive emotion regulation and stress coping strategy on psychological well-being of college students: mediated by social support. Counsel Res 2012;13(3):1481-1499.&#xD;
&#xD;
[27]&#xA0;&#xA0;&#xA0;&#xA0; Hwang IH, Lee YH. Influences of police officers&amp;#39; job stress and traumatic stress on burnout. Korean J Psychol Gen 2012;31(4):1115-1138.&#xD;
&#xD;
[28]&#xA0;&#xA0;&#xA0;&#xA0; Kim KK. A study on influence of police officer&#x2019;s job stress on organizational commitment based on resilience. PhD&#x2019;s Thesis. Daegu University. Korea 2019:144.&#xD;
&#xD;
[29]&#xA0;&#xA0;&#xA0;&#xA0; Kim SH. The relative influence of job stress on burnout of police officers. The Korean Ass. Police Sci Rev 2014;48:3-25. &#xD;
&#xD;
[30]&#xA0;&#xA0;&#xA0;&#xA0; Cohen S, Hoberman HM. Positive events and social supports as buffers of life change stress 1. J App Soc Psychol 1983;13(2):99-125.&#xD;
&#xD;
[31]&#xA0;&#xA0;&#xA0;&#xA0; Jeong CW. A study on job stress management of police officers - Focusing on personality-oriented self-management. Police Welfare Studies 2017;5(2):241-266.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Application of Newly High-performance ActiveLysine Modified Silica Monolith for Non-steroidal Anti-inflammatory Drugs Extraction&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>11</FirstPage><LastPage>19</LastPage><AuthorList><Author>Owidah Z</Author><AuthorLanguage>English</AuthorLanguage><Author> Jilani AL</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: The drug analyses processes include a number of steps starting from samples collection to the final reporting of the results. The process of the drug extraction is usually, time consuming, labour-intensive, complex and prone to contamination. Therefore, the drug extraction can be considered to be one of the most important stages because it is a possible source of inaccuracy in the overall analysis. Objective: The aim of this work is fabricating a new material with the ability to pre-concentrate drugs of abuse in biological fluids with high extraction efficiency. This was achieved by the fabrication of silica-based monolithic materials, followed by chemical on column modifications of the silica surface with active lysine groups. Method: The columns modifications were characterised by using different analytical techniques, such as Brunauer EmmettTeller (BET) analysis and scanning electron microscopy (SEM) coupled with energy dispersive X-ray (EDAX) analysis. Result: In this study, the isolation of non-steroidal anti-inflammatory drugs (NSAIDs), namely acetylsalicylic acid and ibuprofen (IBP), was achieved successfully by using an active lysine silica monolith in which the drugs were adsorbed on solid support while any contaminants were removed by washing the monolithic materials; finally the purified drugs were eluted from the monolithic material. Conclusion: The promising results indicated that the extraction efficiencies of the two NSAIDs were both more than 85%. Linearity was obtained in the range of 10-100 ng ml-1. The intra- and inter-monolithic columns indicated good monolith reproducibility, with relative standard deviations (RSDs) of less than 4.4% and 6.1%, respectively.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Quality of Life (QOL), Rectal Cancer, High Anterior Resection (HAR), Low Anterior Resection (LAR), Abdominoperineal Resection (APR)</Keywords><Fulltext>Introduction&#xD;
&#xD;
Worldwide today, the utilisation of over counter medicine such as non-steroidal anti-inflammatory drugs (NSAIDs) are the most commonly used as analgesics and an antipyretic. Mainly it used to treat arthritis due to its analgesic and antipyretic properties also, utilised for the treatment of pain, inflammation, vascular headaches and fever.1,2 However, excessive NSAIDs consumption in cases of overdose or chronic abuse can lead to toxic effects include: 1) increased risk of developing renal or hepatic liver tumours; 2) reduced platelet function; 3) changes in kidney function, and 4) prolongation of pregnancy or childbirth on their own.3 To improve NSAID therapy management for long-term, the monitoring of NSAIDs is considered the importance management factor.4 Therefore, it is important to develop a suitable specific and sensitive analytical method to monitor the levels of NSAID compounds in biological samples.5-8&#xD;
&#xD;
Sample preparation is an essential step in the most analytical instruments to pre-concentrate the analytes of interest or to remove any interfering materials. So far, different sample preparation methods including liquid-liquid extraction (LLE)5-7 and solid-phase extraction (SPE)8-11 have been used for determination and pre-concentration of low levels of NSAIDs from diverse sample matrices. However, LLE is labour-intensive, time-consuming, complicated, non-selective and emulsion formation and carried out depend on hazardous organic solvents.12-14 &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xA0;To overcome these drawbacks the SPE technique has been considered due to its ease of use, being relatively rapid, and being easy-to-automate, portable, and solvent-free.15,16 Many materials can be used as SPE-sorbents including inorganic monolithic materials and organic monolithic materials. In fields of inorganic polymer monolithic material, many publications focused on the extraction of different types of drugs17-19 and Though, there are some drawbacks with organic monolithic materials, such as low mechanical stability, poor hydrophobicity and small surface area, therefore, the widespread application for drug extraction is limited by using inorganic monolithic materials.1,5,6 &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The major goal of the present work is fabricating an inorganic high performance modified monolithic material which followed by surface modifications with active lysine groups to form ion-exchange materials.7 The silica surface was chemically modified with lysine using a 3-glycidoxy propyltriethoxy silane linkage to get a stable ion-exchange stationary phase.20 The silica was fabricated in a plastic syringe to get rode shape, to use for aspirin and ibuprofen extraction from the biological matrix.&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; A new anion-exchange/hydrophobic monolith as a stationary phase for nano liquid chromatography of small organic molecules and inorganic anions. Characterisation of the lysine modified monolithic materials was carried out using different techniques to study the morphological, chemical, and physical properties. Also, the chromatographic performance (retention time) or extraction efficiency (recovery of target analytes) was evaluated. &#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
Chemicals and Materials&#xD;
&#xD;
Tetraethyl ortho-silicate (TEOS), tetra-methyl-ortho-silicate (TMOS), anhydrous toluene, ammonia, nitric acid, HPLC-grade methanol and acetonitrile (ACN) were purchased from Fisher Scientific ( Loughborough, UK). Polyethene oxide (PEO) with an average relative molecular mass MW of 10,000 Da, acetic acid, 3-Glycidyloxypropyl) tri-methoxy-silane (GPTMS), sodium phosphate dibasic, sodium phosphate monobasic, acetylsalicylic acid, ibuprofen and lysine were purchased from Sigma-Aldrich (Poole, UK). The plastic disposable syringes were purchased from Scientific Laboratory Supplies and Falcon&#x2122; conical centrifuge tubes were purchased from Scientific Laboratory Supplies (Nottingham, UK).&#xD;
&#xD;
Instrumentation&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The scanning electron microscope (SEM) was a Cambridge S360 instrument (Cambridge, UK) and the energy-dispersive X-ray spectroscopy (EDAX) system was an INCA 350 EDX system, Oxford Instruments (Abingdon, UK). The samples for SEM analysis were coated with a thin layer of gold-platinum (thickness approximately 2 nm) using a SEMPREP 2 Sputter Coater [Nanotech Ltd., Sandy, UK]. The scanning electron images of silica monoliths were obtained using an accelerating voltage of 20 kV and a probe current of 100 pA in high vacuum mode. A hot-plate stirrer from international LLC (West Chester, PA, USA) was used. The Brunauer Emmett-Teller (BET) form Micromeritics Ltd. (Dunstable, UK) model was used for a surface area and porosity analysis. High-temperature muffle furnace from Laboratory Instruments Ltd (Wertheim, Germany) was used. High-performance liquid chromatography (HPLC) system with a 785A UV/Visible Detector from PerkinElmer (California, USA) was used. The symmetry C18 column, 150 x 4.6 mm packed with5 &#x3BC;m silica particles, was purchased from Phenomenex (Torrance, CA, USA).&#xD;
&#xD;
Fabrication of the lysine silica monolith column&#xD;
&#xD;
The fabrication of the silica-based monoliths was carried by the hydrolysis and poly-condensation of precursors using the procedure reported by Nakanishi21 with some modifications to the composition and experimental conditions. The reagents of the silica-based monolith were mixed inside a 50 ml polyethene centrifuge tube which was located in an ice bath to promote the sol-gel reaction. The desired amount of polyethene oxide 0.282 g with an average relative molecular mass (MW=100,000) was mixed with 2.537 ml of 1 M nitric acid and 0.291 ml of distilled water or 4 ml of (0.02M) acetic acid. The solution was then mixed using a magnetic stirrer for 30 min while the polymer fully dissolved. Then, 2.256 ml of tetraethyl ortho-silicate (TEOS) or tetra-methyl-ortho-silicate (TMOS) was added to the transparent solution and mixed for 30 min. until the two-phase mixture gradually became the homogeneous solution.5-8&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The disposable plastic syringe (1 ml, internal diameter 4.5 mm) was used as the mould to obtain bar or column-shaped monoliths for the homogeneous mixture. the syringe was sealed at the outlet end with polytetrafluoroethylene (PTFE) tape and then 0.8 ml of the resulting homogeneous mixture was poured slowly down the inside of the syringe which was then shaken carefully to remove any air bubbles. The inlet end of the syringe was closed with a small lid and sealed tightly with PTFE tape as well.&#xD;
&#xD;
Finally, the syringe was placed upright in a glass beaker and left in the oven at 40&#xB0;C 24 hours. After that, the monolithic column was removed from the plastic and then placed in a purified water bath to remove any possible residue. Following washing, the resulting monolithic column was treated with 30 ml of 1 M aqueous ammonia solution in a100 mL of the conical flask at 85 &#xBA;C for 24 hours. Then, the resulting monolithic column was rinsed with distilled water for 8 hours and the water changed every 2 hours until a neutral pH was obtained. The monolithic columns were then placed in the oven for 6 hours at 40&#xB0;C, followed by a further 3 hours at 100&#xB0;C. Finally, the columns were placed in the oven at 500&#xB0;C for 3 hours.20-22&#xD;
&#xD;
Modification of the silica monolith surface with lysine groups&#xD;
&#xD;
The surfaces of the monolithic silica column were covalently modified with lysine to obtain ion exchange phase. This was achieved by generating the desired epoxy, diol, and lysine bonded phases in three main steps as reported by.22&#xD;
&#xD;
The monolithic column was continuously fed with a mixture of 1 ml of 3-glycidoxy propyl trimethoxysilane (GPTMS) in 10 ml of anhydrous toluene was pumped for three hours. Next, the monolithic column was placed in an oven at 110&#xB0;C for 1 hour and the epoxy monolith was then thoroughly washed with 1 ml of toluene and then with 1 ml of methanol to clean the column of any residue. To convert the epoxy groups to diols, a 1 ml aliquot of 0.1M hydrochloric acid was passed through the column for 2 hours and then placed in the oven at 60 oC for 1 hour and then washed with 1 ml of purified water and 1 ml of methanol. Finally, the lysine phase was achieved by continuously flowing a mixture of 1 M lysine solution through the monolithic column 2 hours. Subsequently, the monolithic column was placed in the oven at 75oC for 1 hour. The 1 M lysine solution was prepared by dissolving 4.38g of lysine in 50 ml of 50 mM of phosphate buffer at pH 8. Finally, the resulting lysine-bonded phase was rinsed with 1 ml of purified water and 1 ml of methanol at a flow rate of 20 &#x3BC;l min-1 at room temperature.9,10 &#xD;
&#xD;
Characterisation of the fabricated materials&#xD;
&#xD;
The morphology of the prepared silica monolith was characterised using scanning electron microscopy (SEM). To determine changes of the chemical composition of the internal surface of the silica-based monolith before and after modification with lysine, the energy dispersive analysis of X-ray spectroscopy (EDAX) was performed. Besides, a Brunauer-Emmett-Teller (BET) instrument was used to measure the surface area, pore size, and pore volume within the monoliths using nitrogen adsorption and desorption isotherms at 77 K. The pore volume and pore size distribution within the monoliths were also determined from isotherms using the Barrett-Joyner-Halenda (BJH) model. A small piece of the monolithic column was weighed and placed into the BET instrument for analysis.23-26&#xD;
&#xD;
Drug Extraction&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Acetylsalicylic acid and ibuprofen were prepared separately by dissolving an accurately weighed amount of each drug in 20 mM acetate buffer at pH 4.7 to achieve a concentration of 100 ng ml-1. All stock solutions were stored at 4 &#xB0;C. Concentrations of the working of 80, 60, 40, 20&#xA0; and 10 ng ml-1 were freshly prepared by diluting the stock solution in the appropriate buffer and stored at 4 &#xB0;C.&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The lysine monolithic column was cut (1 cm) and placed inside the plastic syringe, which was used as a mould. The steps commonly involved in the solid-phase extraction (SPE) procedure are used as follows: conditioning and equilibration of the adsorbent, loading of the sample, removing of impurities (washing) and eluting of the target analyte. All steps in the extraction procedure used a flow rate of 20 &#x3BC;l min-1. Cleaning and conditioning of the column were carried out with 1 ml of water and then 1 ml of the 20 mM acetate buffer at pH 4 which was used for preparing the working solution. The standard solution (500 &#xB5;L) was loaded into the column and then washed three times with the buffer. Finally, the elution step was carried out using 20 mM phosphate buffer pH 7 and the elute was collected into an Eppendorf tube for further analysis using the HPLC system.11-15&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The chromatographic analysis was performed using HPLC with a UV detector to determine extraction efficiency by comparing the peak areas of the analyte (drug) extraction with the peak areas of the non-processed analyte standard solutions. The mobile phase used is acetonitrile (ACN) and 50 mM of phosphate buffer at pH 5.0 with isocratic conditions (50:50) at ambient temperature (around 23&#xB0;C). The sample injection volume was 20 &#x3BC;l, the flow rate was set to 1 ml min1, and the detection wavelength was adjusted to 230 nm. The extraction recovery (ER) was calculated by the following equation as reported by Miyazaki et al.23 &#xD;
&#xD;
&#xD;
&#xD;
Where Ielute is the amount of analyte eluted from the sorbent, and Itotal is the amount of analyte introduced into the sorbent.&#xD;
&#xD;
Result and discussion&#xD;
&#xD;
Formation of a Sol-gel Silica Monolith &#xD;
&#xD;
In this study, it was decided that silica monolith would be fabricated and followed by modification of the surface with lysine as a sorbent for the extraction of NSAIDs. The formation of the sol is based on hydrolysis and condensation reactions of the metal alkoxides precursors, either TMOS or TEOS.24,25 The composition of the starting mixture was a metal alkoxide, either TMOS or TEOS. The fabrication procedures using a sol-gel process involving two kinds of reactions: hydrolysis of the sol-gel precursor and polycondensation of the hydrolysed products.24 25 The initial solution also contains a water-soluble polymer such as polyethene oxide (PEO) acting as a porogen to form the macropores and micropores in the silica gel.26,27&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Also, a catalyst is used which can be an acid catalyst (such as acetic acid or nitric acid), It is known that TMOS is undergoing more rapid hydrolysis in the sol-gel process than TEOS. A weak acid such as acetic acid was therefore used for hydrolysis of TMOS, while a strong acid such as nitric acid was chosen as a catalyst for TEOS, as reported in the literature.28,29&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; At the mixing step, the partially polymerised solution is then poured into a mould before its viscosity becomes too high. This casting process can be influenced by several factors such as the shape of the mould which determines the final shape of the monolithic column product. In this work, the aplastic 1 ml syringe was used as the mould for the fabrication of silica monoliths. After the polymerisation and drying process, shrinkage of the monolithic structure enabled the silica rods to be released easily from the plastic syringe.&#xD;
&#xD;
The monolithic rods were then treated with an aqueous 1 M ammonia solution at 80oC for 24 hours to produce the mesoporous. The formation of the mesopores on the monolithic silica surface is vital to obtain a high surface area.Besides increasing surface area, the ammonia hydrothermal treatment increases the mechanical strength of the monolithic structure.30-34 The wet gel monolith is then dried in an air-circulating oven to remove the majority of the solvents used at 40 &#xBA;C. After drying, subsequent heat treatment is carried out at a high temperature at 500 oC for 3 hours to decompose the organic residues without serious deformation of the monolithic structure. Besides, the mechanical stability the monolith increases as a result of calculations and a bright white and crack-free monolith was formed.27,35&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; To identify the effect of each step of the sol-gel process on the internal structure of the silica monoliths, SEM was obtained. Figure 1and Figure 4 shows the internal structure of the TEOS silica monolithic rods during the fabrication process. Figure 1(A) the SEM image of TEOS after the gelation step and before treatment with ammonia. The through pores which give the macroporous structure can be seen and the surfaces can be seen to be smooth. Figure 1 (B) shows the SEM image of TEOS after hydrothermal treatment by ammonia 1M NH4OH, and Figure 1 (C) shows the SEM image of TEOS after the calcination step at 500&#xB0;C for 3 hours.&#xA0; &#xD;
&#xD;
&#xD;
&#xD;
Figure 1: The internal structure is analysed for the fabrication steps using SEM images for silica monolithic rods consisting of TEOS + PEO (100K) + 1 M nitric acid (A) before 1 M NH4OH treatment (B) after 1 M NH4OH treatment (C) after 1 M NH4OH treatment and calcination. The scale bar is 1 &#xB5;m &#xA0; &#xA0; &#xA0;&#xA0;&#xD;
&#xD;
It can be seen that the surface of the silica monolithic rods changes after hydrothermal treatment, becoming rougher. This rough surface is an indication that mesopores have been tailored inside the surface skeleton by a dissolution re-precipitation process, where the dissolution of the silica occurs on the convex surface and reprecipitation occurs on the concave surfaces. Also, it can be seen that there is no significant difference in general morphology comparing the SEM images of the monolith before and after calcination step.30,31&#xD;
&#xD;
Modification with lysine groups&#xD;
&#xD;
Once the silica monolithic column was prepared, it was then modified with lysine. Surface modification of the silica-based monolith was carried out on-column by a continuous flow of the reagents through the porous monolithic silica column inside the heat-shrinkable tube. A system was designed to allow a solid-phase extraction process to occur within a monolithic rod. Figure 2 shows how the monolith rod was sealed within a heat-shrinkable Polytetrafluruoroethylene (PTFE) tube and connected to the borosilicate tube.&#xD;
&#xD;
&#xD;
&#xD;
Figure 2: The monolith rod sealed within a PTFE tube and connected to the borosilicate tube.&#xA0; &#xA0; &#xA0;&#xA0;&#xD;
&#xD;
The resulting silica monolithic rod within the heat-shrinkable tube was then ready to be prepared for either surface modification or the solid phase extraction process. This method was very effective and there was no leakage during the continuous flow chemical reaction. The syringe pump was connected to the tubing using a two-piece finger-tight fitting.&#xD;
&#xD;
In this study, the monolithic silica rod was chemically modified with lysine. The three main steps involved are shown in Figure 3. Scheme (A) in Figure 3 shows the first step where 3- glycidoxypropyltrimethoxysilane (GPTMS) was covalently bonded to the surface of a silica monolith in order to form an epoxy surface monolith. The trimethoxysilane group reacted with the silanol groups (Si-OH) on the surface of thesilica-based monolith, while the glycidyl functional groups offered the necessary active sites for other components to be further immobilised. In the second steps (B) of Figure 3, a diol was generated by treatment with hydrochloric acid. Finally the GPTMS-modified silica was reacted with lysine and the primary amino groups in the lysine form a secondary amino group, as can see in Figure 3 scheme (C)&#xD;
&#xD;
&#xD;
&#xD;
Figure 3: The schematic reaction pathways for the generation of the lysine bonded monolith in three steps&#xD;
&#xD;
Characteristics of the fabricated materials:&#xD;
&#xD;
The structural morphology of the lysine modified monolithic rods was examined by SEM analysis to investigate the effect of the surface modification. The SEM image was acquired for the tetraethyl orthosilicate (TEOS) monolithic silica prepared with polyethylene glycol (PEO) 200 K, and Figure 4 shows the internal structure of the TEOS monolithic silica during the modification process steps. Figure 4- (A) shows the SEM image of the TEOS monolithic silica before modification. Figure 4 (B) shows the image after the sanitation process with GPTMS. Figure 4 (C) shows the monolithic silica after the complete lysine modification process.&#xD;
&#xD;
&#xD;
&#xD;
Figure 4. SEM images for the TEOS monolith column during the lysine modification process. (A) The monolithic column before modification. (B) The monolithic column after silanisation by GPTMS. (C) The monolithic column after lysine modification&#xD;
&#xD;
Figure 4 shows a homogeneous morphology during the modification process and there are no significant differences in comparing the SEM images of the monoliths before and after modification with lysine. It was expected that the size of the pores of the amino-modified silica monolith would decrease due to the attaching of the lysine onto the inner surface of the pores; however, it was observed that the structural morphology of both samples was similar and there were no significant differences in the through pores for the monolith before and after the modification process.32,33 Further examination of the physical properties of the lysine modified monolithic column was carried out by comparing the surface area and pore volumes before and after modification. Table 1 illustrates the calculated specific surface area (BET method) for TEOS prepared with PEO 200 K after the modification process.&#xD;
&#xD;
&#xD;
&#xD;
The results in Table 1 show that the surface area decreased as a result of the lysine modifications process from 352 to 312 m&#xB2; g-1, a reduction of approximately 11%. Whilst there is no significant change in the size of the mesopore and the through pores diameter of modified monolithic column comparing with the result of the non-modified monolithic column in as seen Table 1. The reason for the decrease in surface area after modification could be due to blocking of the micropore access (at scales less than 2 nm) in the silica-based monolith by the bonded phase (lysine chains attached to the silica surface), thus confirming the modification of the surface with lysine groups.36, 37&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; EDAX or EDX analysis for elemental characterisations was carried out to confirm the modification process by comparing the chemical composition of the monolithic silica column during the modification process. Figure 5 (A) &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;shows the EDX spectra of the bae monolithic silica with the percentage of elements detected being 7, 49, and 45 for C, O, and Si, respectively. Figure 5 (B) silica-based monolith after silanisation with GPTMS with the percentage of elements detected being 14, 46, and 40 for Si, C, and O, respectively. While Figure 5 (C)&#x200E;of the lysine silica-based monolith shows a peak for nitrogen (N) on the monolithic surface after lysine modification, this peak was not present in the other spectra.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Figure 5&#xA0;(A) EDX spectra of the 1-non-modified silica-based monolith, (B) silica-based monolith after silanisation with GPTMS and (C) silica-based monolith after lysine modification steps&#xD;
&#xD;
The corresponding EDX analysis as shown in figure 5 indicates that the monolithic silica is mainly composed of silicon (Si), carbon (C), and oxygen (O). During the modification process, the percentage of carbon increased from 6.78 to 13.96% after glycidyloxpropyl trimethoxysilane (GPTMS) silanisation, indicating that the silanisation process was successful. Further modification of the silica surface with lysine leads to the percentage of carbon increasing to 18.5%. Figure 5 shows the lysine silica-based monolith peak for nitrogen (N) which was discovered on the monolithic surface after lysine modification.34,35 This peak was not present in the other spectra. Na and Cl spectra were also observed with a very low percentage after the lysine modification process and this could have come from the lysine solution, or the H2O used during washing. This indicates that the monolithic surface was successfully modified by the lysine groups.&#xD;
&#xD;
Extraction of drugs&#xD;
&#xD;
The fabricated of lysine-TEOS columns was also investigated for the extraction of NSAIDs. In this work, acetylsalicylic acid and ibuprofen were chosen as a model which are acidic compounds due to their pKa values of 3.5 and 4.4 respectively. At a pH greater than 4, most of the drug will be in the ionised form with a negative charge. This value is compatible with the pH range of lysine in zwitterionic state at between 4 and 8 where the lysine can have a positive and negative charge. The mechanism of acidic drug capture with an anion-exchanger depends on the pH of the solution. At pH 4, the amino group in the lysine is positively charged and electrostatic interaction with the negatively charged acidic drug can occur. &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Recoveries of acetylsalicylic acid and ibuprofen as acidic drugs were determined by using High performance liquid chromatography (HPLC-Uv) system. A 400&#x3BC;l aliquot of a mixed 100 ng ml-1 acetylsalicylic acid and ibuprofen standard was passed through the lysine modified column using the syringe pump at a flow rate of 20&#x3BC;l min-1. The recovery of the target analytes was calculated by comparing the chromatographic peak areas after direct injection of standard samples with those obtained by the same samples after extraction. The percentage recovery of the target analytes was plotted on a bar chart as shown in Figure &#x200E;6.&#xD;
&#xD;
&#xD;
&#xD;
Figure 6: The extraction profile for 100 ng ml-1 of ibuprofen and acetylsalicylic acid using lysine modified column and the average recovery percentage was derived from three consecutive experiments and the error bars indicate one standard deviation&#xD;
&#xD;
The extraction profile data present in Figure &#x200E;6 demonstrates the efficient recovery of acetylsalicylic acid and ibuprofen at 89% and 83%, respectively using the TEOS lysine modified column. The remaining small amount of analyte was retained in the column. In general, the TEOS modified lysine column showed good selectivity towards a mixture of acidic drugs and the column enabled efficient extraction.36-38&#xD;
&#xD;
The method for extraction recovery was evaluated in terms of linearity, LOD, LLOQ, and precision to verify the reliability and applicability of lysine-TEOS columns in extracting acidic drugs when analysed using HPLC with UV detection. Standard solutions of acetylsalicylic acid and ibuprofen at concentrations of 100, 80, 60, 40, 20 and 10 ng ml-1 were analysed by HPLC three consecutive times and the peak areas were plotted against concentration as presented in Figure 7.&#xA0; &#xD;
&#xD;
&#xD;
&#xD;
Figure 7: Calibration curve of acetylsalicylic acid and ibuprofen standard solutions with peak areas plotted versus the concentration in &#x3BC;g ml-1&#xD;
&#xD;
Calibration curves for the target analytes showed a good linearity over the range used and a correlation coefficient (R2) more than 0.9984. LOD and LLOQ were calculated and summarised in Table 2 and 3.&#xD;
&#xD;
&#xD;
&#xD;
&#xA0; &#xA0; &#xA0; &#xA0; &#xA0;The precision performance of the lysine-TEOS column for extraction was evaluated in terms of repeatability (within-day) and reproducibility (between-day) from the results of the peak areas of each reference standard. In this study, different concentrations were used: low (10ng ml-1), medium (50ng ml-1), and high (100ng ml-1). Each analysis was carried out in triplicate on the same day to determine within-day precision. The same procedure was repeated over three consecutive days in triplicate using the same lysine modified column to obtain the inter-day precision as shown in Table 3. The intra-day %RSD was in the range from 2.7 to 4.3% and the inter-day %RSD in the range from 3.7 to 6.1% for the examined concentrations. These results indicate that using lysine-TEOS columns for extraction could provide good reliability and applicability NSAIDs, as the %RSD values were less than the acceptable limit of 15%.38&#xD;
&#xD;
&#xD;
&#xD;
Conclusions&#xD;
&#xD;
In this study, the fabricated lysine silica monolithic column was successfully synthesized by the on-column reaction of lysine with GPTMS-modified silica TEOS monolith which, successfully trap and extract of NSAIDs. The fabricated materials were also studied by using different analytical techniques. Furthermore, the synthesized lysine silica monolith exhibited structure quality and reproducibility with good extraction stability. &#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3431</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3431</Fulltext></URLs><References>1.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Luo YB, &#xA0;Zheng H,&#xA0; Wang J,&#xA0; Gao G,&#xA0; Yu Q,&#xA0; Feng Y. An anionic exchange stir rod sorptive extraction based on monolithic material for the extraction of non-steroidal anti-inflammatory drugs in environmental aqueous samples. Talanta 2011;86:103-108.&#xD;
&#xD;
2.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Bempong DK, &#xA0;Bhattacharyya L. Development and validation of a stability-indicating high-performance liquid chromatographic assay for ketoprofen topical penetrating gel. J Chromatogr A 2005;1073(1-2):341-346.&#xD;
&#xD;
3.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Hu T, Ting H,&#xA0;Tao P,&#xA0;Xiao J,&#xA0;Dong C,&#xA0;Han H,&#xA0;et al. Simultaneous determination of thirty non-steroidal anti-inflammatory drug residues in swine muscle by ultra-high-performance liquid chromatography with tandem mass spectrometry. J Chromatogr A 2012; 12(19):104-113.&#xD;
&#xD;
4.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Sarafraz-Yazdi A, Amirhassan A,&#xA0;Gholamhossein R,&#xA0;Hossein EH. Determination of non-steroidal anti-inflammatory drugs in urine by hollow-fibre liquid membrane-protected solid-phase microextraction based on sol-gel fibre coating. J Chromatogr B 2012;908:67-75.&#xD;
&#xD;
5.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Noche GG, Eric M. In situ aqueous derivatization and determination of non-steroidal anti-inflammatory drugs by salting-out-assisted liquid-liquid extraction and gas chromatography-mass spectrometry. J Chromatogr A 2011;1218(37):6240-6247.&#xD;
&#xD;
6.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Ro&#x161;kar R, and Kmetec V. Liq chromatographic determination of diclofenac in human synovial fluid. J Chromatogr B 2003;788(1):57-64.&#xD;
&#xD;
7.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Lo D, Mike V. Acidic and neutral drugs screen in blood with quantitation using microbore high-performance liquid chromatography&#x2013;diode array detection and capillary gas chromatography&#x2013;flame ionization detection. Foren Sci Int 1997;90(3):205-214.&#xD;
&#xD;
8.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Migowska N, Chen W, Young C. Simultaneous analysis of non-steroidal anti-inflammatory drugs and estrogenic hormones in water and wastewater samples using gas chromatography-mass spectrometry and gas chromatography with electron capture detection. Sci Total Envt 2012;441:77-88.&#xD;
&#xD;
9.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Rezaei F, Moradi M. Solid-phase extraction as a cleanup step before microextraction of diclofenac and mefenamic acid using nanostructured solvent. Talanta 2013;105:173-178.&#xD;
&#xD;
10.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Madrakian T, Mazaher A,&#xA0;Abbas A,&#xA0;Mohammad S. Selective solid-phase extraction of naproxen drug from human urine samples using molecularly imprinted polymer-coated magnetic multi-walled carbon nanotubes prior to its spectrofluorometric determination. Analyst 2013;138(16):4542-4549.&#xD;
&#xD;
11.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Lyu DY, Yang CX, Yan XP. Fabrication of aluminium terephthalate metal-organic framework incorporated polymer monolith for the microextraction of non-steroidal anti-inflammatory drugs in water and urine samples. J Chromatogr A 2015;1393:1-7.&#xD;
&#xD;
12.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Vas G, Vokey K. Solid?phase microextraction: a powerful sample preparation tool before mass spectrometric analysis. J Mass Spectr 2004;39(3): 233-254.&#xD;
&#xD;
13.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Fan Y, Yu-Qi F,&#xA0;Shi LD,&#xA0;Zhong HW. In-tube solid-phase microextraction using a &#x3B2;-cyclodextrin coated capillary coupled to high-performance liquid chromatography for determination of non-steroidal anti-inflammatory drugs in urine samples. Talanta 2005; 65(1):111-117.&#xD;
&#xD;
14.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Nov&#xE1;kov&#xE1; L, Vl?kov&#xE1; H. A review of current trends and advances in modern bio-analytical methods: Chromatography and sample preparation. Analy Chim Act. 2009; 656(1&#x2013;2): 8-35.&#xD;
&#xD;
15.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Zare F, Ghaedi M, Daneshfar A. The headspace solid-phase microextraction of polycyclic aromatic hydrocarbons in environmental water samples using silica fibre modified by self-assembled gold nanoparticles. Analyst Methods 2015;7(19): 8086-8093.&#xD;
&#xD;
16.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Campestre C, Enric Z. Analysis of imidazoles and triazoles in biological samples after MicroExtraction by the packed sorbent. J Enz Inh Med Chem 2017;32(1):1053-1063.&#xD;
&#xD;
17.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Ma Q, Hu M, Chen F. Preparation of a poly (N?isopropyl acrylamide?co?ethylene dimethacrylate) monolithic capillary and its application for in?tube solid?phase microextraction coupled to high?performance liquid chromatography. J Separ Sci 2009 32(15?16):2592-2600.&#xD;
&#xD;
18.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Svec F. Porous polymer monoliths: The amazingly wide variety of techniques enabling their preparation. J Chromatogr A 2010;1217(6):902-924.&#xD;
&#xD;
19.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Yu QW, Xin W,&#xA0;Qiao M,&#xA0;Bi-Feng Y,&#xA0;Hai-Bo H,&#xA0;Yu-Qi F. Automated analysis of non-steroidal anti-inflammatory drugs in human plasma and water samples by in-tube solid-phase microextraction coupled to liquid chromatography-mass spectrometry-based on poly (4-vinyl pyridine-co-ethylene dimethacrylate) monolith. Analy Meth 2011;4(6): 1538-1545.&#xD;
&#xD;
20.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Sugrue EP, Nesterenko N, &#xA0;Paull B. Fast ion chromatography of inorganic anions and cations on a lysine bonded porous silica monolith. J Chromatogr A 2005;1075(1-2):167-175.&#xD;
&#xD;
21.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Nakanishi K, Soga N. Phase separation in silica sol-gel system containing polyacrylic acid I. Gel formaation behavior and effect of solvent composition. J&#xA0; Non-Cryst Sol 1992; 139:1-13.&#xD;
&#xD;
22.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Huang G, Chen S, Lu C. Preparation and evaluation of a lysine-bonded silica monolith as polar stationary phase for hydrophilic interaction pressurized capillary electrochromatography. Electrophoresis 2008;29(18):3896-3904.&#xD;
&#xD;
23.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Causo TJ, Nischang I, Critical differences in chromatographic properties of silica- and polymer-based monoliths. J Chromatogr A 2014;1358(0):165-171.&#xD;
&#xD;
24.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Kumar A, Dhananjay KT. A review on development of solid phase microextraction fibres by sol-gel methods and their applications. Analyst Chimica Acta 2008;610(1):1-14.&#xD;
&#xD;
25.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Pierre AC. Introduction to sol-gel processing. 1. 2013: Springer Science &amp; Business Media.&#xD;
&#xD;
26.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Nakanishi K, Soga N. Phase Separation in Silica Sol-Gel System Containing Poly (Ethylene oxide) II. Effects of Molecular Weight and Temperature. Bull Chem Soci Jap 1997;70(3):587-592.&#xD;
&#xD;
27.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Nunez O, Nakanishi K, Tanaka N. Preparation of monolithic silica columns for high-performance liquid chromatography. J Chromatogr A 2008;1191(1-2):231-252.&#xD;
&#xD;
28.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Siouffi AM. Silica gel-based monoliths prepared by the sol-gel method: facts and figures. J &#xA0;Chrom A 2003;1000(1-2):801-818.&#xD;
&#xD;
29.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Minakuchi H, Zeho M. Octadecylsilylated porous silica rods as separation media for reversed-phase liquid chromatography. Analyt Chem 1996;68(19):3498-3501.&#xD;
&#xD;
30.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Takahashi R, Nakanishi K, Soga N. Small-angle X-Ray scattering study of nanopore evolution of macroporous silica gel by solvent exchange. Far Discuss 1995;101:249-263.&#xD;
&#xD;
31.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Nakanishi K, Chen H, Feng L, Formation of hierarchical pore structure in silica gel. J Sol-Gel Sci Techn 2000;17(3):191-210.&#xD;
&#xD;
32.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Nakanishi K. Double pore silica gel monolith applied to liquid chromatography. J Sol-Gel Sci Tech 1997;8(1-3):547-552.&#xD;
&#xD;
33.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Ishizuka N, Hiroyoshi M,&#xA0;Kazuki N,&#xA0;Kazuyuki H,&#xA0;Nobuo T. Chromatographic characterization of macroporous monolithic silica prepared via sol-gel process. Colloids and Surfaces A: Physic Engg Asps 2001;187-188:273-279.&#xD;
&#xD;
34.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Puy G. Influence of the hydrothermal treatment on the chromatographic properties of monolithic silica capillaries for nano-liquid chromatography or capillary electrochromatography. J Chromatogr A 2007;1160(1&#x2013;2):150-159.&#xD;
&#xD;
35.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Fletcher P,&#xA0;Ping H,&#xA0;Stephen MK,&#xA0;Andrew M, Permeability of silica monoliths containing micro-and nano-pores. J Por Mater 2010;3:1-8.&#xD;
&#xD;
36.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Simpson NJ, Solid-phase extraction: principles, techniques, and applications. 2000, New York: Marcel Dekker. xi, 514.&#xD;
&#xD;
37.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Zhao XS, Lu GQ, Hu X. Chemical modification and characterization of MCM-41 and adsorption study. Adsor Sci Tech 2000;12:386-390.&#xD;
&#xD;
38.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Peters FT, Drummer OH, Musshoff F. Validation of new methods. For Sci Int 2007; 165(2&#x2013;3):216-224.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Study of Factors Affecting Nutritional Status of Children Aged 1-5 Years Attending a Tertiary Hospital&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>20</FirstPage><LastPage>25</LastPage><AuthorList><Author>V Nandhija Devi</Author><AuthorLanguage>English</AuthorLanguage><Author> Kishore Narayan</Author><AuthorLanguage>English</AuthorLanguage><Author> Balamma Sujatha</Author><AuthorLanguage>English</AuthorLanguage><Author> Nazeem Fathima</Author><AuthorLanguage>English</AuthorLanguage><Author> Rajesh S</Author><AuthorLanguage>English</AuthorLanguage><Author> Santhosh Kumar T</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Anthropometric measures are clinical tools that help to identify the nutritional status of a child. Poor nutritional status of a child might be due to poor diet or due to repeated childhood infections. Objective: This study was done to find the correlation between anthropometric measures with nutritional history and acute infectious disease rate in children aged 1-5 years. Methods: 100 children between age 1-5 years old attending the pediatric OPD were enrolled. Information was collected in a semi-structured questionnaire. Detailed history regarding the antenatal factors, birth weight, and breast-feeding, the nutritional history of the child was obtained. Sickness like diarrhoea and lower respiratory tract infection incidence in the past year were documented. The anthropometry measures noted and HAZ, WAZ scores and Weight for length/height were plotted in WHO charts. Stunting, underweight and wasting were inferred from the charts based on the WHO definition. The collected data were analysed with sigma plot 13(system software, USA). Results: Exclusive breastfeeding for 6 months was practised by 77% of mothers. The total duration of breastfeeding and consumption of eggs have a statistically significant effect on anthropometry. Conclusion: Longer duration of breastfeeding has a positive effect on anthropometry. Consumption of eggs increases the chances of a child being of normal height.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Anthropometry, Breastfeeding, HAZ, WAZ, Nutrition, Infection</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Anthropometry is the scientific study of body proportions. Anthropometric measures like weight, height and specific measures of Paediatric interest like mid-arm circumference and head circumference etc are clinical tools that help evaluate the physical health of an individual. In developing countries, growth deficits are caused by two preventable factors, inadequate food and infections.1,2 Anthropometry parameters like Height for age Z (HAZ) scores, Weight for age Z scores (WAZ), Weight for length/height Z scores and Mid arm circumference (MAC) can help to evaluate nutritional status as well as susceptibility to infections. These measures help in detecting both acute and chronic malnutrition.&#xD;
&#xD;
Given that the common and preventable illnesses in this age group involve benign illnesses of the respiratory tract and gastrointestinal system, the susceptibility of the child to such illnesses can be assessed by periodic anthropometric measurement as well as the effect of infection on anthropometry. It is also an eventual observation that the illnesses would result in a corollary of poor anthropometric measures in the child, who then now become susceptible to illnesses at a greater rate than the normal, setting off a vicious cycle.3,4&#xD;
&#xD;
The morbidity and mortality from acute respiratory illness and diarrhoea can be reduced to a large extent by appropriate nutritional interventions.3The accumulated results from a large number of studies are consistent in showing that low values of anthropometric indicators are associated with a high risk of mortality as well as with a high incidence of a long duration of diarrhoea and other diseases among children.5, 6 Weight-for-height, height-for-age, and weight-for-age are the primary means of assessing anthropometry as per WHO recommendations.By WHO definitionWeight-for-Agereflects body mass relative to chronological age and the child is classified as normal or under-weight.7Height-for-Agereflects height relative to chronological age. Stunted growth reflects a failure to reach linear growth potential as a result of sub-optimal health or nutritional conditions and usually indicates chronicity.&#xD;
&#xD;
Weight-for-Heightreflects body mass relative to the height; it is a measure of acute or short term exposure to a negative environment. It is sensitive to calorie intake or the effects of the disease. Wasting is the first response to nutritional and/or infectious insult. Mid upper arm circumference &gt; 12.5cm is considered normal according to WHO guidelines for children aged 12 months to 60 months. A value </Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3432</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3432</Fulltext></URLs><References>&#xD;
	&#xD;
	Guerrant RL, Schorling JB, McAuliffe JF, de Souza MA. Diarrhea as a cause and an effect of malnutrition: diarrhea prevents catch-up growth and malnutrition increases diarrhoea frequency and duration.&#xA0;Am J Trop Med Hyg1992;47:28-35.&#xD;
	&#xD;
	&#xD;
	WHO Working Group. Use and interpretation of anthropometric indicators of nutritional status. WHO Working Group.&#xA0;Bull World Health Organ 1986;64(6):929-941.&#xD;
	&#xD;
	&#xD;
	Walson JL, Berkley JA. The impact of malnutrition on childhood infections. CurrOpin Infect Dis 2018;31(3):231-236. &#xD;
	&#xD;
	&#xD;
	Rice Al, Sacco L, Hyder A, Black RE. Malnutrition as an underlying cause of childhood deaths associated with infections diseases in developing countries. Bull World Health Organ 2005;78:1207-1221.&#xD;
	&#xD;
	&#xD;
	Pelletier DL. The relationship between child anthropometry and mortality in developing countries: implications for policy, programs and future research.&#xA0;J Nutr. 1994;124(10 Suppl):2047S-2081S.&#xD;
	&#xD;
	&#xD;
	Schroeder DG,&#xA0;Brown KH. Nutritional status as a predictor of survival: summarizing the association and quantifying its global impact. Bull World Health Organization 1994;72(&#x200E;4):569-579.&#xA0;&#xD;
	&#xD;
	&#xD;
	World Health Organization. Management of severe malnutrition: a manual for physicians and other senior health works. Geneva: WHO; 1999&#xD;
	&#xD;
	&#xD;
	Park K. Park&amp;#39;s textbook of Preventive and Social Medicine. 25th edition.&#xA0; Chapter 10, 2019; p 577. &#xD;
	&#xD;
	&#xD;
	&#xA0;International institute for population sciences. National family health survey (NFHS-4), 205-16; India.vol.1.mumbai, India; IIPS; 2017 available from: http://www.rchiips.org/nfhs/report.shtml. last accessed on 2020 September&#xD;
	&#xD;
	&#xD;
	Gupta V, Chawla S, Mohapatra D. Nutritional assessment among children (1-5 years of age) using various anthropometric indices in a rural area of Haryana, India. Indian J Community Fam Med 2019;5:39-45.&#xD;
	&#xD;
	&#xD;
	Sinha T, Singh G, Nag U. Nutritional Status of Children Under 5 Years in Tribal Villages of Bastar Chhattisgarh India. J Intern Med Prim Healthcare 2019;3:007.&#xD;
	&#xD;
	&#xD;
	Nayak BS, Unnikrishnan B, George A, Sashidhara YN, Mundkur SC.Risk factors for malnutrition among preschool children in rural Karnataka: a case-control study.&#xA0;BMC Public Health&#xA0;2018;18:283.&#xD;
	&#xD;
	&#xD;
	Bhagwat B, ChandrashekarNooyi S, Krishnareddy D H, Murthy SN. Association of Practices Regarding Infant and Young Child Feeding with Anthropometry Measurements Among an Urban Population in Karnataka, India. Cureus. 2019;11(3): e4346. &#xD;
	&#xD;
	&#xD;
	Algur V, Yadavannavar MC, Patil SS. Assessment of Nutritional Status of Under Five Children in Urban Field Practice area. Int J Cur Res Rev 2012;04(22):122-126.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Evaluation of Covid-19 Awareness and Understanding Amongst Pharmacy Students at Gayatri College of Pharmacy Sambalpur, Odisha&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>26</FirstPage><LastPage>31</LastPage><AuthorList><Author>Ray B</Author><AuthorLanguage>English</AuthorLanguage><Author> Biswal PK</Author><AuthorLanguage>English</AuthorLanguage><Author> Panda BB</Author><AuthorLanguage>English</AuthorLanguage><Author> Dash SN</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Global Pandemic COVID-19 caused by Severe acute respiratory syndrome Coronavirus 2(SARS COV 2) spreading rapidly and become a serious challenge for the entire healthcare profession. It results in a significant burden on the human race. There is no effective treatment so far discovered for the SARS CO V 2. As the modified strain of the virus is new the research on various aspect like pathogenesis, prognosis, etc are limited due to lack of time and rapidly spreading. The best measure is prevention by maintaining social distancing and other hygienic measures. Objective: The surveyor study Aims to determine the level of awareness, perception and professional knowledge of COVID 19, Global pandemic in different aspects like mode of transmission, Preventive and Precaution and approved treatment protocol among Pharmacy students at various stages in the study. one of the vital aims is to identify the key source of gained awareness as well as identify which of these were is the most effective in information delivery. Methods: A cross-sectional study was conducted among Pharmacy students of Gayatri Colege of Pharmacy, Sambalpur using a questionnaire total of 50 Participants who fully completed the questionnaire were included in the Study. Results: Participants were surveyed on their knowledge including the source of Information, Possible source of creating awareness. Conclusion: The result suggests that Participants basic knowledge about COVID-19 is acceptable. Although improvements are advised in the understanding of preventive measures that can be taken, Recommended more focus towards it as it is so helpful in creating Awareness.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Pandemic, COVID-19, Pathogenesis, Awareness, Social Distancing, Sanitisation, Vaccine</Keywords><Fulltext>Introduction&#xD;
&#xD;
The World Health Organization (WHO) &#x201C;defines coronavirus as a large family of viruses that cause illness ranging from the common cold to more severe disease&#x201D;. The name comes from the Latin word &#x201C;corona&#x201D;, which means &#x201C;crown&#x201D; or &#x201C;halo&#x201D;, and refers to the shape of the virus particle when viewed under a microscope. &#x201C;Coronaviruses are zoonotic, meaning they are transmitted between animals and people&#x201D;, the WHO says. Coronavirus is an infectious disease caused by a type of common virus that infects humans, typically leading to an upper respiratory infection (URI). Seven different types of human coronavirus have been identified. Most people will be infected with at least one virus in their lifetime.1,2&#xD;
&#xD;
Corona virus disease 2019(COVOD-19) caused by this newly discovered virus has very quickly spread all over the world. Considering the rapidly increasing number of cases the WHO declared a pandemic on 11th March 2020. The incubation period of this disease transmitted by droplets ranges from 2 to 14 days, usually between 3 and 7.3,4 On Jan. 7, 2020, The virus has been isolated in china by the Chinese authority of Health. The virus pathogenesis was quite a new model. To understand the Pathology of Infection at that time was quite crucial.&#xD;
&#xD;
SARS-CoV-2 is a single-stranded, positive-sense RNA coronavirus which causes an illness called COVID-19 (note that many people still equate and interchange the disease name COVID-19 with the new official virus named SARS-CoV-2). It is a new strain of coronavirus which is causing an Illness of Respiratory tract. Sometimes it is mild, sometimes moderate, sometimes serious. People who have other underline problem or comorbidity factor, they are high risk.&#xD;
&#xD;
Pathogenesis&#xD;
&#xD;
The severe symptoms of COVID-19 are associated with an increasing number and rate of fatalities especially in the epidemic region of China. On January 22, 2020, the China National HealthCommissionreportedthe details of the first 17 deaths and on January 25, 2020, the death cases increased to 56 deaths. The percentage of death among the reported 2684 cases of COVID-19 was approximately 2.84% as of Jan25, 2020 and the median age of the deaths was 75(range 48&#x2013;89) years. Patients infected with COVID-19 showed higher leukocyte numbers, abnormal respiratory findings, and increased levels of plasma pro-inflammatory cytokines. One of the COVID-19 case reports showed patient at 5 days of fever presented with a cough, coarse breathing sounds of both lungs, and a body temperature of 39.0 &#xB0;C. The patient&amp;#39;s sputum showed positive real-time polymerase chain reaction results that confirmed COVID-19 infection. The laboratory studies showed leucopenia with leukocyte counts of 2.91 &#xD7; 10^9 cells/L of which70.0% were neutrophils. Additionally, a value of 16.16 mg/L of blood C-reactive protein was noted which is above the normal range(0&#x2013;10 mg/L). High erythrocyte sedimentation rate and D-dimer were also observed. The main pathogenesis of COVID-19 infection as a respiratory system targeting virus was severe pneumonia, anaemia, combined with the incidence of ground-glass opacities, and acute cardiac injury. Significantly high blood levels of cytokines and the-machines were noted in patients with COVID-19 infection that includedIL1-&#x3B2;, IL1RA, IL7, IL8, IL9, IL10, basic FGF2, GCSF, GMCSF, IFN&#x3B3;, IP10, MCP1, MIP1&#x3B1;, MIP1&#x3B2;, PDGFB, TNF&#x3B1;, and VEGFA. Some of the severe cases were admitted to tertiary care hospital or hospital specially design for Corona Patient.5 The infection is manifested by the following abnormality in laboratory test result: Leucopenia, lymphocytopenia, Increase level of LDL and CRP. The imaging technique is an important tool for the diagnosis. Chest computed tomography is presently recommended by an expert as a screening examination.6,7&#xD;
&#xD;
Mode of Transmission&#xD;
&#xD;
As it is a kind of Respiratory Infection, the main mode is Droplet Infection. Droplet of respiratory material when move in air, nearby person gets infected. Surface contact is another main mode of infection as the virus sustained for the long term in any surface. Transmission can be occurred by respiratory droplet or surface contact of the infected spot as the virus exists for a long time in the surface inactive form. person to person infection occurs which is known as community spread.8&#xD;
&#xD;
Sign and Symptom&#xD;
&#xD;
Signs and symptoms of COVID-19 infection&#xA0;include&#xA0;flu-like symptoms&#xA0;that worsen to&#xD;
&#xD;
&#xD;
	&#xD;
	&#xD;
		&#xD;
		fever,&#xD;
		&#xD;
		&#xD;
		coughing, and&#xD;
		&#xD;
		&#xD;
		shortness of breath.&#xD;
		&#xD;
		&#xD;
		Headache and body ache&#xD;
		&#xD;
		&#xD;
		sometimes Diarrohea.&#xD;
		&#xD;
	&#xD;
	&#xD;
&#xD;
&#xD;
Sometimes flu-like symptom starts and sometimes runny nose which may resemble another flu symptom. Difficulty in breathing is the outcome of Untreated Infection. Early diagnosis is essential. It is early in the outbreak of this new disease, so the current approximation of the mortality rate may go up or down.9&#xD;
&#xD;
Treatment and Prevention &#xD;
&#xD;
Globally many drug and therapies are being considered or used for treatment. Usually, the drug treatment is approved by concern healthcare administration of that region. But sometimes Doctor is using a treatment that has not been approved for COVID-19. They are treating the patient using drug beyond their indication, approved use and with few scientific evidence. Sometimes they are advancing drug by extrapolation from in-vitro studies indicating their antiviral and anti-inflammatory study.10 China where the pandemic was originated, Hospitals are using traditional Chinese medicine which has been reported to be good effect.11,12&#xD;
&#xD;
As severe acute respiratory syndrome SARS CO V-2, the causative agent of COVID-19 has a close genetic resemblance with the SARS-CO V and the middle east respiratory syndrome. (MERS) CO V, drugs used to treat SARS and MERS are utilised to explore the extent of their activity against SARS CO V 2.Due to the rapid spread of the disease and its high rate of contagion as well as the cost and time for development and marketing of a new, safe and efficacious drug, professional and researcher are looking to repurpose new drug to treat COVID-19.13&#xD;
&#xD;
The virus is new. So the research on various aspects like pathogenesis, treatment, the prognosis is limited to due lack of time versus rapid spread of virus globally. There is no specific therapy approved by the US Food and Drug Administration (FDA). For the present virus, only symptomatic treatment and treatment by antibiotics and antiviral drug trial basis following previous knowledge and individual complication. It will take time for the discovery of the vaccine and an appropriate drug for target-specific treatment. But the protocol of treatment given currently is highly successful in maximum cases. So the recovery rate is also quite satisfactory. The most important method to control the disease is to take preventive measure like social distancing, washing of hands frequently and using a face mask at public places, etc. Government of different countries are making strict rules for their citizens by implementing lockdown followed by shut down which doesn&#x2019;t affect much because now the people should learn the art of living along with the virus. The main objective is to make social distancing between individuals which is the ray of hope in present scenarios.14&#xD;
&#xD;
MATERIALS AND METHODS &#xD;
&#xD;
A lot of Studies has attempted to explore knowledge and attitudes of healthcare professionals of various disciplines like Nursing, pharmacy and Medicine professional Students. The Subject area are TB,AIDS,Diabetes,Hypertension etc.But in the present area COVID-19, This type of survey is few in number or very rare in Pharmacy decline.&#xD;
&#xD;
A study carried out by Akin, et al (2011) investigated the level of knowledge and attitude towards understanding and creating awareness of Turkish Nursing Students about the disease TB, intending to determine whether making changes to their teaching and this type of survey would improve their attitude, as a result of the reflection of awareness in Society.15 Singal, N(1999) Also perform a Survey in the field of Communicable disease TB among Nurses working in a Tuberculosis Hospital.16 This type of Survey Design is quite helpful for students and Healthcare worker to understand the Disease-related information in an interesting way. Later on, the knowledge will be propagated and transmitted in society for creating a high magnitude of Awareness through professionals. The present survey has been designed by following the framework/model of the above study.&#xD;
&#xD;
Study Question&#xD;
&#xD;
The present study sought to explore the degree of COVID-19 Awareness among Pharmacy Student at GCP and identify the key point of gained awareness.&#xD;
&#xD;
This was a questionnaire-based cross-sectional study. The participant&amp;#39;s information and were questionnaire distributed in Web Base class to Pharmacy student at GCP by the researcher. The questionnaire was made up of twenty multiple type question divided into three separate categories. Section A contains Demographic information meant to understand the difference in Awareness and level of knowledge between different population group. Section B contains five-question relating to COVID 19 Awareness and Possible source of existing knowledge. The rest of the question was mentioned in Section C which included detail question on cause, transmission, symptom and medication etc, aims to test Participants basic understanding of COVID-19. The final question in this section explored participants attitude to creat Awareness as a student of the Healthcare profession. All participants were provided with information as the short discussion about COVOD -19 to support their learning after they send their response.&#xD;
&#xD;
Sampling methods&#xD;
&#xD;
Participants were exclusively Pharmacy Students at different stages of study at the GCP with the understanding that their comp questionnaire lesion of the questionnaire will imply their consent to participate in this study. Few incomplete questionnaires were later on omitted from data set which resulted in yielding a total of 50 complete response.&#xD;
&#xD;
Data Analysis&#xD;
&#xD;
Statistical analysis has been carried out by using SPSS Software and excel programme. Before running analysis responses were screened for the incomplete response(i.e Partially answered or completely unanswered questionnaire .) which were subsequently removed from data set. The questionnaire with more than three unanswered questions is considered as incomplete. The analysis consisted using frequency distribution for the total participant sample and each demographic characteristics. Dichotomous formatting enabled detail analysis of responses within each participant.&#xD;
&#xD;
Results&#xD;
&#xD;
Demographic characteristic of Respondents &#xD;
&#xD;
The analysis involved 14 pharmacy students (64% female and 36 % male) from two selective semesters in Study. The age range of participant was 18-24. Sources of gained awareness and education were also explored to identify which method was most effective in their opinion.&#xD;
&#xD;
Covid Awareness and Source of Existing&#xA0; Knowledge&#xD;
&#xD;
All respondent indicated that they have Previously heard about COVID-19. Among participant twenty-five per cent, student indicate that&#xD;
&#xD;
Participants basic understanding of COVID-19&#xD;
&#xD;
Majority of participants identify and indicate the appropriate method of creating awareness. Maximum Participant identified COVID-19 is a Viral Disease. Most Participants agreed that COVID-19 is a viral disease. Most participants indicated that Anganwadi (the local group for primary health screening programme under Govt of Odisha and India), Participate in Primary screening of health for COVID-19. Most of the participant agreed that Maintaining Social Distancing, Repeatedly sanitisation of hand, Using face mask, Avoiding to touch any external object is a series or package for prevention of COVID-19 in community. [Ethical clearance-Ethical requirement for the survey was granted by principal Gayatri college of pharmacy who is also one of the co-authors for the Manuscript. No-GCP/000&#xD;
&#xD;
Participant COVID awareness and self-identified source of knowledge&#xD;
&#xD;
Following data (Table 1) indicates the awareness and general knowledge about sources of COVID 19 Information&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
Understanding Transmission and Possible Treatment of COVID-19&#xD;
&#xD;
Table 4 indicated the Distribution of correct answer provided by participants regarding transmission and possible treatment of COVID-19.&#xD;
&#xD;
&#xD;
&#xD;
Discussion&#xD;
&#xD;
Participants were surveyed on their knowledge including the source of Information, Possible source of creating awareness. Participants have also surveyed on their knowledge the causative organism and basic idea about COVID-19 which include the mode of spread, treatment management and possible method of Prevention to spread within the community.&#xD;
&#xD;
The finding has highlighted the need to increase awareness and a boosting tool for enhancement of current education, knowledge and awareness about COVID-19, Among Pharmacy students, who are highly professional as a community pharmacist in Creating Social awareness in Community. Most participants were third and Fifth-semester students. Male participants were considerable ow when compared to female participants.&#xD;
&#xD;
Conclusion&#xD;
&#xD;
Participants basic knowledge about COVID-19&#xA0;&#xA0; is acceptable. Although improvements are advised in the understanding of preventive measures that can be taken, Recommended more focus towards it as it is so helpful in creating Awareness.&#xD;
&#xD;
Acknowledgement:&#xD;
&#xD;
The authors are highly thankful to the Student Society of GCP. The authors also highly acknowledge the help of the Staff member of Dept of Pharmacology GCP for encouraging the students to participate in the Survey.&#xD;
&#xD;
Conflict of Interest and Source of Funding&#xD;
&#xD;
There is NO Conflict of interest with the article.&#xD;
&#xD;
There is NO EXTERNAL FUNDING SOURCE.&#xD;
&#xD;
CONTRIBUTION OFF AUTHORs :&#xD;
&#xD;
1. Dr. B. Ray: Designing of Manuscript and Analysis of Data&#xD;
&#xD;
2. Dr. P.K. Biswal: Collection of Data&#xD;
&#xD;
3. Dr. B.B. Panda: Tabulation of data&#xD;
&#xD;
4. Prof. S.N. Das: Deals with the ethical matter.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3433</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3433</Fulltext></URLs><References>[1] World&#xA0; Health&#xA0; Organization. Clinical management of severe acute respiratory infection when novel coronavirus&#xA0; (nCoV)&#xA0; infection is suspected&#xA0; https://www.who.int/publicationsdetail/clinical-management-of-severe-acute-respiratory-infection-when-novel-coronavirus(ncov)-infection-is-suspected. &#xD;
&#xD;
[2]&#xA0; CDC Website:&#xA0; https://www.cdc.gov/coronavirus/2019-ncov/hcp/clinical-guidancemanagement-patients.html.&#xD;
&#xD;
[3] Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. A pneumonia outbreak&#xD;
&#xD;
associated with a new coronavirus of probable bat origin. Nature 2020;579:270-273.&#xD;
&#xD;
[4] Lai CC, Shih TP, Ko WC, Tang HJ, Hsueh PR. Severe acute respiratory syndrome&#xD;
&#xD;
coronavirus 2 (SARS-CoV-2) and coronavirus disease-2019 (COVID-19): the epidemic&#xD;
&#xD;
and the challenges. Int J Antimicrob Agents 2020;55(3):105924.&#xD;
&#xD;
[5]&#xA0; Chu&#xA0; CM,&#xA0; Cheng&#xA0; VCC,&#xA0; Hung&#xA0; IFN,&#xA0; Role of lopinavir/ritonavir in the treatment of&#xA0; SARS: initial virological and clinical findings.&#xA0; Thorax&#xA0; 2004;59(3):252-256.&#xA0; &#xD;
&#xD;
[6] Jin YH, Cai L, Cheng ZS, Cheng H, Deng T, Fan YP, et al. A rapid advice guideline for&#xD;
&#xD;
the diagnosis and treatment of 2019 novel coronavirus (2019-nCoV) infected&#xD;
&#xD;
pneumonia (standard version). Mil Med Res 2020 Feb 6;7(1):4. &#xD;
&#xD;
[7] Bernheim A, Mei X, Huang M, Yang Y, Fayad ZA, Zhang N, et al. Chest CT findings&#xD;
&#xD;
in coronavirus disease-19 (COVID-19): relationship to duration of infection.&#xD;
&#xD;
Radiology 2020;295(3):200463. &#xD;
&#xD;
[8] Guan WJ, Ni ZY, Hu Y, Liang WH, Ou CQ, He XJ, et al. Clinical characteristics of&#xD;
&#xD;
coronavirus disease in 2019 in China. N Engl J Med 2020; 382(18):1708-1720. &#xD;
&#xD;
[9] Jin&#xA0; Y, Cai&#xA0; L, Cheng&#xA0; Z. A rapid advice guideline for the diagnosis and treatment of 2019&#xA0; novel coronavirus (2019-nCoV) infected pneumonia (standard version). Military Med Res 2020;7:4. &#xD;
&#xD;
[10] Kalil AC. Treating COVID-19-Off-label drug use, compassionate use, and randomized clinical trials during pandemics. JAMA 2020;323:1897-1898.&#xD;
&#xD;
[11] Ji S, Bai Q, Wu X, Zhang DW, Wang S, Shen JL, et al. Unique synergistic antiviral effects of shifting jiedu capsule and oseltamivir in influenza A viral-induced acute exacerbation of the chronic obstructive pulmonary disease. Biomed Pharmacother 2020;121:109652.&#xD;
&#xD;
[12] Yao KT, Liu MY, Li X, Huang JH, Cai HB. Retrospective clinical analysis on treatment of novel coronavirus-infected pneumonia with traditional Chinese medicine Lianhua-Qingwen. Chin J Exp Tradit Med Form 2020;12:1-7.&#xD;
&#xD;
[13] Folegatti PM, Ewer KJ, Aley PK, Angus B, Becker S, Belij-Rammerstorfer S, et al. Safety and immunogenicity of the ChAdOx1 nCoV-19 vaccine against SARS-CoV-2: A preliminary report of a phase 1/2, single-blind, randomised controlled trial. Lancet 2020;396:467-478.&#xD;
&#xD;
[14] Ray B, Motalebi M, Nanda SS. Global Pandemic COVID 19: The art of living with the virus. J Hospital Pharm 2020;15(3):67-74.&#xD;
&#xD;
[15] Gorak AS, Unsure G, Molaglu S, Godzilla M, Durna ZK. Knowledge of and attitudes towards tuberculosis of Turkish Nursing and Midwife students. Nurse Education Today 2011;31(8):774-779.&#xD;
&#xD;
[16] Singal N, Sharms P, Jain R. Awareness about tuberculosis among Nurses working in a tuberculosis hospital and a General Hospital in Delhi, India. Int J Tuberc Lung Dis 1999;2(12):1005-1010.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>An Assessment of Pain-Free Blood Glucose Level by Noninvasive Methods&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>32</FirstPage><LastPage>35</LastPage><AuthorList><Author>Agalya V</Author><AuthorLanguage>English</AuthorLanguage><Author> Sumathi S</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Diabetes mellitus is the kind of metabolic disease that affects millions of people around the world. Diabetics must have a constant awareness of their blood glucose level to keep their physics in healthy condition. Objective: In this paper, a comprehensive discussion on current methods which are performed for blood glucose measurement and exploration on the current implementation of noninvasive glucometer strategies through linear regression is represented. Methods: Linear regression models are generated through One-to-One and weighted average correlation of individual input parameters. Thirty-eight samples are incorporated in the analysis, here Density in &#x2018;kg/m3 &#x2019;, Pressure generated by Blood Test in &#x2018;Pa&#x2019; and Absorption in &#x2018;AU&#x2019; is considered as Input parameters and Glucose Concentration in &#x2018;mg/dL&#x2019; as an output parameter. R-Square is performed to understand the best fitting between observed and predicted Glucose Concentration levels. In the end, the weighted average prediction is also done for the correlation. Results: By comparing the observed value, the linear regression predicted the optimal glucose concentration (mg/dl) with 0.9794 R-Square value. And from the prediction process, it was observed that Density to Glucose Concentration result with 100% best fitting, Pressure to Glucose Concentration result with 99.99% best fitting, Absorption to Glucose Concentration result with 97.95% best fitting and Weighted Average to Glucose Concentration result with 99.8% best fitting. Conclusion: Arrived direct correlations are very much useful to create new products for monitoring blood glucose level continuously under non-invasive conditions.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Metabolic, Glucose, Blood, Noninvasive, samples, Linear Regression</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
People with diabetics are tasked with monitoring their blood glucose levels at frequent intervals within the day to ensure the blood glucose levels within the permissible range.1 Based on this measurement, diabetics can inspect their health to make sure of their life safety.2-4 The most familiar method of measuring the glucose content is by blood sampling and testing with glucometers. This is done through pricking their skin in fingers many times in a day. This inconvenience can be rectified by the way of noninvasive glucose monitor systems.5 A special type of sensor is introduced here to obtain the accurate value of blood glucose level without collecting blood samples.&#xD;
&#xD;
Blood Glucose measuring techniques have three categorization1 (i) Invasive (ii) Minimal Invasive and (iii) Noninvasive as shown in figure 1. This paper illustrates on various contents of noninvasive glucose monitoring systems with the following classes, (a) Diabetes and its impact (b) Invasive glucose measurement strategies which are currently in use (c) Traditional strategies on noninvasive glucose measurement (d) New approaches in noninvasive glucometers and (e) Conclusions regarding the feasibility methods.&#xD;
&#xD;
&#xD;
&#xD;
DIABETES AND ITS IMPACT&#xD;
&#xD;
&#x201C;Diabetes&#x201D; is the kind of autoimmune disease results due to the loss of the ability of the pancreas to produce adequate quantity and quality of insulin required to break down the glucose content. In the digestive system, carbohydrates are break down into glucose which is then utilized by the cell for energy conversion. To use this glucose, cells need insulin. If required insulin is not present in the cells then it results with excess glucose in the blood stream. Generally two types of diabetes,&#xA0; Type 1 is Insulin Dependent Diabetes Mellitus occur in childhood due to genetic predisposition and Type 2 is Non-Insulin Dependent occurs later in life due to obesity and other relevant factors.&#xD;
&#xD;
If blood sugar is left unregulated over a time leads to accelerated complications like a greater risk of stroke.1,3 Now a day, there is a need for minimization of the complications associated with diabetes and respective health care cost. So the appropriate glucose measurement method is always in demand to keep the people under healthy condition.&#xD;
&#xD;
INVASIVE GLUCOSE MEASUREMENT STRATEGIES&#xD;
&#xD;
At present there are two main methods are followed under Invasive glucose measurement, the first one is called an A1C test. This simple lab test is conducted through a small amount of blood sample drawn from the person. This test helps to find the average glucose level in the blood for the past three months. For diabetics, this test is recommended at least twice in a year which helps to measure the risk level. The scale measurement followed in A1C test is 12, 11, 20, 9, 8, 7 and 6 corresponding to the average glucose level of 345, 310, 275, 240, 205, 170 and 135 respectively.&#xD;
&#xD;
The test procedure is, pricking of patient finger to collect blood sample with a help of lancet, then dropped into a strip and optical meter is used to measure the blood glucose content level. Based on the type of sensor, healthy condition is measured for blood glucose level as prescribed in Table 1.&#xD;
&#xD;
&#xD;
&#xD;
Another mode of invasive glucose measurement is based on different site inspection like the upper arm and forearm, but the accuracy is not up to the level of pricking method. Another method is MINIMED monitoring system, it is known as invasive continuous monitoring system3, here a small plastic catheter is inserted under the skin to measure the blood glucose level continually and sometimes it is used to inject insulin at the risky situation. These methods have their discomfort like fainting at sight and anxiety towards regular usage. To overcome this kind of distress, preferably noninvasive methods are considered.&#xD;
&#xD;
TRADITIONAL STRATEGIES ON NONINVASIVE GLUCOSE MEASUREMENT&#xD;
&#xD;
The main objective of noninvasive glucose measurement is to avoid pain and discomfort, piercing of skin and tissue deterioration. Many strategies are applied to reach these requirements; some of the inventions are commercially available is illustrated in Table 2. Two different techniques are used for the development of the product (i) Reverse Iontophoresis &#x2013; Electrical current-based (ii) Spectroscopy &#x2013; Interaction of Light-based.&#xD;
&#xD;
&#xD;
&#xD;
Non-invasive applied by Photoacoustic spectroscopy, here beam of light is performed. Optical energy generated from the light capable of developing an acoustic pressure wave. This wave helps to find glucose concentration through the microphone. A linear response is perceived by Mckenzie et al., based on the light source and glucose concentration.9 Later the research created by incorporating piezoelectric transducer and a laser pulse measurement through an optical fibre.10 The transducers are capable of detecting the photoacoustic pulse with high accuracy.3&#xD;
&#xD;
Another strategy followed is Scatter changes of a blood sample based on the refraction index. Light refraction measured under abdomen is observed as accurate site indication of blood glucose level. The scatter method requires calibration process, so it is mandatory to take into account of signal shift due to location factors.4&#xD;
&#xD;
NEW APPROACHES IN NONINVASIVE GLUCOMETERS&#xD;
&#xD;
Few recent geometry methods are available based on reverse iontophoresis and fluorescence. Fluorescence method is achieved by using a contact lens. These methods are continuous and non-invasive by incorporating carbon nanotubes and metabolic heat conformation. Under Metabolic heat confirmation method, body heat and oxygen supply are measured through a sensing device.11 In 19thcentury, elevated tear glucose levels were first introduced.12 Blood glucose level can be monitored through the tears. Boron acid doped lens is deficient with electron which can be easily reached back by the presence of glucose. This change will be reflected in fluorescence spectral which is directly related to blood glucose level.11 A related study found that these lenses are comfortable to use continuously for long run.13&#xD;
&#xD;
Other new approaches are based on the sugars leaching, pH response, sensitivity, polarity and comfortability.5,12 Leaching is known as the process of extraction of specific materials from a carrier and converts into a liquid. From the literature, it was found that leaching will cause about eight percentage changes in the fluorescent intensity.11 GlucoScope and Glucoview are the products invented under non-invasive glucometer in the year 2003. GlucoScope is a small pair of binoculars used to measure the blood glucose level based on the fluid which is associated in the anterior chamber of the eyes. Gluco-view is the kind of disposable contact lens used to measure the glucose level in the tears by changing the respective colour spectrum.14 All these products are having a drawback of collecting the data for prediction which significantly affect the calibration process.&#xD;
&#xD;
MATHEMATICAL CORRELATION&#xD;
&#xD;
During the research the diabetes data base is collected from UCI machine learning repository for testing. This trial and error is done with the help of a linear regression model. The predicted measurement of glucose concentration is correlated by the followingequations.&#xD;
&#xD;
y1&#xA0; = b1(1) + b1(2)*x1................................................................................................ (i)&#xD;
&#xD;
y2&#xA0; = b2(1) + b2(2)*x2.............................................................................................. (ii)&#xD;
&#xD;
y3&#xA0; = b3(1) + b3(2)*x3............................................................................................. (iii)&#xD;
&#xD;
ya = [y1&#xA0; + (0.9999*y2) + (0.9795*y3)] / (1+0.9999+0.9795)&#xA0; &#x2026;.(iv)&#xD;
&#xD;
Where,&#xD;
&#xD;
x1= density kg/m3 - (Input Parameter)&#xD;
&#xD;
x2= pressure generated by BT (Pa) - (Input Parameter)&#xD;
&#xD;
x3= Absorption (AU) - (Input Parameter) and b1, b2, b3 are the arrived coefficients&#xD;
&#xD;
Here 38 samples are taken into consideration for trial and error calibration. The expected output value is represented as y1, y2, y3 and ya. Linear regression is collectively done by relating individual input parameter and output parameter as detailed in Figures 2(a) &#x2013; 2(d). Finally, the weighted average prediction is also done for the correlation. By comparing the observed value, the linear regression predicted the optimal glucose concentration (mg/dl) with 0.9794 R-Square value.&#xA0;Table 3 elaborates on input and output parameters used for the regression analysis.&#xD;
&#xD;
&#xD;
&#xD;
From the prediction process from figure 2, it was observed that Density to Glucose Concentration result with 100% best fitting, Pressure to Glucose Concentration result with 99.99% best fitting, Absorption to Glucose Concentration result with 97.95% best fitting and Weighted Average to Glucose Concentration result with 99.8% best fitting. These direct correlations are very much useful to create a new product for monitoring blood glucose level continuously under non- invasive.&#xD;
&#xD;
&#xD;
&#xD;
Figure 2: Correlation between Predicted and Observed Blood Glucose Concentration (a) Density Vs Glucose Concentration (b) Pressure Vs Glucose Concentration (c) Absorption Vs Glucose Concentration (d) Weighted Average Vs Glucose Concentration&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
A detailed report on diabetes with its impact, invasive glucose measurement strategies, appropriate traditional strategies followed in noninvasive glucose measurement and inventions about new approaches are presented. The research is still ongoing to find an alternative for finger pricking even after crossing a decade, to reach utmost accuracy and comfortability. Some useful and hopeful approaches are already made from the different research which enhances the possibility of achieving those products. Regression correlation is analyzed here to find the relationship between blood glucose concentrations with density, pressure and absorption. Precisely this will help to invent the portable noninvasive product at low cost as possible.&#xD;
&#xD;
&#xA0; &#xA0; &#xA0; &#xA0;Source of Funding: Nil&#xD;
&#xD;
Conflict of interest: Nil&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3434</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3434</Fulltext></URLs><References>1. American Diabetes Association. Diagnosis and classi?cation of diabetes mellitus. Diab Car 2014; 37(1):81-90.&#xD;
&#xD;
2. Shiel WC. Diabetes - What Should My Blood Sugar Levels Be? - Diabetes Mellitus, Type2 Diabetes, Type 1, and Metabolic Disorders Treatment and Medications on MedicineNet.com. Medicine Net 29th edn.2002.&#xD;
&#xD;
3. Amaral YS. Current development in non-invasive glucose monitoring. Med Engg Phys 2008;30:541-549.&#xD;
&#xD;
4. Moschou TS. Fluorescence glucose detection: advances toward the ideal in vivo biosensor. J Fluor 2004;14.&#xD;
&#xD;
5. Badugu CR. A Glucose sensing contact lens: A new approach to non-invasive continuous physiological glucose monitoring. J Fluoresc 2003;13(5):134.&#xD;
&#xD;
6. Eva TS. Accuracy of the GlucoWatch G2 Biographer and the Continuous Glucose Monitoring System During Hypoglycemia: Experience of the Diabetes Research in Children Network (DirecNet). Diab Car 2004; 27(3): 722&#x2013;726. &#xD;
&#xD;
7. Liu R, Chen W, Gu X, Ruikang K, Xu WK. Chance Correlation in non-invasive glucose measurement using near-infrared spectroscopy. J Phys Appl Phys 2005; 38(15):304-314.&#xD;
&#xD;
8. Christison GB, MacKenzie HA. Laser photoacoustic determination of physiological glucose concentrations in human whole blood. Med Biol Engg Comp 1993; 31:284-290.&#xD;
&#xD;
9. MacKenzie AW, Hugh A. Advances in Photoacoustic Noninvasive Glucose Testing. Clin Chem 1999;45(9):99-104.&#xD;
&#xD;
10. Waynant RW, Chenault VM. Overview of Non-Invasive Optical Glucose Monitoring Techniques. IEEE - The World&amp;#39;s Largest Professional Association for the Advancement of Technology. 2011;01.&#xD;
&#xD;
11. Wickramasingh RT. Current Problems and Potential Techniques in In Vivo Glucose Monitoring. J Fluor 2004;14.&#xD;
&#xD;
12. March WF, Mueller A, Herbrechtsmeier P. Clinical trial of noninvasive contact lens glucose sensor. Diab Tech Ther 2004;6:782-789.&#xD;
&#xD;
13. Smith JL. The Pursuit of Noninvasive Glucose: Hunting deceitful Turkey. 2006.&#xD;
&#xD;
14. Khalil S. Non-invasive Photonic-Crystal Material for Sensing Glucose in Tears. Clin Chem 2004;50(12):201-205.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Spectrum Analysis of Thyroid Lesions on Histopathology&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>36</FirstPage><LastPage>41</LastPage><AuthorList><Author>Sheema Sheikh</Author><AuthorLanguage>English</AuthorLanguage><Author> Rohi Wani</Author><AuthorLanguage>English</AuthorLanguage><Author> Farzana Manzoor</Author><AuthorLanguage>English</AuthorLanguage><Author> Sabiha Ashraf</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Thyroid gland is an endocrine organ with two lobes and connecting isthmus, located below and anterior to the larynx. Histologically, the thyroid gland is comprised of follicles lined by follicular epithelial cells with eosinophilic colloid in the lumen. Objective: This study aimed to analyse thyroid lesions histopathologically. Methods: Specimens of thyroid lesions received at Department of Pathology, Government Medical College, Srinagar from January 2018 to December 2019 were studied retrospectively. Results: Among the 180 specimens of thyroid lesions, 145 were from female patients and 35 from male patients. Age of the patients ranged from 4 years to 66 years. 31 cases (17%) were found to be non-neoplastic and 149 cases (83%) were neoplastic. Of the non-neoplastic lesions, 28 cases were documented as colloid goitre, 2 cases as a thyroglossal cyst and 1 case as Hashimoto thyroiditis. Of the neoplastic category, benign neoplasms(n=49) included 34 cases of follicular adenoma, 12 cases of Hurthle cell adenoma and 3 cases of non-invasive follicular thyroid neoplasm with papillary like nuclear features malignant category (n=100) included 90 cases of papillary thyroid carcinoma, 2 cases of follicular thyroid carcinoma and 8 cases of medullary thyroid carcinoma. Conclusion: In our study, only 17% of thyroid surgeries were done for non-neoplastic lesions. Further reduction in the number of thyroidectomies for non-neoplastic lesions is expected with improved applicability of preoperative imaging and fine-needle aspiration cytology.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Thyroid, Histopathology, Neoplastic, Papillary Thyroid carcinoma</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Thyroid gland is an endocrine organ with two lobes and connecting isthmus, located below and anterior to the larynx. Histologically, the thyroid gland is comprised of follicles lined by follicular epithelial cells with eosinophilic colloid in the lumen.1 C-cells are interspersed within the follicular epithelium with basement membrane investing both follicular as well as C-cells. Common diseases of thyroid encountered in histopathological specimens include developmental (pyramidal lobe, thyroglossal duct cyst, lingual thyroid), inflammation (thyroiditis), thyroid hyperplasia (goitre), and neoplasms.2 The updated classification of thyroid neoplasms (Table 1) has been introduced in the 4th Edition of the WHO classification of endocrine organs in 2011.3 The precise classification of thyroid neoplasms has always been onerous owing to the evolution of molecular/genetic characterisation of these tumours, introduction of new entities, reclassification of previous entities and updates in diagnostic criteria. This study was undertaken to thoroughly analyse thyroid lesions and thereby establishing the histopathological spectrum.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
This was a retrospective study conducted at the department of pathology, Government Medical College, Srinagar. The records of all thyroid specimens received in the department over 2 years (January 2018 to December 2019) were acquired from departmental registry and histopathology requisition forms. The clinical history including age, gender, symptoms, radiological and cytologic findings were noted. The slides were retrieved from the departmental gallery and wherever necessary, fresh 4-5micron sections were cut on a microtome and stained by Hematoxylin and Eosin stain. All the cases were studied by more than one pathologist. The data were entered in Microsoft Excel spreadsheet and was then imported into statistical package for social science (SPSS) version 20 for statistical analysis.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
In the two years from January 2018 to December 2019, a total of 180 specimens of thyroid lesions designated thyroidectomy, lobectomy, partial excision and Sistrunk operation have been received in our department. Overall female patients outnumbered male with F: M ratio of 4.14:1 (Figure 1, Table 2). The maximum lesions predominated in the age group of 21-40 years (n=102) (Table 3). &#xD;
&#xD;
The non-neoplastic lesions constituted 17% (31 cases) of all thyroid lesions (Figure 2). Colloid goitre was the most common non-neoplastic lesion (28/31, 90.32%). Of these cases, 25 were female (89.28%) and 3 were male (10.71%). Two cases(6.45%) of the thyroglossal cyst and 1 case (3.22%) of Hashimoto thyroiditis were found (Figure 3). In this study, 149 cases (83%) belonged to the neoplastic category. Of these cases, 49 (32.88%) were benign and 100 (67.11%) were malignant. In the benign category,34 cases of follicular adenoma, 12 cases of hurthle cell adenoma and 3 cases of Non-Invasive Follicular Thyroid neoplasm with Papillary like nuclear features (NIFTP)were found. The female to male ratio was 5.1:1 and the majority cases were in the age group of 21-50 years (Figure 4, 5).&#xD;
&#xD;
Among the malignant thyroid neoplasms, papillary thyroid carcinoma, PTC was found to be the most common malignant thyroid lesion (90 cases). Of these cases, 71 were female and 19 were male with F: M ratio of 3.7:1 and most of the patients was in 21-40 years of age group (n=56). Two cases of follicular carcinoma (minimally invasive) and 8 cases of medullary carcinoma were documented (Figure 4). Conventional/classic type percutaneous tranhepatic cholangiography (PTC) constituted 84.44% (76/90) of PTC cases. Also, 6 variants were identified including papillary microcarcinoma (5 cases), invasive follicular variant (2 cases), tall cell variant (3 cases), diffuse sclerosing variant (2 cases), columnar cell variant (1 case) and oncocytic variant (1 case) (Figure 5). One of the two cases of the diffuse sclerosing variant was found in association with the thyroglossal cyst.&#xD;
&#xD;
Photomicrographs of some of the thyroid lesions are shown as hurthle cell adenoma (Figure 6), papillary microcarcinoma (Figure 7), a diffuse sclerosing variant of PTC (Figure 8), a tall cell variant of PTC (Figure 9) and medullary thyroid carcinoma (Figure 10).&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
Thyroid lesions are common all over the world and the histopathological spectrum of these lesions vary according to the geographical region, race, age and gender of the studied population. In concordance with the previously published literature,4-9 our study demonstrated that females are more commonly affected than males with the majority of the lesions documented in the age group of 21-40 years. &#xD;
&#xD;
Both neoplastic and non-neoplastic lesions of thyroid are found in this part of the world and we found that neoplastic lesions are more common than non-neoplastic ones in the thyroid specimens sent for histopathological examination. Majority of other authors reported a higher percentage of non-neoplastic lesions, constituting 72.3%, 82%, 83.3% and 84% of thyroid lesions respectively in the studies by Albasri et al.10 Sreedevi et al.11, Fatima &#xA0;et al.5 and Prabha et al.7 In a study by Ramesh12, neoplastic lesions (52.5%) marginally exceeded the non-neoplastic lesions (47.5%). This deviation from the previously published literature could be because of the applicability of fine-needle aspiration cytology and increased expertise of cytopathologists7-9 in accurately diagnosing thyroid lesions, thereby reducing the burden of unnecessary surgeries for non-neoplastic lesions. Also, the increased detection of malignant lesions with the introduction of high-resolution imaging techniques may be responsible for the increased incidence of neoplastic lesions in our study.&#xD;
&#xD;
Among the non-neoplastic lesions, colloid goitre was the most common lesion in our study similar to the previous studies.10-12 The low frequency of Hashimoto thyroiditis in our study was also noted by other authors.13-15 Of the neoplastic lesions, the most common benign tumour reported was follicular adenoma,&#xA0; in consonance with literature.10,12,16 All cases of follicular adenoma showed a single lesion except for one where multiple lesions were identified in right lobe and isthmus. Malignant lesions were found to be more common than benign paralleling the earlier studies.10,17 &#xD;
&#xD;
The most common malignant thyroid tumour is PTC, constituting 85-90% of all differentiated thyroid cancers and females are affected four times than males.1,2,22 PTC was the commonest malignant lesion (91.83%) in our study supporting the increasing trend of this carcinoma documented in studies by other author.12,17-21 The&#xA0; F: M ratio for PTC in our study was 3.7. Similar to earlier studies,11,12,17,18 majority of the PTC were of conventional type (84.44%). Tall cell variant, diffuse sclerosing variant and columnar cell variant are acknowledged by WHO classification of thyroid tumours as biologically aggressive variants, all of which showed up in our study with the frequency of 3.33% (n=3), 2.22% (n=2) and 1.11 % (n=1) respectively. The newly described hobnail cell variant is also proposed to have probably more aggressive biological behaviour.23 Tall cell variant is one of the more common aggressive types of PTC, seen in a slightly older age group than conventional variant.18,24,25 In our study, all three cases were older than 40 years of age.&#xD;
&#xD;
Oncocytic papillary carcinoma is a rare variant characterised by papillary structures with thin fibrovascular cores covered by oncocytic cells.18 This type was first reported in 1995.26 It accounts for less than 10% of all papillary carcinomas 27and less than 0.5% when purely oncocytic without admixture of other patterns3. In our study, only one case (1.11%) of pure oncocytic papillary carcinoma was documented. Follicular thyroid carcinoma, FTC and medullary thyroid carcinoma, MTC account for 6-10 % and 2-3% of all thyroid carcinomas.3 In the current study, there were two cases of follicular carcinoma both were minimally invasive, accounting for 2% of thyroid carcinoma. MTC was the second most common type of malignancy in our study (8%, n=8) and no case of anaplastic carcinoma was found. This retrospective study was of shorter duration (two years), thereby explaining the disparity in the percentages of less common thyroid cancers.&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
This study points to the evolving histopathological spectrum of thyroid diseases with neoplastic lesions showing up as major chunk in thyroidectomy specimens. Females constituted the majority of thyroid lesions and more than half cases were in the age group of 21-40 years. Colloid goitre was the most common non-neoplastic lesion, follicular adenoma, the most common benign tumour and papillary thyroid carcinoma, the most common malignant lesion.&#xD;
&#xD;
CONFLICT OF INTEREST: Nil&#xD;
&#xD;
SOURCE OF FUNDING: Nil&#xD;
&#xD;
ACKNOWLEDGEMENT: Authors acknowledge the immense help received from the scholars whose articles are cited and included in references to this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3435</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3435</Fulltext></URLs><References>&#xD;
	&#xD;
	Kumar V, Abbas AK, Aster JC. Robbins and Cotran Pathologic Basis of Disease. 9th Edition. Philadelphia: Elsevier Saunders; 2015. &#xD;
	&#xD;
	&#xD;
	Pfeifer JD, Dehner LP, Humphrey PA. The Washington Manual of Surgical Pathology. 3rd ed. Philadelphia, PA: Wolters Kluwer, 2019.&#xD;
	&#xD;
	&#xD;
	Lloyd RV, Osamura RY, Kloppel G, et al. WHO Classification of Tumors: Pathology and Genetics of Endocrine Organs. 4th ed. Lyon, France: IARC;2017.&#xD;
	&#xD;
	&#xD;
	Haque WS, Yasmin S, Islam SMJ, et al. Histomorphologic spectrum of thyroid lesions in surgically treated thyroid specimens. Br Dem Med J 2020;10(1):54-59&#xD;
	&#xD;
	&#xD;
	Fatima A, Tolnur RA, Patil BV, et al. Histopathologic spectrum of thyroid lesions. Ind J Path Oncol 2018;5(2):298-301.&#xD;
	&#xD;
	&#xD;
	Abboud B, Ghorra CS, Rassy M. Epidemiologic Study of Thyroid Pathology in a University Hospital. Acta Chir Belg 2015;115:414-417.&#xD;
	&#xD;
	&#xD;
	Prabha V, Bhuvaneswari MG. A study of the histopathological spectrum of thyroid lesions. Int J Sci Stud 2019;7(1):1-4.&#xD;
	&#xD;
	&#xD;
	Negro R, Gharib H, Savoldi L, et al. A longitudinal study of thyroidectomised patients in a region of north Italy: Benign versus malignant disease. Endocr Pract J 2013;19(2):145.&#xD;
	&#xD;
	&#xD;
	Antony J, Celine TM, Chacko M. Spectrum of thyroid disorders: A retrospective study at a medical college hospital. Thyroid Res Pract 2014;11(2):261-264.&#xD;
	&#xD;
	&#xD;
	Albasri AK, Sawaf Z, Hussany AS, et al. Histopathological pattern of thyroid disease in Al-Madinah region of Saudi Arabia. Asian Pac J Cancer Prev 2014;15(14):5565-5570.&#xD;
	&#xD;
	&#xD;
	Sreedevi AR, Sheela KM. Histopathological spectrum of non-neoplastic and neoplastic lesions of thyroid- a 2-year study in a tertiary care teaching hospital. J Med Sci Clin Res 2018;6(6):145-149.&#xD;
	&#xD;
	&#xD;
	Ramesh VL, Ramu S. Study of distribution of Thyroid lesions in a hospital. Int J Sci Res 2014;3(12):541-545.&#xD;
	&#xD;
	&#xD;
	Maechim G, Young MH. De Quervain&amp;#39;s subacute granulomatous thyroiditis: Histologic identification and incidence. J Clin Pathol 1963;16:189-199.&#xD;
	&#xD;
	&#xD;
	&#xA0;Arora HL, Gupta DP. Geographic pathology of thyroid diseases in Rajasthan. J Ind Med Assoc 1967;48:424-428.&#xD;
	&#xD;
	&#xD;
	Jagadale K, Srivastava H and Nimbargi R. Recent trends in the distribution of thyroid lesions in a tertiary care hospital in India. Int J Leps 2016;3(4):234-239.&#xD;
	&#xD;
	&#xD;
	Ariyibi OO, Duduyemi BM, Akang EE. Histopathological patterns of thyroid neoplasms in Ibadan Nigeria: a twenty-year retrospective study. Int J Trop Dis 2013;3:148-156.&#xD;
	&#xD;
	&#xD;
	Beigh A, Amin J, Junaid S. Histopathological study of thyroid neoplastic lesions in a tertiary care hospital &#x2013; A 5-year study. Int J Cont Med Rea 2018;5(4): D4-D7.&#xD;
	&#xD;
	&#xD;
	Lam AKY, Lo CY, Lam KS. Papillary carcinoma of the thyroid: A 30-yr clinicopathologic review of the histologic variants. Endo Path 2005;16(4):323-330.&#xD;
	&#xD;
	&#xD;
	Yang L, Sun TT, Yuan YN. Time trends and pathological characteristics of thyroid cancer in urban Beijing. Endo Path 2013;47:109-112.&#xD;
	&#xD;
	&#xD;
	Yildiz SY, Berkem H, Yuksel BC. The rising trend of papillary carcinoma in thyroidectomies: 14 years of experience in a referral centre of Turkey. World J Surg Oncol 2014;12:34.&#xD;
	&#xD;
	&#xD;
	Amphlett B, Lawson Z, Abdul Rehman GO. Recent trends in the incidence, geographical distribution and survival from thyroid cancer in Wales. J Thyroid 2013;23:1470-80.&#xD;
	&#xD;
	&#xD;
	Goldblum JR, Lamps LW, McKenney JK, Myers JL. Rosai and Ackerman&#x2019;s Surgical Pathology. 11th edition. Philadelphia: Elsevier;2018; 283-331.&#xD;
	&#xD;
	&#xD;
	Asioli S, Erickson LA, Sebo TJ. &#xA0;Papillary thyroid carcinoma with prominent hobnail features a new aggressive variant of moderately differentiated papillary carcinoma. A clinicopathologic, immunohistochemical and molecular study of eight cases. Am J Surg Pathol 2010;34:44-52.&#xD;
	&#xD;
	&#xD;
	Prendiville S, Burman KD, Ringel MD, et al. Tall cell variant: an aggressive form of papillary thyroid carcinoma. Otol Head Neck Surg 2000; 122:352-357.&#xD;
	&#xD;
	&#xD;
	Khanafshar E, Lloyd RV. The Spectrum of Papillary Thyroid Carcinoma Variants. Adv Anat Pathol 2011;18(1):90-97.&#xD;
	&#xD;
	&#xD;
	Apel RL, Asa SL, LiVolsi VA, Papillary Hurthle cell carcinoma with lymphocytic stroma. &#x201C;within-like tumour&#x201D; of the thyroid. Am J Surg Pathol 1995;19:810-814.&#xD;
	&#xD;
	&#xD;
	Carr AA, Yen TWF, Diana LO. Patients with oncocytic variant papillary thyroid carcinoma have a similar prognosis to matched classic papillary thyroid carcinoma controls. Thyroid 2018;28:1462-1467.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Use of Medicinal Plants in Oral Lesions&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>42</FirstPage><LastPage>46</LastPage><AuthorList><Author>Sneha D</Author><AuthorLanguage>English</AuthorLanguage><Author> Magesh KT</Author><AuthorLanguage>English</AuthorLanguage><Author> Sivachandran A</Author><AuthorLanguage>English</AuthorLanguage><Author> Sathya Kumar M</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>The progress of dentistry into an advanced science is a truly remarkable one. The importance and value of dental art and science as a humane service are well recognized. It was people of earlier periods who laid the foundations upon which current day dentistry has been built. The use of indigenous plants for the treatment of various health conditions has been documented since 6,000 BC throughout the Indian subcontinent. The popularity and widespread acceptance of this form of medicine stem from the easy accessibility to local herbs, lower cost, and the absence of any potential chemical additives which are present in conventional drugs. In dentistry, many of these have been studied for their cleansing action, antimicrobial, and antiplaque properties, due to their innate antioxidant and anti-inflammatory mechanisms. In this review, we intend to discuss the use of indigenous plants in treating various oral lesions. A literature review was conducted for finding a solution to show evidence on a metalevel. Two reviewers selected the articles to ensure the quality and reliability of the search protocol. Search engine like Google, Pubmed, Medline and Scopus were used with the key terms herbal extracts, alternative medicine, oral lesions, phytotherapy. Medicinal herbs have been found to possess anti-inflammatory properties and some even demonstrated to have anti-cancer properties. In developing countries still, herbal medicine is considered to be the main system in treating many diseases since it is affordable. But, the end-users should be given sufficient scientific evidence to use them which can be achieved by conducting scientific experiments to confirm their safety and efficacy.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Herbal extracts, Alternative medicine, Oral lesions, Dental herb therapy, Antibacterial, Phytotherapy</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Ayurvedic medicine has often been quoted as the oldest medical system in the world. The use of indigenous plants for the treatment of various health conditions has been documented since 6,000 BC throughout the Indian subcontinent. Traditional healers know over 2500 herbs and use almost 100 species of therapeutic plants in everyday practice.1&#xD;
&#xD;
In recent years, a system of &#x2018;complementary and alternative medicine&#x2019; (CAM) has been recognized by healthcare professionals all over the world. The National Centre for Complementary and Integrative Health (NCCIH, USA) has defined CAM as &#x201C;a group of diverse medical and health care systems, practices, and products that are not presently considered to be part of conventional medicine&#x201D;. Following this, the World Health Organization defined herbal medicine as &#x2018;plant-derived materials or preparations intended for human therapeutic use or other health benefits in humans&#x2019; and categorized it based on the evolution, origin, and current usage into 4 subtypes:&#xD;
&#xD;
&#xD;
	&#xD;
	Indigenous herbal medicine- used primarily by the members of a small local community and the knowledge is passed on over generations.&#xD;
	&#xD;
	&#xD;
	Herbal medicines in systems- the system of medicine that is widely documented and accepted by their respective countries, like Ayurveda, Siddha, and Unani. &#xD;
	&#xD;
	&#xD;
	Modified herbal medicines- plant extracts whose dose, chemistry, and administration have been modified to reach the safety standards of a regulatory body. &#xD;
	&#xD;
	&#xD;
	Imported products with a herbal medicinal base- include all forms of a herb and its extracts that are imported and approved by a national regulatory body.2&#xD;
	&#xD;
&#xD;
&#xD;
USES OF HERBS IN DENTISTRY &#xD;
&#xD;
Phytotherapy or phytomedicine is commonly defined as the study of the use of extracts of natural origin as medicines or health-promoting agents. The popularity and widespread acceptance of this form of medicine stem from the easy accessibility to local herbs, lower cost, and the absence of any potential chemical additives which are present in conventional drugs. &#xD;
&#xD;
Although only a few herbs have been scientifically approved for their medicinal values, a large number of them have always been used as major staples in local cuisine. In dentistry, many of these have been studied for their cleansing action, antimicrobial, and antiplaque properties, due to their innate antioxidant and anti-inflammatory mechanisms. Besides, they have proven to be effective in specific conditions such as recurrent aphthous ulcers, gingivitis, oral infections of Candida albicans, etc.3,4&#xD;
&#xD;
ALOE VERA&#xD;
&#xD;
Aloe barbadensis miller, commonly called Aloe vera, belongs to the Asphodelaceae family. It is a succulent plant, widely cultivated for its ornamental and medicinal properties. This succulence or fleshy nature of the leaves allows the plant to thrive in dry regions with low annual rainfall. The parenchymal tissue of the leaves contains three prominent layers &#xD;
&#xD;
1. An inner layer of colourless mucilaginous gel that is primarily made of water (98-99%)&#xD;
&#xD;
2. A middle layer of yellow sap or latex&#xD;
&#xD;
3. A thick protective outer layer or rind&#xD;
&#xD;
The leaves also contain important bioactive molecules such as aloesin, aloin, aloe-emodin, flavonoids, anthraquinones, etc.&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Aloe vera gel (AVG), extracted from the fleshy leaves, and has been proven to be a potent antibacterial, antifungal, anti-oxidant and immune-boosting agent. As a result, AVG has been studied in the treatment of various oral lesions such as recurrent oral ulcers, oral lichen planus, and oral candidiasis. Besides, AVG gel has also shown positive outcomes in aiding wound healing when used over-extraction sockets.&#xD;
&#xD;
In an in vitro study comparing various dilutions of AVG with standard drugs such as Ciprofloxacin and Ofloxacin, it was found that at higher concentrations (50%, 100%) the gel showed significant potency as an antibacterial agent. However, at concentrations below 50%, no antibacterial effect was reported.5&#xD;
&#xD;
Following this, the effect of aloe vera on colonies of cariogenic and periodontal pathogens was studied by disc diffusion assays and reported based on the zone of inhibition produced by various concentrations. It was found that the minimum inhibitory concentrations (MIC) were much lesser for strains of Streptococcus mutans when compared to Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis. The antibacterial properties of aloe vera against specific pathogens such as Escherichia coli, Salmonella typhi, Klebsiella, Pseudomonas, etc. have also been studied.6&#xD;
&#xD;
TURMERIC&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Curcuma longa(C.longa), commonly used as a household ingredient turmeric, has been used for its therapeutic properties in Ayurveda, Siddha, and Unani medicine. It contains a class of phytochemicals known as curcuminoids, namely curcumin, dimethoxy curcumin, and bisdemethoxycurcumin.&#xD;
&#xD;
Curcuminoids have shown significant anti-inflammatory, antioxidant, and anticancer properties in in-vivo and ex-vivo studies. This anti-inflammatory action is attributed to its inhibitory effect on enzymes such as Cyclooxygenase-2 (COX-2), lipoxygenase (LOX), and inducible nitric oxide synthase enzymes (iNOS). It also blocks the release of cytokines such as tumour necrosis factor (TNF), and interleukins (IL) 1, 2, 6, 8, and 12. The immunomodulatory effect of curcumin has also been correlated to its activation of host macrophages and natural killer cells and regulation of lymphocyte-mediated function.7&#xD;
&#xD;
A study comparing the effect of 1% curcumin oral gel with 0.1% paste of triamcinolone acetonide was conducted in patients with oral lichen planus (OLP), and it was found that the pain and burning sensation was significantly reduced with the use of the natural alternative. It was concluded that although turmeric gel cannot be used independently in the management of OLP, it could be used in the maintenance phase of treatment, following the initial phase of standard corticosteroid therapy.8 Similarly, when higher doses of curcuminoids were administered systemically in patients with OLP, greater control of the symptoms was observed.&#xD;
&#xD;
In a randomized controlled trial conducted among known cases of Oral submucous fibrosis (OSMF), leukoplakia, and OLP, it was found that curcumin produced a marked reduction in the pain scores, as well as the extent of the mucosal lesions, and an increased mouth opening was observed in patients with OSMF. This effect of curcumin on these potentially malignant conditions was associated with a rise in vitamin C and E, and subsequent inhibition of damage to DNA or lipid peroxidation.9&#xD;
&#xD;
TULSI&#xD;
&#xD;
Ocimumsanctum (O.sanctum), commonly known as holy basil or Tulsi is an aromatic plant used for religious and traditional medicinal practices. The main phytochemical components of tulsi are saponins, flavonoids, triterpenoids, and tannin. Other bioactive molecules include oleanolic acid,&#xA0;ursolic acid,&#xA0;rosmarinic acid,&#xA0;eugenol,&#xA0;carvacrol,&#xA0;linoleic acid, and&#xA0;&#x3B2;-caryophyllene.&#xD;
&#xD;
In an experimental study conducted on rats, the combined antioxidant, anti-inflammatory and analgesic properties of tulsi have shown positive results in aiding wound healing. Ethanolic extracts of O. sanctum have shown greater wound breaking strength, a faster rate of epithelialization with the substantial rise in wound contraction.4&#xD;
&#xD;
Herbal mouth rinses containing extracts of tulsi have shown antibacterial activity specifically against strains of Streptococcus mutants. In a comparative evaluation of a herbal mouth rinse containing tulsi and a standard sodium fluoride mouth rinse, it was found that this inhibitory effect on the pathogen was achieved employing increasing salivary pH levels resulting in reduced virulence of the bacteria.10 Clinical trials conducted with a tulsi mouth rinse and 0.2% Chlorhexidine mouth rinses have provided similar results, and patients have shown to favour the natural alternative due to better taste and convenience. &#xD;
&#xD;
The antibacterial action of extracts of O. sanctum has been attributed to the nature of the formulation. While aqueous extracts have shown a greater inhibitory effect on Klebsiellapneumoniae, Escherichiacoli, Candida albicans, and Staphylococcus aureus, the alcoholic extracts showed greater antagonistic effects on Vibrio cholerae.&#xD;
&#xD;
An experiment conducted on hamsters with 7,12-dimethyl benza-anthracene (DMBA) induced buccal pouch carcinogenesis highlighted the anticancer property of O. sanctum extracts. Simultaneous topical application of aqueous extracts along with oral administration of ethanolic extracts, showed substantially lesser development of oral papillomas and squamous cell carcinomas.11&#xD;
&#xD;
POMEGRANATE&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Punicagranatum (P. granatum), commonly called pomegranate, is a shrub that is native to the Indian subcontinent. It is abundant with phytochemicals like tannins, flavones, and anthocyanins (like delphinidin and cyanidin) which produce the bright red colour of the fruit extracts. These molecules have been studied for their chemopreventive and anti-inflammatory effects on cells. Besides, the seeds are a rich source of punicic acid, oleic and linoleic acid, palmitic acid, and stearic acid.&#xD;
&#xD;
These phytochemicals have shown a substantial inhibitory effect on inflammatory mediators. Punicic acid has shown an antagonistic effect on prostaglandin synthesis, while pomegranate seed oil has shown suppression of cyclooxygenase and lipoxygenase enzymes. The presence of tannins has led researchers to believe that P. granatum can promote wound healing and enhance collagen stabilization due to the inherent affinity of these molecules for proteins, and hence reduce tissue destruction in periodontal disease. The combined effect of tannins and polyphenols has also been attributed to the greater proliferation of fibroblasts and collagen formation, along with faster wound healing and angiogenesis.&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The anaesthetic effect of tannins has also been under study. Topical application of extracts of P. granatumhave elicited lower gag reflex in the soft palate and in the tonsillar region. Methanolic extracts obtained from the peel of the P.granatum fruit (MEPGP) have shown antibacterial properties under various concentrations. While the growth of Staphylococcus aureus and Staphylococcus epidermidis was inhibited at all concentrations between 4-12 mg/mL, significant inhibition of Streptococcus sanguinis, Lactobacillus acidophilus, Streptococcus mutans, and Streptococcus salivarius were observed at concentrations between 8-12 mg/mL.12&#xD;
&#xD;
PAPAYA, FENUGREEK, CINNAMON&#xD;
&#xD;
Carica papaya(C.papaya), commonly known as papaw or papaya fruit is a rich source of vitamins A, C, and E, along with magnesium, potassium, folate and pantothenic acid. The seeds contain phenolic compounds like benzyl isothiocyanate and carotenoids, while the extracts of papaya leaves are high in food fibres and flavonoids.&#xD;
&#xD;
In an experimental study conducted on mice (Mus musculus) with gingival ulcerations to verify the therapeutic properties of papaya leaf extract at various concentrations, it was found that at all concentrations between 25-75% the extract acted as a potent antioxidant and allowed wound healing and contraction. At 75% concentration, the rate of epithelialisation was accelerated with better fibroplasia and wound contraction.13&#xD;
&#xD;
In an in vitro study of alcoholic extracts obtained from Carica papaya, Trigonella foenum-graecum (fenugreek), and Cinnamomumverum (cinnamon), all of the herbal alternatives showed significant anti-fungal activity against Fluconazole resistant Candida albicans.4 Additionally, in an evaluation of the antifungal activity of cinnamon bark oil, it was found that along with the fungicidal properties, aqueous extracts of cinnamon showed the potential to reinforce the oral epithelial barrier and prevent the formation of biofilms by Candida albicans.14&#xD;
&#xD;
CRANBERRY&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Cranberries are Vaccinium macrocarpon (V.macrocarpon) and contain proanthocyanidins (PACs) and anthocyanidins.&#xA0; It was used to prevent recurrent urinary tract infections and has been postulated to inhibit bacterial adherence due to the presence of proanthocyanidin.15 Cranberry flavonols have shown an inhibitory effect on the enzymes of Streptococcus mutans. A comparison of these biomolecules on their antibacterial effects demonstrated that the highest inhibition of Streptococcus mutans was exhibited by PACs, followed by the flavonols. &#xA0;&#xA0; Extracts of V. macrocarpon have shown the highest antibacterial properties on periodontal pathogens like Porphyromonas gingivalis, Fusobacterium nucleatum, and Aggregatibacter actinomyecetomcomitans at bactericidal concentrations of 0.25 mg/mL. Other oral microbes like Veillonellaparvula and Streptococcus oralis were inhibited at concentrations above 1mg/mL.16&#xD;
&#xD;
NEEM&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Azadirachtaindica (A.indica), known as neem or Indian lilac, has been cultivated for its herbal properties for over two millennia. While the most significant biomolecules of A.indica are azadirachtins, the leaf extracts also contain Nimbolinin, Nimbin, Nimbidin, Nimbanene, Quercetin, Gedunin, and Salannin.&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; An in vitro study using the chloroform based crude extracts of A.indica, demonstrated a significant antioxidant potential of the leaves. Azadirachtin has shown to antagonise the development of buccal pouch carcinogenesis and prevent Deoxy Ribonucleic Acid damage with chemopreventive effect in hamsters. Further, the leaf extracts have been associated with the induction of apoptosis in target organs. 17 Inactivation of viral strains by interruption of the replication mechanism by the leaf extracts has also been observed. A.indica mouth rinses have also shown positive outcomes in controlling periodontal pathogens comparable to standard chlorhexidine mouth rinses. Both aqueous and ethanolic extracts have inhibited strains of Fusobacterium nuceatum.18&#xD;
&#xD;
CHAMOMILE&#xD;
&#xD;
Chamomile tea obtained from the leaves of Matricaria chamomilla (M.chamomilla), is widely consumed for its therapeutic properties. It is a rich source of sesquiterpenes, flavonoids, and coumarins. The powdered form of chamomile leaves has been used topically to treat perioral inflammation, skin eruptions, and infections of the mouth. This topical application has shown to accelerate wound healing and also have an analgesic effect.&#xD;
&#xD;
In a double-blind clinical study analysing the rate of wound healing, the topical application of M.chamomilla extracts allowed faster wound drying with re-epithelialisation. Chamomile has also exhibited antioxidant properties in inhibition of lipid peroxidation and blocking the formation of reactive chemical entities in tissue. Apigenin, found in M.chamomilla has shown chemopreventive effects in Oral Squamous Cell Carcinoma due to its inherent potential to interfere with the cell cycle at several stages of carcinogenesis. 19&#xD;
&#xD;
CLOVE &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Clove oil, obtained from Syzygiumaromaticum(S.aromaticum), is rich in thymol, eugenol, carvacrol, cinnamaldehyde, and &#x3B2;-caryophyllene. The eugenol component has an inherent affinity for free radicals, and hence clove oil acts as a potent antioxidant. Besides, eugenol has also demonstrated the alteration of ergosterol structure, which is the main component of fungal cell membranes. Studies have also correlated the antifungal potency of eugenol with the inhibition of germ tube formation in strains of Candida albicans.20&#xD;
&#xD;
TOXICITY OF HERBAL EXTRACTS&#xD;
&#xD;
Herbal medicine has received criticism due to its potential to cause side-effects or toxicities when consumed without regulation. This is attributed to the lack of standardization of doses and form of administration in various communities. Toxicities also arise due to adulteration or inappropriate processing of dietary herbal supplements, interactions of these extracts with conventional drugs, as well as the inherent toxins associated with some plant species. Metabolomics is the study of bioactive molecules or metabolites in tissues, biofluids, etc. The most recent approach in the management of herbal toxicities involves a metabolomic analysis of the phytochemical constituents present in each medicinal plant. This is done via phytochemical profiling and fingerprinting.21 While &#x2018;phytochemical profiling&#x2019; involves a targeted analysis to detect the presence of known biomolecules in a plant extract, &#x2018;phytochemical fingerprinting&#x2019; refers to the identification of all molecular species found in a sample.&#xA0; A holistic analysis of the phytochemicals in herbal extracts can allow better control over manifestations of toxicities and negate side effects.&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Traditional medicine has played a key role in the prevention and treatment of various diseases since time immemorial. The use of indigenous medicinal plants is widely being used independently, and as an adjunct to conventional forms of treatment in the management of many oral lesions. Herbal extracts of Aloe vera, Ocimumtenuiflorum (Tulsi), Curcuma longa (turmeric), etc, have shown positive outcomes in the management of gingivitis, oral ulcers, and other mucosal lesions. In developing countries still, herbal medicine is considered to be the main system in treating many diseases as it is affordable and it is the responsibility of the practitioner to use them ethically. &#xD;
&#xD;
Acknowledgement:&#xD;
&#xD;
"Authors acknowledge the immense help received from the scholars whose articles are cited and included in references to this manuscript.&#xA0;The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed."&#xD;
&#xD;
Financial support: Self-funded &#xD;
&#xD;
Conflict of Interest:&#xA0; NIL &#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3436</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3436</Fulltext></URLs><References>&#xD;
	&#xD;
	Gazzaneo LRS. Lucena RFP, Albuquerque UP. Knowledge and use of medicinal plants by local specialists in a region of Atlantic Forest in the state of Pernambuco (Northeastern Brazil). J Ethnobiol Ethnomed 2005; 1(9):1-8.&#xD;
	&#xD;
	&#xD;
	Chaudhary A, Singh N. Contribution of world health organization in the global acceptance of Ayurveda.&#xA0;J Ayur Integr Med&#xA0;2011;2:179&#x2013;186.&#xD;
	&#xD;
	&#xD;
	Varadarajan S, Narasimhan M, Malaisamy M, Duraipandian C. Invitro Anti-mycotic Activity of Hydro Alcoholic Extracts of Some Indian Medicinal Plants against Fluconazole Resistant Candida albicans.&#xA0;J Clin Diagn Res 2015;9(8):ZC07-ZC10. &#xD;
	&#xD;
	&#xD;
	Shetty S, Udupa S, Udupa L. Evaluation of Antioxidant and Wound Healing Effects of Alcoholic and Aqueous Extract of Ocimum sanctum Linn in Rats.&#xA0;Evid Based Complement Altern Med 2008;5(1):95-101. &#xD;
	&#xD;
	&#xD;
	Jain S, Rathod N, Nagi R, Sur J, Laheji A, Gupta N et al. Antibacterial Effect of Aloe Vera Gel against Oral Pathogens: An In-vitro Study.&#xA0;J Clin Diagn Res 2016;10(11): ZC41-ZC44. &#xD;
	&#xD;
	&#xD;
	Fani M, Kohanteb J. Inhibitory activity of Aloe vera gel on some clinically isolated cariogenic and periodontopathic bacteria.&#xA0;J Oral Sci 2012;54(1):15-21. &#xD;
	&#xD;
	&#xD;
	Yadav VS, Mishra KP, Singh DP, Mehrotra S, Singh VK. Immunomodulatory effects of curcumin.&#xA0;Immunopharmacol Immunotoxicol 2005;27(3):485-497. &#xD;
	&#xD;
	&#xD;
	Thomas AE, Varma B, Kurup S, Jose R, Chandy ML, Kumar SP et al. Evaluation of Efficacy of 1% Curcuminoids as Local Application in Management of Oral Lichen Planus - Interventional Study.&#xA0;J Clin Diagn Res 2017;11(4):ZC89-ZC93.&#xD;
	&#xD;
	&#xD;
	Rai B, Kaur J, Jacobs R, Singh J. Possible action mechanism for curcumin in pre-cancerous lesions based on serum and salivary markers of oxidative stress.&#xA0;J Oral Sci 2010;52(2):251-256.&#xD;
	&#xD;
	&#xD;
	Megalaa N, Thirumurugan K, Kayalvizhi G, Sajeev R, Kayalvizhi EB, Ramesh V, et al. A comparative evaluation of the anticaries efficacy of herbal extracts (Tulsi and Black myrobalans) and sodium fluoride as mouth rinses in children: A randomized controlled trial. Indian J Dent Res 2018;29:760-767.&#xD;
	&#xD;
	&#xD;
	Karthikeyan K, Ravichandran P, Govindasamy S. Chemopreventive effect of Ocimum sanctum on DMBA-induced hamster buccal pouch carcinogenesis.&#xA0;Oral Oncol 1999;35(1):112-119.&#xA0;&#xD;
	&#xD;
	&#xD;
	AbdollahzadehSh, Mashouf R, Mortazavi H, Moghaddam M, Roozbahani N, Vahedi M. Antibacterial and antifungal activities of Punica granatum peel extracts against oral pathogens.&#xA0;J Dent (Tehran) 2011;8(1):1-6.&#xD;
	&#xD;
	&#xD;
	Hakim RF, Fakhrurrazi, Dini. Effect of&#xA0;Carica papaya&#xA0;Extract toward Incised Wound Healing Process in Mice (Mus musculus) Clinically and Histologically.&#xA0;Evid Based Complement Alternat Med 2019:8306519. &#xD;
	&#xD;
	&#xD;
	Veilleux MP, Grenier D. Determination of the effects of cinnamon bark fractions on Candida albicans and oral epithelial cells.&#xA0;BMC Complement Altern Med 2019;19(1):303. &#xD;
	&#xD;
	&#xD;
	&#xA0;Suman E, Chakraborty A, Kotian SM. Does black grape juice inhibit bacterial adherence and biofilm production by uropathogenic escherichia coli just as cranberry juice?. Int J Cur Res Rev 2015;13(7):51-53.&#xA0; &#xD;
	&#xD;
	&#xD;
	S&#xE1;nchez MC, Ribeiro-Vidal H, Bartolom&#xE9; B, Figuero, E.; Moreno-Arribas, M.V.; Sanz, M et al. New Evidences of Antibacterial Effects of Cranberry Against Periodontal Pathogens.&#xA0;Foods 2020;9(2):246. &#xD;
	&#xD;
	&#xD;
	Priyadarsini RV, Manikandan P, Kumar GH, Nagini S. The neem limonoids azadirachtin and nimbolide inhibit hamster cheek pouch carcinogenesis by modulating xenobiotic-metabolizing enzymes, DNA damage, antioxidants, invasion and angiogenesis.&#xA0;Free Radic Res 2009;43(5):492-504.&#xD;
	&#xD;
	&#xD;
	Lekshmi N. C. J. P., Sowmia N., Viveka S., Brindha Jr., Jeeva S. The inhibiting effect of&#xA0;Azadirachtaindica&#xA0;against dental pathogens.&#xA0;Asian J Plant Sci Res 2012;2(1):6-10.&#xD;
	&#xD;
	&#xD;
	Maggioni D, Garavello W, Rigolio R, Pignataro L, Gaini R, Nicolini G. Apigenin impairs oral squamous cell carcinoma growth in vitro inducing cell cycle arrest and apoptosis.&#xA0;Int J Oncol 2013;43(5):1675-1682.&#xD;
	&#xD;
	&#xD;
	Pinto E, Vale-Silva L, Cavaleiro C, Salgueiro L. Antifungal activity of the clove essential oil from Syzygiumaromaticum on Candida, Aspergillus and dermatophyte species.&#xA0;J Med Microbiol 2009;58(Pt 11):1454-1462.&#xA0;&#xD;
	&#xD;
	&#xD;
	Simmler C, Kulakowski D, Lankin DC, McAlpine JB, Chen SN, Pauli GF. Holistic Analysis Enhances the Description of Metabolic Complexity in Dietary Natural Products. Adv Nutr 2016;7(1):179-189. &#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Hyperglycemic Activity of Chenopodium Quinoa in Diabetic Rats and its Potential Health Benefits &#x2013; Functional Superfood for Todays World&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>47</FirstPage><LastPage>53</LastPage><AuthorList><Author>Gopika R</Author><AuthorLanguage>English</AuthorLanguage><Author> Senthilkumar G</Author><AuthorLanguage>English</AuthorLanguage><Author> Karthy ES</Author><AuthorLanguage>English</AuthorLanguage><Author> Panneerselvam A</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Quinoa is crop developed regularly as an oat feast. Concerning the most fundamental supplements, it is viewed as the world&#x2019;s perhaps the most popular wellbeing nourishments. Quinoa has over the top nutritive esteem and can acquire food security around the world. The 2013th year was considered as &#x201C;the international year of the quinoa&#x201D;. Objective: To evaluate the Phytochemicals, Minerals and Vitamins content, hyperglycemic activity of the quinoa seed powder (QSP) and their effect on diabetic rats. Methods: Major phytoconstituents in the quinoa seed powder were tested according to standard methods. Minerals and Vitamins were analysed with an atomic absorption spectrophotometer. The antidiabetic effect was evaluated in streptozotocininduced diabetic rats following oral administration of probiotics and different concentration of quinoa seed powder in. Results: A large number of minerals found in quinoa seeds powder had the content of Magnesium, Zinc, Chromium, Manganese, and Vanadium. Quinoa seed powder administered up to 28 days (150, 250 and 350 mg/kg) significantly improve the alterations in blood glucose levels in diabetic rats and no histopathological changes were observed. Conclusion: Incorporation of quinoa in our diet not only increases the nutritive value alternatively will also minimize the risk of various health illness like cardiovascular diseases, type 2 diabetes, etc. Use of quinoa represents a promising region of research as its use in our daily diet can enhance the consumption of certain essential nutrients and phytochemicals which caters important health benefits.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Diabetes, Quinoa Seed Powder (QSP), Phytochemicals, Vitamin and Minerals, Histopathology, Probiotics</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Diabetes mellitus (DM) is in all likelihood one of the oldest ailments recognised to man. It was once first pronounced in Egyptian manuscript about 3000 years in the past.1 In 1936, the difference between kind 1 and kind two DM was once definitely made. Type two DM used to be first described as an issue of metabolic syndrome in 1988.2 Type 2 DM (formerly recognized as non-insulin dependent DM) is the most frequent form of Diabetes Mellitus characterized by hyperglycemia, insulin resistance, and relative insulin deficiency.3 Type 2 Diabetes Mellitus Outcomes from the interaction between genetic, environmental and behavioural risk factors.4 It is estimated that 366 million human beings had DM in 2011; through 2030 this would have risen to 552 million. The number of human beings with type 2 DM is increasing in every country with 80% of human beings with DM residing in low- and middle-income countries. DM caused 4.6 million deaths in 2011. It is estimated that 439 million humans would have kind two DM employing the year 2030.5 The incidence of kind two DM varies drastically from one geographical vicinity to the different result of environmental and way of life danger factors. People residing with type 2 DM are more susceptible to various types of short- and long-term complications, which frequently lead to their premature death. This tendency of increased morbidity and mortality is seen in patients with type 2 DM due to the fact of the commonness of this type of DM, its insidious onset and late recognition, particularly in resource-poor developing countries.6&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Quinoa, a pseudo-cereal, is recognized as one of the world&#x2019;s healthiest foods due to its excessive nutritional value along with its potential to cater to various health benefits. Being an accurate source of whole protein (contains all the nine crucial amino acids), unsaturated fatty acids, minerals, vitamins, fibre and antioxidants, it is considered as &#x201C;superfood&#x201D;. Quinoa additionally assists with decreasing the danger of different sicknesses like cardiovascular infections, type-2 diabetes, some malignant growth, over the top pulse, heftiness and is likewise a decent choice for people who are hypersensitive to certain nutrition classes. Its biodiversity and functionally to sustain in unfavourable adverse climatic conditions make it a perfect crop to cultivate worldwide particularly in below developing countries of Asia and Africa, where food production is threatened by global climatic changes. Hence, the existing world demands to increase the awareness regarding the various functional benefits of quinoa to fight one of the world&#x2019;s major crises, that is, starvation and malnutrition.7&#xD;
&#xD;
Quinoa is a species of the goosefoot genus. It&#x2019;s a crop grown particularly for its edible seeds. Being high in various essential nutrients, it is considered as world&#x2019;s one of the most popular health foods. The Food and Agricultural Organization of the United Nations (FAO) formally declared the yr 2013 as &#x201C;The International Year of The Quinoa&#x201D;. FAO declared quinoa as a portion of food with excessive nutritive value, widespread biodiversity and as a food which can have an important role to play in the achievement of food security worldwide.8 Being exceptionally nutritious, quinoa additionally imparts various health benefits which makes it an excellent example of &#x2018;functional food&#x2019; as suggested.&#xD;
&#xD;
Quinoa seeds (Chenopodium quinoa) contain a significant number of phytochemicals including flavonoids, phenolic acids, squalene, phytosterol, saponins, fat-soluble vitamins, fatty acids, trace elements and other compounds. The eating regimen of individuals needs numerous supplements, especially some significant minerals like magnesium, potassium, zinc and iron. The absence of iron is perhaps the most incessant nourishment insufficiencies. It keeps our red platelets solid and conveys oxygen starting with one then onto the next cell and builds mind works alongside another significant capacity in our body. Dietary minerals are essentially chemical factors that play a functional role in regulating electrolyte balance, glucose homeostasis, the transmission of nerve impulses and enzyme cofactors in the body. Calcium, magnesium and potassium in quinoa are found in sufficient quantities and bioavailable forms necessary for maintaining a balanced human diet.9&#xD;
&#xD;
Quinoa is also a good source of B nutritional nutrients riboflavin and folic corrosive. Riboflavin improves energy digestion inside mind and muscle cells, and folic corrosive assumes an essential part for legitimate cerebrum work and is significant for acceptable mental and enthusiastic wellbeing. It is a significant nutrient for pregnant ladies as it brings down the danger of unbiased birth surrenders. Quinoa additionally includes a significant amount of vitamin E, which acts as an antioxidant, even though the quantity declines after processing and cooking.10 Low level of vitamin E are associated with an increased incidence of diabetes and some research suggests that people with diabetes have decreased level of antioxidants. &#xD;
&#xD;
Our study aimed to evaluate the hyperglycemic activity and histopathological changes that occur in diabetic albino rats fed on different concentration of quinoa seed powder. Besides, the willpower of the dietary properties, chemical composition, phenolic content material in quinoa seed powder.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Quinoa seeds (Chenopodium quinoa) was obtained from the online supermarket. The dry seeds were powdered and packaged in moisture-proof containers and stored in a freezer. They were conditioned at room temperature before use.&#xD;
&#xD;
Phytochemical screening &#xD;
&#xD;
Major phytoconstituents in the quinoa seed powder such as alkaloids, saponins, tannin, steroids, flavonoids, glycosides, terpenoids and anthraquinone were tested according to standard methods.11-13&#xD;
&#xD;
Test for alkaloids &#xD;
&#xD;
A total of 0.5 g quinoa seed powder was mixed with methanol containing 1% HCl and then boiled and filtered. A total of 2 ml of 10% NH3 and 5 ml of chloroform was added to 5 ml of the filtrates and shaken gently to extract the alkaloidal base. The chloroform layer was extracted with 2 ml of acetic acid, and Mayer&#x2019;s reagent was added. The formation of cream (with Mayer&#x2019;s reagent) or presence of turbidity used to be viewed as the presence of alkaloids.&#xD;
&#xD;
Test for saponins &#xD;
&#xD;
Two grams of quinoa seed powder was boiled in 20 ml of water in a water bath and filtered. A total of five ml of the filtrates were mixed with three ml distilled water in a test tube and shaken vigorously. Frothing, which persisted on warming, was considered preliminary evidence for the presence of saponins. A few drops of olive oil had been delivered to the extract and shaken vigorously. The appearance of the formation of soluble emulsion in the extracts was indicative for the presence of saponins.&#xD;
&#xD;
Test for tannins &#xD;
&#xD;
Quinoa seed powder was treated with 15% ferric chloride test solution. The blue colour in the mixtures signified the presence of hydrolysable tannin. For confirmation, 0.5g of the extracts were added to 10 mL of freshly prepared potassium hydroxide (KOH) in a beaker and shaken to dissolve. A dirty precipitate was indicative of the presence of tannin. &#xD;
&#xD;
Test for steroids (Liberman-Buchard reaction) &#xD;
&#xD;
About 200 mg of quinoa seed powder was once dissolved in two ml chloroform. Sulfuric acid used to be carefully added to form a lower layer. A reddish-brown colour at the interface used to be indicative of the presence of steroidal rings.&#xD;
&#xD;
Test for flavonoids &#xD;
&#xD;
Three methods were used to determine the presence of flavonoids in the quinoa seed powder A total of 5 ml of 10% ammonia solution was added to a portion of the aqueous filtrate from the shoot extract of the cover crops followed by addition of concentrated H2S04. A yellow colouration observed in each extract was used to validate the presence of flavonoids. About 200 mg of quinoa seed powder was once dissolved in two ml chloroform. Sulfuric acid used to be carefully added to form a lower layer. A reddish-brown colour at the interface used to be indicative of the presence of steroidal rings. &#xD;
&#xD;
Test for cardiac glycosides (Keller-Killani test) &#xD;
&#xD;
A total of 2 gm of quinoa seed powder was treated with 2 ml glacial acetic acid containing one drop of ferric chloride solution. This used to be underlaid with one ml of concentrated sulfuric acid. The formation of a brown ring of the interface was indicative of the presence of a deoxy sugar of cardenolides. &#xD;
&#xD;
Test for terpenoids (Salkowski test) &#xD;
&#xD;
A total of 5 gm of quinoa seed powder was mixed in 2 ml of chloroform, and concentrated H2S04 (3 ml) was carefully added to separate the 2 layers distinctly. A reddish-brown colouration of the interface was formed to confirm the presence of terpenoids.&#xD;
&#xD;
Test for anthraquinone (Borntrger&#x2019;s test) &#xD;
&#xD;
About 0.5 g of the quinoa seed powder was taken into a dry test tube and 5 ml of chloroform was added and shaken for 5 min. The extract used to be filtered and the filtrate was shaken with an equal quantity of 10% ammonia solution. A red-violet or purple colour in the ammonia layer was observed which indicates the presence of anthraquinones.&#xD;
&#xD;
Determination of Vitamins and Minerals&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Minerals (Magnesium, Zinc, Manganese, Vanadium and Chromium) and Vitamins (Vitamin -D and Vitamin -E) were analysed with an atomic absorption spectrophotometer (AAS; Shimadzu Instruments, Inc., SpectrAA-220.&#xD;
&#xD;
Experimental Design &#xD;
&#xD;
Adult male albino Wistar rats (6 weeks), weighing 150 g to 200 g were used for the present antidiabetic study. The animals were housed in clean polypropylene cages and maintained in a well-ventilated temperature-controlled animal residence with a regular 12 h light/dark schedule. The animals had been fed with preferred rat pelleted diet (Hindustan Lever Ltd., Mumbai, India) and clean ingesting water used to be made available ad libitum. All animal procedures were performed after approval from the ethical committee IAEC NO: KMCRET/Ph.D/10/2017-2018 and following the recommendations for the proper care and use of laboratory animals.&#xD;
&#xD;
The animals were divided into four groups of six animals each. The rat 6 weeks animals are kept overnight fasting and Streptozotocin was dissolved in citrate buffer (pH 4.5) and nicotinamide was dissolved in normal physiological saline. Non-insulin subordinate diabetes mellitus was incited in for the time being abstained rodents by a solitary intraperitoneal infusion of 60 mg/kg streptozotocin, 15 min after the i.p organization of 120 mg/kg of nicotinamide. &#xD;
&#xD;
Hyperglycemia was confirmed by the elevated levels of blood glucose were determined at 72 hrs. The animals with blood glucose level more than 250mg/dl will be used for the study.14&#xD;
&#xD;
The Six experimental groups with six rats each prepared as per given schedule.&#xD;
&#xD;
Group 1: Control only normal saline&#xD;
&#xD;
Group 2: Only Streptozotocine 60 mg/kg/b.w. (IP) +Nicotinamide 120mg/kg (po)&#xD;
&#xD;
Group3: Streptozotocin (60 mg/kg) Nicotinamide 120mg/kg (po) rats treated with&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xA0;Glibenclamide 20 mg/kg(po)&#xD;
&#xD;
Group4: Streptozotocin (60 mg/kg) +Nicotinamide 120mg/kg (po) rats treated with &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xA0;Chenopodium quinoa 150 mg/Kg. &#xD;
&#xD;
Group5: Streptozotocin (60 mg/kg) +Nicotinamide 120mg/kg (po) rats treated with &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xA0; Chenopodium quinoa 250 mg/Kg.&#xD;
&#xD;
Group6: Streptozotocin (60 mg/kg) +Nicotinamide 120mg/kg (po) rats treated with &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xA0; Chenopodium quinoa 350 mg/Kg&#xD;
&#xD;
The fasting animal body, blood glucose level used to be estimated on 1st,7th,14th, 21st and 28th day. At the end of experimental period rats were fasted overnight and anaesthetized with Ketamine; blood samples were collected through retro-orbital sinus puncture after 90 min administration of treatment doses to the respective group animals with or without EDTA container for biochemical parameters estimation. Fasting blood glucose level used to be measured by using Accu-Check active blood glucose meter (Roche Group, Indianapolis, In USA)&#xD;
&#xD;
Histopathologic Analysis &#xD;
&#xD;
The pancreases were fixed for 48 hrs in 10% formalin saline and processed through the paraffin technique. Sections of 5-micron thickness have been cut and stained by using hematoxylin and eosin (H &amp; E) for histological examination. Observation of slides was once performed under a light microscope (DM2000; Leica, Bensheim, Germany).&#xD;
&#xD;
Statistical Analysis &#xD;
&#xD;
The data were analysed by one-way ANOVA followed by Dunnett test. p</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3437</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3437</Fulltext></URLs><References>1. Ahmed AM. History of diabetes mellitus. Saudi Med J 2002;23(4);373-378.&#xD;
&#xD;
2. Patlak M. New weapons to combat an ancient disease: treating diabetes. FASEB J 2002;16(14):1853. &#xD;
&#xD;
3. Maitra A, Abbas AK. Endocrine system. In: Kumar V, Fausto N, Abbas&#xD;
&#xD;
AK (eds). Robbins and Cotran Pathologic basis of disease (7th ed). Philadelphia, Saunders 2005;1156-1226.&#xD;
&#xD;
4. Chen L, Magliano DJ, Zimmet PZ. The worldwide epidemiology of type 2 diabetes mellitus: present and future perspectives. Nat Rev Endocrinol 2011;8(4):228-36.&#xD;
&#xD;
5. Chamnan P, Simmons RK, Forouhi NG, Luben R, Khaw Ky, Wareham NJ.&#xA0; Incidence of type 2 diabetes using proposed HbA1c diagnostic criteria in the EPIC-Norflok cohort: Implication for preventive strategies. Diabetes Care. 2011 Apr; 34(4): 950&#x2013;956.&#xD;
&#xD;
6. Zimmet P, Alberti KG, Shaw J. Global and societal implications of the diabetes epidemic. Nature 2001;414(6865):782-787.&#xD;
&#xD;
7. Shilpi S, Rashmi S, Kunwar Vikash S. Quinoa (Chenopodium Quinoa Willd), functional super food for today&#x2019;s world: A Review. World Sci News 2016;58:84-96. &#xD;
&#xD;
8. Gordillo-Bastidas E, Diaz-Rizzolo DA, Roura E, Massanes T, Gomis R. Quinoa (Chenopodium quinoa Willd), from nutritional value to potential health benefits: An integrated review. J Nutr Food Sci 2016;6(3).&#xD;
&#xD;
9.&#xA0; Vega-G&#xE1;lvez A, Miranda M, Vergara J, Uribe E, Puente I, Mart&#xED;nez EA. Nutritional facts and potential of quinoa (Chenopodium quinoa Willd) an ancient Andean grain: a review. J Sci Food Agric 2010;90;2541-2547.&#xD;
&#xD;
10. Kaziol M. Chemical composition and nutritional evaluation of quinoa (Chenopodium quinoa Willd). J Food Compos Anal 1992;5:35-68. &#xD;
&#xD;
11. Parekh J, Chanda SV.&#xA0; In vitro antimicrobial activity and phytochemical analysis of some Indian medicinal plants. Turk J Biology 2007;31;53-58. &#xD;
&#xD;
12. Sofowora A. Medicinal plants and traditional medicine in Africa. John Willey and Sons 1982:142-146. &#xD;
&#xD;
13. Onwukeame DN, Ikuegbvweha TB, Asonye CC. Evaluation of phytochemical constituents, antibacterial activities and effects of exuding of pycanthus angolesis weld warb (Mysristicaeceae) on corneal ulcers in the rabbit. Trop J Pharm Res 2007; 6:725&#x2212;730. &#xD;
&#xD;
14. Masiello P, Broca C, Gross R, Roye M, Manteghetti M, Hillaire-Buys D, et al. Experimental NIDDM: development of a new model in adult rats administered streptozotocin and nicotinamide. Diabetes 1998;47:224-229.&#xD;
&#xD;
15. Zeng X, Cheng KW, Jiang Y, Lin ZX, Shi JJ, Ou SY, et al. Inhibition of acrylamide formation by vitamins in model reactions and fried potato strips. Food Chem 2009;116(1):34-39. &#xD;
&#xD;
16. Graf BL, Poulev A, Kuhn P, Grace MH, Lila MA, Raskin I. Quinoa seeds leach phytoecdysteroids and other compounds with anti-diabetic properties. Food Chem 2014;163:178-185.&#xD;
&#xD;
17. Graf BL, Rojas?Silva P, Rojo LE, Delatorre?Herrera J, Baldeon ME, Raski I. Innovations in health value and functional food development of quinoa (Chenopodium quinoa Willd.). Compre Rev Food Sci Food Safety 2015;;14(4):431-445.&#xD;
&#xD;
18. Brownawell AM, Caers W, Gibson GR, Kendal CW, Lewis KD, Ringel Y, et al. Prebiotics and the health benefits of fibre: current regulatory status, future research, and goals. J Nutr 2012;142(5):962-974. &#xD;
&#xD;
19. Alghamdi ES. Protective effect of quinoa (Chenopodium quinoa willd) seeds against hypercholesterolemia in male rats. Pharmacophore 2018;9(6):11-21. &#xD;
&#xD;
20. Pasko P, Zagrodzki P, Barton H, Ch?opicka J, Gorinstein S. Effect of quinoa seeds (Chenopodium quinoa) in the diet on some biochemical parameters and essential elements in blood of high fructose-fed rats. Plant Foods Human Nutr 2010;1;65(4);333-338. &#xD;
&#xD;
21. Valencia-Chamorro SA. Quinoa. In: Caballero B.: Encyclopaedia of Food Sci. and Nutr 2003;4895-4902. &#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Antibacterial Activity of Fused Zinc Oxide Nanoparticles with Bacteriocin Sub Class II B [Lactacin F] Against Shigella Species &#x2013; A Synergistic Study&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>54</FirstPage><LastPage>57</LastPage><AuthorList><Author>S. Kaviya Sri</Author><AuthorLanguage>English</AuthorLanguage><Author> Malini Evangeline Rose</Author><AuthorLanguage>English</AuthorLanguage><Author> Monica</Author><AuthorLanguage>English</AuthorLanguage><Author> Kamala</Author><AuthorLanguage>English</AuthorLanguage><Author> Muthumariyammal</Author><AuthorLanguage>English</AuthorLanguage><Author> Shelina Namperipakkam</Author><AuthorLanguage>English</AuthorLanguage><Author> B. Manipriya</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Antibacterial effect of zinc oxide nanoparticles (ZnO-NPs) has remarked a huge interest overall especially by the usage of nanotechnology to synthesis particles in the nanometer size. ROS has been a central point for a few systems including cell wall destruction because of ZnO confined communication, improved film porousness, the disguise of NPs because of loss of proton intention power and take-up of poisonous broke up zinc particles. Objective: The antibacterial impact of zinc oxide (ZnO) nanoparticle and bacteriocin on Shigella species. Methods: Preliminary tests have been done for the identification of Lactobacillus acidophilus strains producing bacteriocin. Chloroform&#x2013;Methanol (2:1 v/v) was used for crude Bacteriocin extraction. However produced precipitate at Solvent-Aqueous interphase was collected aseptically, the solvent was evaporated and the precipitate was kept in a buffer which was used for the antimicrobial study. Sep-pack C18 cartridge and reverse-phase High-Performance Liquid Chromatography on a Nucleosil column were used for purification of lactation F. In this study Agar well diffusion and Broth dilution techniques were used to obtain antimicrobial activity of Lactation F. Synergistic antibacterial activity was done with 1: 1 combination of lactation f and ZnO nanoparticle against. Results: Lactacin F was purified and the antimicrobial testing was done with and without zinc oxide nanoparticle, which shows that Lactation F with zinc oxide nanoparticle had expanded zone of restraint to Shigella species when contrasted with Lactacin F alone. Conclusion: Invitro antibacterial activity of the synergistic compound was more effective than the crude extract of bacteriocin against Shigella species.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Bacteriocin, Lactacin F, Shigella species, Synergy, Zinc oxide</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Bacteriocins have been grouped into three classes based on the different criteria such as producer organisms, molecular sizes, physical properties, chemical structures and mode of actions. In this present study, we isolated subclass II [b] bacteriocins.1,2 This subclass includes heterodimeric bacteriocins which consist of two peptides. Members of this subclass of the bacteriocins meet three criteria: (i) full antimicrobial activity needs both peptides and the individual peptides show little or no activity, (ii) one immunity protein is sufficient to get immunity, and (iii) the genetic organization of the bacteriocin system includes two sequential bacteriocin structural genes encoding the individual peptides and a single immunity gene. Lactococcin G is the first discovered bacteriocin of this group and its antimicrobial activity depends on both &#x3B1;- and &#x3B2;-peptides.3 Plantaricin and lactacin F are also other important representative examples for two-peptide bacteriocins. Their mechanism of action involves the dissipation of membrane potential and a decrease in the intracellular Adenosine Tri Phosphate concentration. Although the presence of both peptides is required to obtain full antimicrobial activity, the individual peptides can act as residual antimicrobials with a modest effect in some cases. &#xD;
&#xD;
Having a satisfactory measure of Zn in the body is essential for the protein and DNA combination, ideal working of insusceptible reaction like immune response and metalloenzyme work. Antibacterial effect of zinc oxide nanoparticles (ZnO-NPs) has gotten the huge interest of nanotechnology to integrate particles in the nanometer locale. Specific underline was given to bactericidal and bacteriostatic systems with centre around the age of receptive oxygen species (ROS) including hydrogen peroxide (H2O2), OH-(hydroxyl extremists), and O2-2 (peroxide).4 ROS has been a main consideration for a few components including cell divider harm because of ZnO restricted connection, improved film penetrability, the disguise of NPs because of loss of proton intention power and take-up of poisonous disintegrated zinc particles. These have prompted mitochondria shortcoming, intracellular outpouring, and delivery in the quality articulation of oxidative pressure which caused possible cell development restraint and cell death.5&#xD;
&#xD;
Thus, in synergy, zinc oxide nanoparticles and lactacin D were used against Shigella species in this study.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
This is the Cross-sectional study done for a period of one year from June 2018- May 2019 at Saveetha Medical College and Hospital, Thandalam.&#xD;
&#xD;
Isolation and Identification of different probiotics strains6&#xD;
&#xD;
Two grams of curd sample was transferred in a flask containing MRS Broth as enrichment media and added distilled water to 100 ml and incubated in 37&#xB0;C.&#xA0; After 24 h, 100 &#x3BC;l of enriched samples were spread on MRS agar. Then, they have anaerobically incubated in [Candle jar] incubator at 37 degree Celsius which is the optimum temperature for lactobacillus species for 24 hours. After the period of incubation 8, isolated colonies were grown. In that, 1 colony shows 100% resemblance with lactobacillus acidophilus. For long term storage Figure 1 shows cultural characteristics of Lactobacillus species. Figure 2 shows Gram staining under the compound microscope with a magnification 100x. Preliminary identification tests like catalase, oxidase, indole and motility were performed. Through antagonist activity of Lactobacillus acidophilus against common pathogens, bacteriocin producers were selected and used for further studies.7 Chloroform &#x2013; Methanol (2:1 v/v) was used for crude Bacteriocin extraction&#xD;
&#xD;
Purification of crude bacteriocin by HPLC method7&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Figure 3 shows the Ammonium sulfate precipitation method. Bacteriocin cleansing Method of Precipitation with Ammonium sulfate, Sep-pack C18 cartridge and converse stage HPLC on a C18 Nucleosil section. A 24-h-old culture (200 ml) of L. acidophilus ST31 was centrifuged for 15 min at 20,000 x g, 4&#xBA;C. The dynamic supernatant was treated for 10 min at 80&#xBA;C to forestall bacteriocin proteolysis. Ammonium sulfate (Kimax) was delicately added to the cell supernatant (kept up at 4&#xBA;C) to acquire 60% immersion (1, 6), and blended for 4h. After centrifugation (1h at 20,000 x g, 4&#xBA;C), the pellet was resuspended in 25 mM ammonium acetic acid derivation (pH 6.5) and stacked on a Sep-Pack C18 cartridge (Waters Millipore, MA, USA). The cartridge was washed with 20% I-propanol in 25 mM ammonium acetic acid derivation (pH 6.5) and the bacteriocin was eluted with 40% I-propanol in 25 mM ammonium acetic acid derivation (pH 6.5). &#xD;
&#xD;
In the wake of drying under diminished tension (Speed-Vac; Savant, France), the divisions were halfway disintegrated in 0.1% trifluoroacetic corrosive (TFA) and tried for antimicrobial action. This dynamic portion was additionally cleaned by invert stage HPLC on a C18 Nucleosil segment (250 x 4.6 mm). Elution was performed by applying a straight slope from 0.1% TFA (dissolvable A) to 90% acetonitrile in 0.1% TFA (dissolvable B) in 65 min. Polypeptides, recognized by A220, were gathered physically. After drying under diminished tension and resuspension in 1 ml of de-ionized water, the watery polypeptide arrangements were put away at - 20&#xBA;C.&#xD;
&#xD;
Isolation and Identification of Shigella species&#xD;
&#xD;
The in-house strain of Shigella dysenteriae and Shigella flexneri were used for antimicrobial testing of Lactacin F with zinc oxide. To check the synergistic activity of Zinc oxide nanoparticles with lactacin F agar cup diffusion method was adapted. 8&#xD;
&#xD;
Agar cup Diffusion Method&#xD;
&#xD;
Lactacin F and Zinc oxide nanoparticles of 20- 25nm size were added in 1:1 proportion of microgram per millilitre and tested against lawn culture of Shigella species by making wells in the medium. 9&#xD;
&#xD;
RESULTS AND DISCUSSION&#xD;
&#xD;
In this study out of 25 isolates of Lactobacillus species, 18 were Lactobacillus acidophilus. All these strains had antagonistic activity against Escherichia coli ATCC 25922. American Type Culture Collection 10mL of Bacteriocin were extracted and purified from these isolates. Lactacin F was purified and the antimicrobial testing was done with and without zinc oxide nanoparticle, which shows that Lactacin F with zinc oxide nanoparticle had increased (&gt;20mm) zone of inhibition to Shigella species when compared to Lactacin F alone and the positive control with Gentamicin Disc.10 Figure 5 shows the agar cup diffusion testing of the synergy compounds.&#xD;
&#xD;
Different approaches can be employed which includes herbal-based, 11 in silico based,12 nanomaterial-based,13 and combination therapy.14 These approaches are tried recently against A. baumannii also and some of them shown promising results. ZnO NPs have also shown antimicrobial activity on skin-specific bacteria15 like Streptococcus mutans, Streptococcus pyogenes. This study showed effective antibacterial efficacy of zinc oxide even in presence of Lactacin F against Shigella species.&#xD;
&#xD;
The activity of lactocidin against&#xA0;Salmonella enteritidis, Escherichia coli, Pseudomonas aeruginosa, and&#xA0;Staphylococcus aureus&#xA0;led to speculate that&#xA0;L. acidophilus&#xA0;producer strains were essential in controlling undesirable flora in the intestinal tract. However, antibacterial activity at pH 7.0 was lost with further purification as described by Vincent in his study.15 Reports also says that Bacteriocin produced by L. acidophilus has a broad-spectrum antagonistic property.16&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Thus, along with probiotics, nanoparticles can be incorporated and it can play a key role in easy absorption and highly efficient elimination of pathogens in the intestine. Instead of antibiotics, Lactacin F combined with zinc oxide nanoparticles can be effective against enteric pathogens. In future, it helps to reduce the intake of antibiotics and creating community-acquired drug resistance in microbes. This combination may even help in the skin and a soft tissue infection which needs future research work.&#xD;
&#xD;
Authors acknowledgement: This research was supported/partially supported by Saveetha medical college and hospital. We are thankful to our colleagues who provided expertise that greatly assisted the research.&#xD;
&#xD;
FUNDING: No funding sources&#xD;
&#xD;
CONFLICT OF INTEREST: None declared&#xD;
&#xD;
ETHICAL APPROVAL: The study was approved by the Institutional Ethics Committee, No. SU216/2018 &#xD;
&#xD;
AUTHORS CONTRIBUTION:&#xD;
&#xD;
Kavyasree and Malini Evangeline rose made substantial contributions to conception, acquisition&#xA0; of&#xA0; data,&#xA0; took&#xA0; part&#xA0; in&#xA0; drafting&#xA0; the&#xA0; article&#xA0; or&#xA0; revising&#xA0; it&#xA0; critically&#xA0; for&#xA0; important&#xA0; intellectual&#xA0; content, Monica, Nithya, Shelina namperipakkam and Muthumariyammal made HPLC analysis [Graphical data] and final&#xA0; approval&#xA0; of&#xA0; the&#xA0; version&#xA0; to&#xA0; be&#xA0;&#xA0; published and agreed to be accountable&#xA0; for all aspects of the work.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3438</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3438</Fulltext></URLs><References>&#xD;
	&#xD;
	Field D, Begley M, O&amp;#39;Connor PM, Daly KM, Hugenholtz F, Cotter PD, et al. Bioengineered nisin A derivatives with enhanced activity against both Gram-positive and Gram-negative pathogens.&#xA0;PLoS One&#xA0;2012;7(2):468-484.&#xD;
	&#xD;
	&#xD;
	Wirawan RE, Klesse NA, Jack RW, Tagg JR.&#xA0;Molecular and genetic characterization of a novel nisin variant produced by&#xA0;Streptococcus uberis.&#xA0;Appl Environ Microbiol 2006;72(5):1148&#x2013;1156. &#xD;
	&#xD;
	&#xD;
	Oppegard C,&#xA0;Rogne P,&#xA0;Emanuelsen L,&#xA0;Kristiansen PE,&#xA0;Fiml G,&#xA0;Nissen-Meyer J. The two-peptide class II bacteriocins: structure, production, and mode of action. J Mol Microbiol Biotechnol 2007;13(4):210-219.&#xD;
	&#xD;
	&#xD;
	Umamageswari, B. Manipriya, M. Kalyani. Evaluation of Antibacterial activity of Zinc oxide Nanoparticles against Biofilm Producing Methicillin-Resistant Staphylococcus aureus (MRSA). Res J Pharm Tech 2018;11(5):1884-1888.&#xD;
	&#xD;
	&#xD;
	Sirelkhatim A, Mahmud S, Seeni A. Review on Zinc Oxide Nanoparticles: Antibacterial Activity and Toxicity Mechanism. Nano-Micro Letters 2015; 7(3):219&#x2013;242.&#xD;
	&#xD;
	&#xD;
	Saavedra L, Taranto MP, Sesma F, de Valdez GF. Homemade traditional cheeses for the isolation of probiotic&#xA0;Enterococcus faecium&#xA0;strains.&#xA0;Int J Food Microbiol 2003;88:241&#x2013;245&#xD;
	&#xD;
	&#xD;
	Burianek LL. Yousef AE. Solvent extraction of bacteriocin from liquid cultures. Lett Appl Microbiol 2000;31:193-197.&#xD;
	&#xD;
	&#xD;
	Alabi OS, Sanusi EA. Efficacy of three disinfectant formulations against multidrug-resistant nosocomial agents. Afri J Clin Expe Microbiol 2012; 13(3):178-182.&#xD;
	&#xD;
	&#xD;
	Tiwari V, Tiwari M, Biswas D. Rationale and design of an inhibitor of RecA protein as an inhibitor of Acinetobacter baumannii. J Antibiot 2018;71:522&#x2013;534.&#xD;
	&#xD;
	&#xD;
	Bhuvaneshwari G, Shameem banuAS and Kalyani M. Nonfermentative gram-negative bacilli: Phenotypic identification and a correlation between biofilm formation and antibiotic susceptibility testing. Int J Res Pharma Sci 2018; 9(4):1229-1234.&#xD;
	&#xD;
	&#xD;
	Roy R, Tiwari M, Donelli G, Tiwari V. Strategies for combating bacterial biofilms: a focus on anti-biofilm agents and their mechanisms of action. Virulence 2018;9(2):522&#x2013;554. &#xD;
	&#xD;
	&#xD;
	Verma P, Tiwari M, Tiwari V. In-silico high throughput virtual screening and molecular dynamics simulation study to identify inhibitor for AdeABC efflux pump of Acinetobacter baumannii. J Biomol Struct Dyn 2018;36:1182&#x2013;1194. &#xD;
	&#xD;
	&#xD;
	Wan G, Ruan L, Yin Y, Yang T, Ge M, Cheng X. Effects of silver nanoparticles in combination with antibiotics on the resistant bacteria Acinetobacter baumannii. Int J Nanomed 2016;11:3789&#x2013;3800. &#xD;
	&#xD;
	&#xD;
	Jain J, Arora S, Rajwade JM, Omray P, Khandelwal S, Paknikar KM. Silver nanoparticles in therapeutics: development of an antimicrobial gel formulation for topical use. Mol Pharm 2009;6:1388&#x2013;1401.&#xD;
	&#xD;
	&#xD;
	Vincent JG, Veomett RC, Riley RF. Antibacterial activity associated with&#xA0;Lactobacillus acidophilus.&#xA0;J Bacteriol&#xA0;1959;78:477&#x2013;484.&#xD;
	&#xD;
&#xD;
&#xD;
Klaenhammer TR. Bacteriocins of lactic acid bacteria.&#xA0;Biochimie 1998;70:337&#x2013;349.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Qualitative and Quantitative Evaluation of Trace Elements in Amaranthaceae Family Medicinal Plant Using ICP-MS&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>58</FirstPage><LastPage>63</LastPage><AuthorList><Author>Malla Balakrishna</Author><AuthorLanguage>English</AuthorLanguage><Author> Pondala Seetharm</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Traditional medicine is an inseparable part of Indian culture. India has had a rich ethnobotanical heritage. Though much work has been performed to isolate organic compound, a little attention has been given to its inorganic elements. Some inorganic elements play an important role in various physiological processes involved in human health. Elements in excess or deficiency cause several diseases. Objective: To investigate the profile of certain trace elements in C. prostrate. The qualitative and quantitative analysis of trace elements in this plant reveals its herbal properties. Methods: Plant samples were roots, leaves and seeds collected from Srikakulam, Andhra Pradesh and taken for the analysis with the ratio of 1:1:1. IPC-MS has been used to evaluate the composition of liquid and allow high-sensitivity investigation of several metal elements which can be found as the trace. Results: This investigation of plant extracts has been done by using ICP-MS as it is powerful, accurate, fast and sensitive analytical technique. The study gives the presence of various concentrations of important trace elements which are having an essential role in the metabolism of the human body. The analysis results twenty trace elements including Li, Be, Al, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Ga, As, Se, Rb, Sr, Ag, Cs, Ba and Tl. Conclusion: The present investigation deals with trace elements concerning C. prostrate medicinal plant reveals that the elements have significant roles in fighting human ailments and diseases.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Inductively coupled plasma mass spectrometry (ICP-MS), Trace elements, Medicinal plants, C. prostrate, Essential metal ions</Keywords><Fulltext>Introduction&#xD;
&#xD;
Nature has provided us with herbals and medicines under different climatic conditions; Medicinal plants and herbals commonly used for human therapy Medicinal plants play a crucial role in traditional medicine and are widely consumed as home remedies.&#xA0; As per the WHO study, most of the world population relies on traditional medicine for their primary home treatment. Pain and inflammation are the two important factors on which present researchers concentrating more. The new drugs to be prepared with fewer effects to avoid side effects caused by non-steroidal anti-inflammatory drugs (NSAIDs) and opioids.1 The main focus of research on medicinal plants is due to their abundance and ease of access. &#xD;
&#xD;
C. prostrata is straggling to the more or less erect annual herb of up to 1 m long and is widely distributed in tropical Africa, Asia, Australia and tropical America. The young foliage is often coloured red with burred and adhesive fruits. The plant is a weed of cultivated land, waste places as well as forest margins. In Ivory Coast, the sap is applied to sores and chancres and used as ear drops for otitis and headache while leafy twigs, inflorescences and seeds pulped into a paste with or without clay are used on sores, burns and fractures. In Nigeria and Cameroon, it is used in the treatment of articular rheumatism and dysentery while in Gabon, it is used in treating eye troubles, wounds and urethral discharges.2 In Traditional therapy, plant extracts are commonly used to control disorders. Due to its non-toxic nature and fewer side effects and high availability, people are using herbal medicine.&#xA0; Medicinal plants have a high potential of the healing capacity of diseases due to the presence of trace elements which are having a significant role in curing diseases.3 However, it is also known that higher concentration of trace elements in medicinal plants are responsible for their toxicity. &#xD;
&#xD;
The essential and trace elements were available in medicinal plants absorbed into the human body by the consumption of herbal medicine. Due to the slight range between deficiency and toxicity of different elements for the human body, it is difficulty to the adequate dosage and health guidelines for usage of herbal medicine. Geochemical features of the soil govern the accumulation of macro and trace elements in the medicinal plants. Furthermore, Elements accumulated into plants from their aquatic and aerial environment and allow some plants used as bio monitors.4-8 In the present study, elemental analysis of, C. prostrate medicinal plants was carried out using&#xA0;inductively&#xA0;coupled plasma mass spectrometry&#xA0;(ICP-MS) technique.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
Experimental Details&#xD;
&#xD;
Sampling&#xD;
&#xD;
C. Prostrate was collected from premises of Srikakulam, Andhra Pradesh. The roots, leaves and stem parts collected from the plant, rinsed well with water to remove foreign materials deposited on them, then they are treated with ethanol for removal of surface contamination and finally washed with deionized water several times. All the parts allowed to dry under shade in the lab for one day and dried using the oven at 40 oC to make them crispy and finally pulverized separately using a blender. The powdered parts of plant materials allowed to room temperature for drying purpose and kept away from direct sunlight in closed plastic containers for further analysis. All the chemicals and solvents used in the present investigation were analytical grade. The sample containing roots, leaves and seeds were taken for the analysis with the ratio of 1:1:1. The details of the plant parts are shown in Table 1.&#xD;
&#xD;
ICP-MS &#xD;
&#xD;
ICP-MS is a rapid, powerful, accurate and sensitive technique used for trace elemental analysis of liquid samples and it can analyse more than 100 samples daily. It has been used to evaluate the composition of liquid and allow high-sensitivity investigation of several metal elements which can be found as the trace. The number of various elements present in the samples determined using a 7700 series ICP-MS (Agilent Technologies, USA). The ICP-MS was calibrated using MERCK XVII multi-element ICP-MS calibration standards (Merck KGaA, Germany), which was diluted with 3% nitric acid (HNO3). The setup of the ICP-MS is summarized in Table 2.&#xD;
&#xD;
Digestion Procedure of Samples&#xD;
&#xD;
1 gm of each sample (1:1:1 weight ratio of various parts of the plant) was digested in a nitric acid/Perchloric acid (6:1) using wet digestion method by heating slowly on a hot plate until white residue was obtained. The residue dissolved in 0.1 N Nitric acid and volume was made upto10 ml. The digested sample was analyzed ICP-MS Instrument.&#xD;
&#xD;
RESULTS AND DISCUSSION&#xD;
&#xD;
Twenty-elements (Li, Be, Al, V, Cr, Mn, Fe, Co, Ni, Cu, Zn, Ga, As, Se, Rb, Sr, Ag, Cs, Ba and Tl) were identified in these medicinal plants. The concentration of each element in ppm was presented in Table 3. The concentration of Iron (Fe) reported higher followed by Aluminium (Al). The anti-inflammatory characteristic of this plant may be due to the presence of Zn with noticeable concentration. The list of macro and microelements determined by using ICP-MS technique and their concentration were given in Table 3. &#xD;
&#xD;
The metal concentrations (ppm) in the C. prostrate are given in Table 3. The concentration of trace elements ranging from 0.0458 ppm of Beryllium (Be) to 1925.6873 ppm of iron (Fe). In the present study Iron (Fe) has reported the highest concentration in the medicinal plant followed by Aluminium (Al), Manganese (Al), Strontium (Sr), and Barium (Ba). The trace elements with less concentration in the medicinal plant are Beryllium (Be), Caesium (Cs), Thallium (Tl), Arsenic (As).&#xA0; Many therapeutic activities of this plant may be attributed and correlated to the presence of these potential trace elements. Deficiencies of these elements may cause different diseases. Zn has been reported to have beneficial effects on atherosclerotic patients as compared to normal (controls). The presence of Zinc (Zn) in the plant shows anti-inflammatory characteristic and may be correlated with its anticancer property. Copper (Cu) and Zinc (Zn) both elements are required in the growth and proliferation of normal cells. Zn concentration decreases in cancer patients whereas Cu concentration increases.9&#xD;
&#xD;
Some are the heavy metals which cause serious health disorders when consumed by animals. According to the World Health Organization, skin cancer is induced because of long-term exposure to Arsenic. Beryllium causes pneumonia, lung disorders, cardiovascular damage and allergy. Lithium is a trace mineral most effective in mental health due to its neuroprotective potential, its deficiency influences common mental illness and social ills.&#xD;
&#xD;
Cobalt (Co)&#xD;
&#xD;
Cobalt is the main part of vitamin B-12 and helps to make DNA and blood cells. This is an essential element and occurs in inorganic and organic forms. The inorganic form of Cobalt is highly essential for the human body. Its excess or deficiency causes unfavourable conditions. The organic form of cobalt is present in green parts of plants, fish, cereals, and water.10, 11 In the present study, the sample contains 2.0365 ppm of Cobalt (Table 3 and Figure 1).&#xD;
&#xD;
Arsenic (As)&#xD;
&#xD;
Arsenic is highly toxic in its inorganic form, long term exposure to inorganic Arsenic through food can lead to poisoning. In the present study, the sample contains 0.8639 ppm of Arsenic (Table 3 and Figure 1).&#xD;
&#xD;
Selenium (Se)&#xD;
&#xD;
Selenium is an essential micronutrient for humans and animals when it takes in excessive leads to toxicity. Se is mainly available in plants as a source of dietary Se, but essentiality of Se for plants is still controversial. However, see at low doses protect the plants from a variety of abiotic stresses such as cold, drought, desiccation, and mental stress. In the present study, the sample contains 0.1854 ppm of Selenium (Table 3 and Figure 1).&#xD;
&#xD;
Rubidium (Rb)&#xD;
&#xD;
The typical daily dietary intake of Rb is expected to be 1&#x2013;5 mg. Rb is highly present in fruits and vegetables. Rb is a relatively nontoxic element and has not shown toxicological concern from the nutritional point of view.12 In the present study, the sample contains 14.7367 ppm of Rubidium (Table 3 and Figure 1).&#xD;
&#xD;
Strontium (Sr)&#xD;
&#xD;
Since Sr is chemically similar to calcium it is taken up from the soil by fruits and vegetables. Assuming a reference body weight of 70 kg, the typical daily Sr exposure is 0.046 mg/kg of body weight. Extremely high Sr uptake can disrupt bone development and cause lung cancer. But this effect can only occur when Sr uptake is in the thousands of mg/kg range.13 Sr levels in our samples were not high enough to be able to cause these effects. In the present study, the sample contains 79.3409 ppm of Strontium (Table 3 and Figure 1).&#xD;
&#xD;
Aluminium (Al)&#xD;
&#xD;
The intake of Aluminium into the human body through various systems like lungs and skin, the accumulation of aluminium in the body causes situations such as neurological disorders, hyper alumina, dialysis encephalopathy and anaemia.14 It is suggested that the intake of Al is 140 mg/day, which has less threat.15 As per EFSA 10 mg of Al per day is possible accumulation.16 In the present study, the sample contains 1800.298 ppm of Aluminium (Table 3 and Figure 1).&#xD;
&#xD;
Iron (Fe)&#xD;
&#xD;
Iron is one of the most important minor elements which plays a crucial role in metabolism and central nervous system, the excess intake of Iron leads to tissue damage.17,18 In the present study, the sample contains 1925.6873 ppm of Iron (Table 3 and Figure 1).&#xD;
&#xD;
Manganese (Mn)&#xD;
&#xD;
Manganese is the second most important minor element present in plant and animal body which required in various biochemical reactions. In the animal, body Manganese is stored in kidney and liver and it is essential for normal functioning of reproductive and central nervous system.19 Manganese deficiency causes the reproduction failure in male and female. Mn plays a key role in biochemical disorders.20 Some investigations regarding the toxicity of manganese and its translocation from soil to plants confirmed that their importance under low pH and redox potential conditions in the soil. Aluminium hydroxide is used in the treatment of ulcers and kidney. Salts of aluminium used in the synthesis of cosmetics, medicine and control the sweat on the skin. It is one of the trace metals shows less toxicity when takes orally.21 In the present study, the sample contains 98.4683 ppm of Manganese (Table 3 and Figure 1).&#xD;
&#xD;
Zinc (Zn)&#xD;
&#xD;
It has an essential role in the processes of genetic expression. It is a vital element having a prominent role in metabolism.22 Zinc is essential for normal development and function of cell mediating innate immunity, neutrophils, and natural killer cells. The concentration of Zinc plays important role in Phagocytises, cytokines production, growth and function of T and B cells, DNA synthesis, RNA transcription and cell activation.23 Zinc is an essential element as it has a relation with the most number of enzymes and participates in enzymatic reactions.24 Zinc is a cofactor in more than 100 enzymatic reactions, an essential component of nuclear DNA binding proteins and serves in genes&#x2019; codes for metallothioneins.25 In the present study, the sample contains 10.3987 ppm of Zinc (Table 3 and Figure 1).&#xD;
&#xD;
Copper (Cu) &#xD;
&#xD;
The high concentration of copper in the foetal liver is remarkable. Not only is there a massive build-up of liver copper in the normal child during the last three months of pregnancy, but the effect lasts about 4 years, by which time liver copper will have normally reverted to adult levels. This build-up of liver copper ensures adequate supplies for the infant in the first few months. Copper is essential for the growth as well as the health of the animals and plants. Copper deficiency may cause anaemia, bone changes and neutropenia in animals.26 It is an essential element for human. The high liver copper may simply be a reflection of the high demand of the foetus for copper. It must be said, however, that growth rates in the newborn appear to be more closely related to zinc than to copper. The excess intake of copper causes adverse effects such as hypertension, sporadic fever, uraemia&#x2019;s, coma etc.27 Copper is an essential trace element which participates in many enzymatic reactions. Its most important role has in the redox process. Reactive copper can participate in liver damage directly or indirectly through kupffer cells stimulation.28 In the present study, the sample contains 3.9858 ppm of Copper (Table 3 and Figure 1).&#xD;
&#xD;
Nickel (Ni)&#xD;
&#xD;
Nickel may act as a nucleic acid stabilizer as it is present in DNA and RNA. The high concentration of copper in the foetal liver is remarkable. Nickel will enter into the human body mainly through water and food, also living organisms wills mostly exposed to nickel by air. In the present study, the sample contains 4.7803 ppm of Nickel (Table 3 and Fig. 1).&#xD;
&#xD;
Chromium (Cr)&#xD;
&#xD;
Chromium is one of the most important trace element required to humans, it plays a vital role in glucose tolerance.29, 30 It is an enzyme activator actively participates in metabolism. If chromium takes in high levels, it causes failure of kidney, liver and lungs, whereas low quantity intake of this may lower the insulin activity. In the present study, the sample contains 10.8653 ppm of Chromium (Table 3 and Fig. 1).&#xD;
&#xD;
Vanadium (V)&#xD;
&#xD;
Vanadium is one of the most powerful elements having an important role in metabolism, it lowers plasma cholesterol. The high quantity intake of vanadium leads to severe diseases like gastrointestinal disturbances. It is one of the most important trace elements found in anti-cancer medicinal plants. In the present study, the sample contains 3.7569 ppm of Vanadium (Table 3 and Figure 1).&#xD;
&#xD;
Conclusions&#xD;
&#xD;
The present study concludes that the investigation of metals in C. prostrate, the results of this study will be helpful pharmacologist and others to identify the plants and their products useful for research and health. The present investigation deals with trace elements concerning C. prostrate medicinal plant reveals that the elements have significant roles in fighting human ailments and diseases. The study reveals that the presence of various vital trace elements in the medicinal plant is useful for human and animals. Important elements like aluminium, iron, chromium and zinc are present with good values. The toxic metals reported in the present analysis are less and as per the World Health Organization.&#xD;
&#xD;
Conflict of Interest&#xD;
&#xD;
Authors declare no conflict of interest.&#xD;
&#xD;
Funding information&#xD;
&#xD;
&#xA0;No financial support has been received.&#xD;
&#xD;
Author&#x2019;s contribution&#xD;
&#xD;
Dr. M. Balakrishna: Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper. &#xD;
&#xD;
Dr. P. Seetha Ram: Conceived and designed the experiments; performed the experiments. &#xD;
&#xD;
Acknowledgements&#xD;
&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references to this manuscript.&#xA0;The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3439</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3439</Fulltext></URLs><References>&#xD;
	&#xD;
	Dharmasiri MG, Jayakody JRAC, Galhena G, Liyanage SSP, Ratnasooriya WD. Anti-inflammatory and analgesic activities of mature fresh leaves of Vitex negundo. J Ethno Pharmac 2003;87:199-206.&#xD;
	&#xD;
	&#xD;
	Burkill HM. The Useful Plants of West Tropical Africa. Roy Bot Gard Kew 1995;1:58-59.&#xD;
	&#xD;
	&#xD;
	Shirin K, Imad S, Shafiq S, Fatima K. Determination of major and trace elements in the indigenous medicinal plant Withania somnifera and their possible correlation with therapeutic activity. J Saudi Chem Soc 2010;14:97-100.&#xD;
	&#xD;
	&#xD;
	Suresh PP, Ramanaiah M, Ramaraju B. Quantitative determination of essential and trace element content of some medicinal plants by ICP-MS technique. Res J Pharm Tech 2019; 12(4):1595-1600.&#xD;
	&#xD;
	&#xD;
	Raez L, Bumbalova A, Harangozo M, Tolgessy J, Tomecek O. Determination of caesium and selenium in cultivated mushrooms using radionuclide x-ray fluorescence technique. J Radio Anal Nucl Chem 2000;245(3):611-614.&#xD;
	&#xD;
	&#xD;
	Richardson DHS, Shore M, Hartree R, Richardson RM. The use of X-ray fluorescence spectrometry for the analysis of plants, especially lichens employed in biological monolith. Sci Tot Env 1995;176:97-105.&#xD;
	&#xD;
	&#xD;
	Viksna A, Lindgren ES, Standzenieks P. Analysis of pine needles by XRF scanning techniques. X-Ray Spect 2001;30:260-266.&#xD;
	&#xD;
	&#xD;
	World Health Organization. Quality Control Methods for Medicinal Plant Materials, WHO Offset Publication. WHO Geneva, 1998.&#xD;
	&#xD;
	&#xD;
	Frans Kok J, Cornelia VM, Hofman A, Gigsbert B,Voet V. Quality Control Methods for analysis. Epiderm 1988;128:352&#x2013;359.&#xD;
	&#xD;
	&#xD;
	Unice KU, Monnot AD, Gaffney SH. Inorganic cobalt supplementation: Prediction of cobalt levels in whole blood and urine using a bio kinetic model.&#xA0;Food Chem Toxic&#xA0;2012; 50:2456&#x2013;2246.&#xA0;&#xD;
	&#xD;
	&#xD;
	Galanis A, Karapetsas A, Sandaltzopoulos R. Metal-induced carcinogenesis, oxidative stress and hypoxia signalling.&#xA0;Mutat Res&#xA0;2009;674:31-35.&#xD;
	&#xD;
	&#xD;
	Anke M, Angelow L. Rubidium in the food chain.&#xA0;Fres J Anal Chem&#xA0;1995;352:236&#x2013;239. &#xD;
	&#xD;
	&#xD;
	Varo P, Saari E, Paaso A, Koivistoinen P. Strontium in Finnish foods.&#xA0;Int J Vitam Nutr Res&#xA0;1982;52:342&#x2013;350.&#xD;
	&#xD;
	&#xD;
	Tayfur M, Unluoglu I, Bener O. Aluminium and health. Food 2002;27(4):306-309.&#xD;
	&#xD;
	&#xD;
	Toxicological profile for aluminium, Agency for Toxic Substances and Disease Registry, Atlanta, USA. 2010.&#xD;
	&#xD;
	&#xD;
	Scientific Opinion on the use of cobalt compounds as additives in animal nutrition. EFSA J 2009;7:1-45.&#xD;
	&#xD;
	&#xD;
	Swanson CA. Iron intake and regulation: implications for iron deficiency and iron overload. Alcohol 2003;30(2):99-102.&#xD;
	&#xD;
	&#xD;
	Abbaspour N, Hurrell R, Kelishadi R. Review on iron and its importance for human health. J Res Med Sci 2014;19(2):164-174.&#xD;
	&#xD;
	&#xD;
	Fu ZH, Xie MY, Zhang ZM, Guo L. Determination of inorganic elements in Plantago by ICP-AES. Spectr Spe Anal 2004;24(6):737-740.&#xD;
	&#xD;
	&#xD;
	Rehnberg GL, Hein JF, Carter SD, Linko RS, Laskey JW. Chronic ingestion of Mn3O4 by rats: tissue accumulation and distribution of manganese in two generations. J Toxic Envt Heal 1982;9(2):175-188&#xD;
	&#xD;
	&#xD;
	WHO. Trace elements in human nutrition and health. World Health Organization, Geneva. 1996; 343. &#xD;
	&#xD;
	&#xD;
	Mocchegiani E, Giacconi R, Malavolta M. Zinc signaling and subcellular distribution: emerging targets in type 2 diabetes. Trends Mol Med 2008;14(10):419-428.&#xD;
	&#xD;
	&#xD;
	Prasad AS. Zinc. An antioxidant and anti-inflammatory agent: Role of zinc in degenerative disorders of ageing. J Trace Elem Med Bio 2014;28(4):364-371.&#xD;
	&#xD;
	&#xD;
	Cempel M, Nikel G. &#xA0;Nickel: A review of its sources and environmental toxicology. Polish J Env Stud 2006;15(3):375-382.&#xD;
	&#xD;
	&#xD;
	Kamal EAA, Eshteag MM. Influence of end-stage renal disease in alteration of some trace elements in Sudanese patients. Int J Curr Res Rev 2016;8(10):16-19.&#xD;
	&#xD;
	&#xD;
	Krupanidhi S, Sreekumar A, Sanjeevi CB. Copper and biological health. Ind J Med Res 2008;128(4):448-461.&#xD;
	&#xD;
	&#xD;
	Anderson RA. Chromium as an essential nutrient for humans. Reg Toxic Pharm 1997;26(1) 35-41.&#xD;
	&#xD;
	&#xD;
	Sunil G, Shravn Kumar M, Jitendra A, Vishnu Dutt B. A study of trace elements (iron, zink, copper, selenium) in liver cirrhosis patients. Int J Curr Res Rev 2012;4(16):69-75.&#xD;
	&#xD;
	&#xD;
	Geyikli ?, Bay?l S. Chromium associates with insulin sensitivity. Gazi Med J 2008;14:59-63.&#xD;
	&#xD;
	&#xD;
	WHO. Vanadium, in Air Quality Guidelines - Second Edition. WHO Regional Office for Europe; Copenhagen, Denmark: 2000.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Chromium (III) Complexes of Metformin, Dapagliflozin, Vildagliptin and Glimepiride Potentiate Antidiabetic Activity in Animal Model&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>64</FirstPage><LastPage>69</LastPage><AuthorList><Author>Fahima Aktar</Author><AuthorLanguage>English</AuthorLanguage><Author> Md. Zakir Sultan</Author><AuthorLanguage>English</AuthorLanguage><Author> Mohammad A. Rashid</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Diabetes is a chronic disease which increases morbidity, mortality along with social and economic costs. Chromium [Cr(III)] is a trace element which plays an important role in glucose and lipid metabolism i.e. in the treatment of diabetes. Objective: To synthesize some new chromium complexes with different classes of oral antidiabetic drugs and studied their antidiabetic potentials in mice. Methods: To increase the therapeutic efficacy of the drugs i.e, Metformin, Dapagliflozin, Vildagliptin and Glimepiride, Cr(III) complexes of these drugs were prepared and characterized by TLC, DSC, TGA and FTIR spectroscopy. The antidiabetic activity of the complexes was also evaluated in mice model. Results: At a dose of 150 mg/kg body weight of Cr(III)-drug complexes, the serum glucose levels reduced by 20.61% for Crmetformin( Cr-Met), 13.07% for Cr-dapagliflozin (Cr-Dapa), 7.61% for Cr-vildagliptin (Cr-Vilda) and 4.07% for Cr-glimepiride (Cr-Glim) than the corresponding parent drugs metformin, dapagliflozin, vildagliptin and glimepiride, respectively after 14 days of treatment. Conclusion: The complexes were found to be effective in lowering the serum glucose level in alloxan-induced diabetic mice.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Metformin, Dapagliflozin, Vildagliptin, Glimepiride, Chromium (III), Antidiabetic</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Diabetes increases morbidity, mortality, social and economic burden. It is reported that diabetes is among the top ten causes of disabilities and about 4-4.6 million people annually die worldwide.1 In 2011, it was estimated that11% of total healthcare spending occurred worldwide for the management of patients with diabetes.1 Nowadays, diabetes is a highly increasing chronic disease all over the world. It is a disease that impairs the body&#x2019;s ability to process blood glucose. Diabetes can lead to the buildup of sugars in the blood which increases the risk of life-threatening adverse complications, including kidney failure, amputations, blindness, stroke and heart failure.2 The diabetic patients often have some other co-existing problems like dyslipidemia, hypertension, insomnia and so on. Now, the total number of diabetic patients in Bangladesh is about 8 million and it causes 6.4 % of total deaths in the country.3 A recent survey in Bangabandhu Sheikh Mujib Medical University (BSMMU) on 2,000 adults in Dhaka slums found 19 % of adults (15.60 % men and 22.5 % women) had diabetes.3 This indicates a rising trend of diabetes in urban areas.&#xA0;Anti-diabetic drugs are used in diabetic patients for lowering the sugar level in blood and several antidiabetic drugs (metformin, vildagliptin, glimepiride and dapagliflozin) are available, and their volition depends on the nature of diabetes, situation and age of the persons and other factors as well. The chemical structures of metformin, dapagliflozin, vildagliptin and glimepiride have been shown in figure 1. Metformin is a drug of biguanide group which increases peripheral glucose utilization and decreases gluconeogenesis, possibly through its action on membrane phospholipids. It also inhibits glucose absorption from the intestinal lumen.4 Vildagliptin is the dipeptidyl peptidase-4 (DPP-4) inhibitors for the treatment of type 2 diabetes mellitus (T2DM). The mechanism of inhibition of DPP-4 inhibitors depends on their ability to increase the level of incretin hormones, glucagons like peptide-1 (GLP-1) and glucose-dependent insulinotropic polypeptide (GIP) in the systemic circulation.5 Dapagliflozin, a glucose-lowering agent used in the treatment of patients with type 2 diabetes. It is known as sodium-glucose co-transporter-2 (SGLT2) inhibitor. By inhibiting the transporter protein SGLT2 in the kidneys, dapagliflozin reduces renal glucose reabsorption, leading to urinary glucose excretion and a reduction in blood glucose levels. &#xA0;Glimepiride is a drug of sulphonylurea group. Sulfonylureas cause hypoglycemia by stimulating insulin release from pancreatic &#x3B2;-cells. It increases insulin release in type 2 DM patients from the pancreas. This group of drugs also may further increase insulin levels by reducing hepatic clearance of the hormone.4,5 Human beings require essential trace elements for displaying a variety of functions, e.g. regulatory, catalytic, immune etc. There are many reports on the metal-antidiabetic drug complexations.6-16&#xD;
&#xD;
Chromium (III) is required at a tiny amount as about 100 &#xB5;g/day and much of the daily intake comes from grains, fruits, vegetables, potatoes, seafood, mushrooms and egg yolk.17 Metformin, dapagliflozin, vildagliptin and glimepiride are common anti-diabetic drugs (Figure 1). Cr (III) is one of the important trace elements that the body can absorb. It is claimed that Cr (III) is the most stable and essential form, and accumulated in liver, spleen, soft tissues and bone. In the body, Cr (III) plays important roles in carbohydrate and lipid metabolism. It may increase the action of insulin by the interaction with the insulin receptor on the cell surface. Chromium also inhibits the liver hydroxymethylglutaryl-CoA reductase (rate-limiting enzyme of cholesterol synthesis). Cr deficiency in serum is reported in patients with glucose intolerance, diabetes mellitus, and hypercholesterolemia and also in aged people.18,19,20&#xD;
&#xD;
But it is somehow difficult to intake the trace amount of Cr (III). There are chances of co-administration of Cr (III) as antidiabetic drug complexes to promote the therapeutic efficacy of antidiabetic drugs. Since it is reported that Cr (III)-metformin complex reduced the glucose level of diabetic rat.21 Therefore, we tried to synthesize some new chromium complexes with different classes of oral antidiabetic drugs and studied their antidiabetic potentials in mice. This paper describes the complex formation of Cr (III) with four popular antidiabetic drugs viz. metformin, dapagliflozin, vildagliptin and glimepiride, and in vivo study of their antidiabetic property in mice model (Figure 1).&#xD;
&#xD;
&#xD;
&#xD;
Figure 1: Structures of metformin (A), vildagliptin (B), glimepiride (C), and dapagliflozin (D).&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
Materials&#xD;
&#xD;
Analytical grade chemicals, solvents and chromium (III) chloride were used for all experimental purposes without further purification. The API of antidiabetic drugs metformin (purity 99%), vildagliptin (purity 99%), glimepiride (purity 99%), and dapagliflozin (purity 99%) were received as gift samples from ACI Pharmaceuticals Ltd., Dhaka, Bangladesh. Alloxan monohydrate (98%) was purchased from Loba Chemie Pvt. Ltd., Mumbai, India. &#xD;
&#xD;
Synthesis of chromium (III) complexes with antidiabetic drugs&#xD;
&#xD;
The Cr(III)-metformin, Cr(III)-glimepiride, Cr(III)-dapagliflozin, Cr(III)-vildagliptin complexes were synthesized by dissolving each drug e. g. metformin hydrochloride (2 mmol, 0.388g,), glimepiride (0.5 mmol, 0.245 g), dapagliflozin (0.5 mmol, 0.2051 g), vildagliptin (0.5 mmol, 0.1517 g) in 25 mL of methanol and then mixed with 25 mL methanol solution of 1 mmol CrCl3,6H2O (0.202g). The mixtures were heated at 70oC in a water bath (J.P.Selecta, Spain) with continuous stirring for 3.30 hours. Then the mixtures were left overnight for precipitation.&#xD;
&#xD;
Characterization of synthesized chromium (III) complexes with antidiabetic drugs&#xD;
&#xD;
Differential scanning calorimetry (DSC)&#xD;
&#xD;
The phase change properties of the Cr(III) complexes were studied by differential scanning calorimetry (DSC) (DSC-60, Shimadzu, Japan). The range of temperature was up to 300oC and temperature rising rate was 10 &#xB0;C/min at a flow rate of 20 mL/min in a nitrogen gas atmosphere. &#xD;
&#xD;
Thermogravimetric analysis (TGA)&#xD;
&#xD;
The thermogravimetric analysis (TGA) of the chromium (III) complexes was carried out by thermogravimetric analyzer (TGA-50, Shimadzu, Japan) at the temperature of up to 600oC. A certain amount of each complex(~3mg) was taken in an aluminium pan and then subjected to heating with a flow rate of 10 oC/min under nitrogen atmosphere where mass, temperature, and time were considered base measurements in the thermogravimetric analysis.&#xD;
&#xD;
Fourier transform infrared spectrophotometry (FTIR)&#xD;
&#xD;
The FTIR analyses of the chromium (III) complexes were carried out at the wavelength ranges of 400 cm-1 to 4000 cm-1.&#xA0; In each sample, about 100 mg of dried, pure KBr was added to 1 mg of dried sample, homogenously mixed with a mortar-pestle and pressed mechanically to make a pellet under the pressure of 8-10 tons. The prepared disc was placed in the path of the IR beam for recording the spectrum. &#xD;
&#xD;
Induction of diabetes in mice&#xD;
&#xD;
Male Albino mice with an average weight of 26 g were purchased from the Department of Pharmacy, Jahangir Nagar University, Savar, Bangladesh and maintained on a normal diet and filtered tap water adlibitum were used in the experiment. The mice were randomly divided into 9 groups (Group-I to Group-IX) (6rats in each group). Group-I was treated as control and allowed to feed normal diet only. Neither alloxan nor drug was introduced to the Group-I. Diabetes was induced in the rest of the eight groups (Group-II to Group-IX) by intraperitoneal administration of alloxan at a dose of 150 mg/kg body weight following overnight fasting. Before induction of diabetes and after three days of alloxan treatment, blood was drawn from the tail of the all groups of fasting mice and serum glucose level was determined immediately by a glucometer (GlucoLeader-yasee, GLM-76, Yasee Co. Ltd., Taiwan). The alloxan-treated rats were considered to be diabetic due to a high serum glucose level (&gt;20mmol/L). Group-II and Group-III weregiven150 mg/kg bw metformin hydrochloride and Cr-metformin complex, respectively in solution form for 14 days. Similarly, Group-IV and Group-V were given 150 mg/kg bw dapagliflozin and Cr-dapagliflozin complex, respectively, Group-VI and Group-VII received 150 mg/kg bw vildagliptin and Cr-vildagliptin complex, respectively, and Group VIII and Group IX were given glimepiride and Cr-glimepiride, respectively orally in solution form for 14 days. After 14 days s of treatment, blood was drawn from the tail of the all groups of fasting mice and serum glucose levels were determined immediately by a glucometer.&#xD;
&#xD;
Statistical analysis&#xD;
&#xD;
The data are expressed as mean &#xB1; SEM. &#xA0;Readings within a group were compared using the one-way ANOVA analysis and readings between groups were compared using the independent sample test. Statistical analysis was performed using Microsoft-Excel 2007.&#xD;
&#xD;
RESULTS AND DISCUSSION&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; After completing the reactions both crystalline and amorphous Cr-drug complexes were obtained. The formation of complexes with drugs was confirmed by TLC, DSC, TGA and FTIR spectroscopy. &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; At first, TLC of the Cr-drug complexes was carried in methanol-dichloromethane in the different ratio for different complexes. Single spot from the complexes which were varied from their precursor drugs was found (Table 1). Each spot indicated the presence of a new complex. &#xD;
&#xD;
&#xD;
&#xD;
The phase changes of the pure anti-diabetic drugs and their Cr-complexes were investigated by DSC. Pure metformin displayed melting endotherm at 231oC and its Cr-complex exhibited at 224 oC (Figure2). Dapagliflozin showed melting endotherm at the point of 77.98 oC and its Cr-complex showed different peaks in the thermogram (Figure 2). Vildagliptin and glimepiride indicated melting points at 152 oC and 213 oC, respectively whereas their Cr-complexes showed different melting endotherms, which revealed the formation of new complexes (Figure2). &#xD;
&#xD;
&#xD;
&#xD;
Figure 2: Overlaid DSC thermograms: metformin and Cr-metformin complex (A), dapagliflozin and Cr-dapagliflozin complex (B), vildagliptin and Cr-vildagliptin complex (C), glimepiride and Cr-glimepiride complex (D)&#xD;
&#xD;
The percentages of weight loss against the increase in temperature for pure antidiabetic drugs and their complexes were investigated by thermogravimetric analysis. For pure metformin, 4.29%was found to be degraded at 205 oC. It also degraded by 88% at 356 oC probably by the removal of methyl groups.22 It was also found to be degraded by 97% at 599 oC due to the loss of amino groups. However, Cr-metformin complex showed completely different degradation pattern (Figure 3). &#xD;
&#xD;
&#xD;
&#xD;
Figure 3: Overlaid TGA thermograms: metformin and Cr-metformin complex (A), dapagliflozin and Cr-dapagliflozin complex (B), vildagliptin and Cr-vildagliptin complex (C), glimepiride and Cr-glimepiride complex (D)&#xD;
&#xD;
In the case of pure dapagliflozin, the degradation pattern showed17% degradation at 189 oC, 86% at 389oC and 94% at 516oC, which are due to release of hydroxyl molecules and methyl groups.23 Similarly, vildagliptin and glimepiride and their Cr-complexes, were showed different degradation pattern from pure drugs. The FTIR spectra were studied to measure the wavelength and intensity of transmission/absorption which have characteristics of specific types of molecular vibration and stretching that help to identify functional groups of new complexes. The FTIR spectra of pure drugs metformin, dapagliflozin, vildagliptin, glimepiride and their Cr-complexes are shown in figure 4. If the pure drugs and complexes displayed same IR spectrum it can be claimed that they are the same compounds. Therefore, any disappearance or shifts of peaks will indicate the presence of new compounds.&#xA0;&#xA0; &#xD;
&#xD;
&#xD;
&#xD;
Figure 4: Overlaid IR spectra of metformin and Cr-metformin complex (A), dapagliflozin and Cr-dapagliflozin complex (B), vildagliptin and Cr-vildagliptin complex (C), glimepiride and Crglimepiride complex (D)&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The characteristic stretching peak of -NH2 of metformin seen at 3742.93 cm-1 was obtained in the downfield at 3706 cm-1for Cr-metformin complexes (Figure 4). Likewise, the characteristic peaks of OH stretching of dapagliflozin, vildagliptin and glimepiride observed at 3352.28 cm-1, 3741 cm-1, 3772 cm-1, respectively shifted in the IR spectra of the respective Cr-drug complexes to 3390 cm-1 for Cr- dapagliflozin and 3402.00 cm-1 for Cr-vildagliptin and 3569.54cm-1 for Cr-glimepiride. These changes in the absorption in the IR spectra indicated the formation of the complex between the drug and chromium.&#xD;
&#xD;
The Cr-drug complexes and standard antidiabetic drugs when administered to alloxan-induced diabetic mice significantly reduced the blood glucose level as compared to alloxan control mice which received distilled water and normal food (Table2). Cr-metformin complex reduced blood glucose level significantly and it was found to be 15.10 mmol/L whereas pure metformin reduced blood glucose level to 19.02 mmol/L after 14 days of treatment. &#xD;
&#xD;
&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Chromium (Cr) (III) reacted with four antidiabetic drugs namely metformin, dapagliflozin, vildagliptin, glimepiride at high temperature and produced complexes which were justified by studying their thermochemical properties e.g. DSC, TGA, TLC and IR spectroscopy. The Cr-drug complexes and standard antidiabetic drugs when administered to alloxan-induced diabetic mice significantly reduced the blood glucose level as compared to alloxan control mice which received distilled water and normal food. It was found that after 14 days of treatment with metformin, dapagliflozin, vildagliptin, glimepiride, the average glucose levels of mice reduced from 31.54 to 19.02, 30.37 to 17.60, 31.50 to 19.70 and 30.24 to 17.20 mmol/L, respectively; whereas chromium complexes of these drugs i.e. Cr-metformin, Cr-dapagliflozin, Cr-vildagliptin and Cr-glimepiride were found to be reduced blood glucose levels in mice from 31.0 to 15.10, 29.40 to 15.30, 31.60 to 18.20&#xA0; and 21.70 to 16.50 mmol/L, respectively. The Cr-complexes were found to be more potent than the corresponding pure drugs viz. Cr-metformin, Cr-dapagliflozin, Cr-vildagliptin and Cr-glimepiride showed 20.61%, 13.07%, 7.61%, 4.07% more effective than metformin, dapagliflozin, vildagliptin, glimepiride drugs, respectively. Among them, Cr-metformin complex reduced blood glucose level significantly and it was found to exhibit 20.61% higher antidiabetic activity than the pure metformin. However, the untoward effects of these complexes could not be established at this moment. Whether the Cr-complexes have long-term health benefits or untoward effects are not yet known, although the mice model experimental data indicated that Cr-complexes can improve glucose metabolism. Therefore, comprehensive studies, including in vivo model will be required to establish other beneficial and/or untoward effects of these Cr-drug complexes. Conducted study reveals that the chromium complexes of traditionally used antidiabetic drugs increase the efficacy of the drugs. The finding opens the possibility to promote the production and utilization of chromium complexes of metformin, dapagliflozin, vildagliptin and glimepiride for treating diabetes mellitus.&#xD;
&#xD;
ACKNOWLEDGEMENT&#xD;
&#xD;
The authors are thankful to Centre for Advanced Research in Sciences (CARS), the University of Dhaka, Bangladesh for providing some laboratory facilities to conduct the research; ACI Pharmaceuticals Ltd., Dhaka, Bangladesh for providing APIs for the research; and Rajia Sultana (Research Fellow, Drug Analysis and Research Laboratory, CARS) for helping us during the research work. &#xD;
&#xD;
Conflict of interest: None &#xD;
&#xD;
Financial support: None&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3440</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3440</Fulltext></URLs><References>&#xD;
	&#xD;
	Plosker GL. Dapagliflozin: A review of its use in type 2 diabetes mellitus. Drugs 2012; 72:2289-2312.&#xD;
	&#xD;
	&#xD;
	Hippisley-Cox J, Coupland C. Diabetes treatments and risk of amputation, blindness, severe kidney failure, hyperglycaemia, and hypoglycaemia: Open cohort study in primary care.&#xA0;Br Med J 2016;352:1450. &#xD;
	&#xD;
	&#xD;
	Porimol&#xA0;P. Worlddiabetes day 2018: A worrying picture of diabetes in Bangladesh. 2018. World Diabetes Day 2018: A worrying picture of diabetes in Bangladesh (thedailystar.net)&#xD;
	&#xD;
	&#xD;
	Laurence LB, John SL, Keith LP. Goodman &amp; Gilman&#x2019;s the pharmacological basis of therapeutics, eleventh edition, The McGraw-Hill Companies, Inc. All rights reserved. Manufactured in the United States of America, 2006;1634-1638.&#xD;
	&#xD;
	&#xD;
	Ahren B, SchweizerA, Dejager S, Villhauer EB, Dunning BE, FoleyJE. Mechanisms of action of the dipeptidyl peptidase-4 inhibitor vildagliptin in humans. &#xA0;Diabetes&#xA0;Obes Metab 2011;13:775-783.&#xD;
	&#xD;
	&#xD;
	?liwi?ska-Hill U, Wiglusz K. The interaction between human serum albumin and antidiabetic agent - exenatide: determination of the mechanism binding and effect on the protein conformation by fluorescence and circular dichroism techniques. Biomol Struct Dyn 2019;22:1-9.&#xD;
	&#xD;
	&#xD;
	Scior T, Guevara-Garcia JA, Do QT, Bernard P, Laufer S.Why antidiabetic vanadium complexes are not in the pipeline of "big pharma" drug research? A critical review. Curr Med Chem 2016;23(25):2874-2891.&#xD;
	&#xD;
	&#xD;
	Zhang Y, Wu M, Dai W, Li Y, Wang X, Tan D, et al. Gold nanoclusters for controlled insulin release and glucose regulation in diabetes. Nanoscale 2019;11:6471-6479. &#xD;
	&#xD;
	&#xD;
	Lockwood TD. Biguanide is a modifiable pharmacophore for recruitment of endogenous Zn2+&#xA0;to inhibit cysteinyl cathepsins: review and implications. Biometerials 2019; 32:575-593.&#xD;
	&#xD;
	&#xD;
	G&#xFC;lfen M, &#xD6;zdemir A, Lin JL, Chen CH. Investigation of manganese(II)-insulin&#xA0;complexes&#xA0;using electrospray ionization mass spectrometry. Int J Biol Macromol 2018;120:557-565.&#xD;
	&#xD;
	&#xD;
	Dong Y, Stewart T, Zhang Y, Shi M, Tan C, et al. Anti-diabetic vanadyl&#xA0;complexes&#xA0;reduced Alzheimer&amp;#39;s disease pathology independent of amyloid plaque deposition. China Life Sci 2019;62:126-139. &#xD;
	&#xD;
	&#xD;
	Chen F, Moat J, McFeely D, Clarkson G, Hands-Portman IJ, Furner-Pardoe JP, et al. Biguanide iridium(iii)&#xA0;complexes&#xA0;with potent antimicrobial activity. J Med Chem 2018; 61:7330-7344. &#xD;
	&#xD;
	&#xD;
	Gondolova G, Taslimi P, Medjidov A, Farzaliyev V, Sujayev A, Huseynova M, et al. Synthesis, crystal structure and biological evaluation of spectroscopic characterization of Ni(II) and Co(II)&#xA0;complexes&#xA0;with N-salicyloil-N&amp;#39;-maleoil-hydrazine as anticholinergic and&#xA0;antidiabetic&#xA0;agents. J Biochem Mol Toxicol 2018; 32:e22197. &#xD;
	&#xD;
	&#xD;
	Kongot M, Dohare N, Singh V, Reddy DS, Singhal NK, Patel R, et al. Novel biocompatible Ni(II)&#xA0;tethered moiety as a glucose uptake agent and a hit against methicillin-resistant Staphylococcus aureus. Eur J Pharm Sci 2018;123:335-349. &#xD;
	&#xD;
	&#xD;
	Vasantha P, Sathish KB, Shekhar B, Anantha Lakshmi PV. Copper-metformin ternary&#xA0;complexes: Thermal, photochemosensitivity and molecular docking studies. Mater Sci Eng C 2018; 90:621-633. &#xD;
	&#xD;
	&#xD;
	Philip JE, Shahid M, Prathapachandra Kurup MR, Velayudhan MP.Metal based biologically active compounds: Design, synthesis, DNA binding and antidiabetic activity of 6-methyl-3-formyl chromone derived hydrazones and their metal (II) complexes. J Photochem Photobiol B 2017;175:178-191.&#xD;
	&#xD;
	&#xD;
	Achmad RT, Budiawan, Auerkari EI.Effects of chromium on the human body. Ann Res Rev Biol 2017;13(2):1-8.&#xD;
	&#xD;
	&#xD;
	ZimaT, MestekO, Tesar V, TesarovaP, NemecekK, Zak A, et al. Chromium levels in patients with internal diseases. Biochem Mol Biol Int 1998;46:365-374.&#xD;
	&#xD;
	&#xD;
	Richard AA. Chromium, glucose intolerance and diabetes. J Am&#xA0;Coll Nutr 1998;17:548-555.&#xD;
	&#xD;
	&#xD;
	Wallach S. In vitro clinical and biochemical aspects of chromium deficiency. J Am Coll Nutr 1985;4:107-120.&#xD;
	&#xD;
	&#xD;
	El-Megharbel SM. Synthesis, characterization and antidiabetic activity of chromium (III) metformin complex. J Microb Bioch Tech 2015;7:2. &#xD;
	&#xD;
	&#xD;
	Agrawal YK, Gogoi PJ, Manna K, Bhatt HG, Jain VK. A supercritical fluid chromatography/tandem mass spectrometry method for the simultaneous quantification of metformin and gliclazide in human plasma. Ind J Pharm Sci 2010;72:50-57.&#xD;
	&#xD;
	&#xD;
	Amit SK, Iain GR, Scott O, Christopher LS, Ernesto C, Kirk RH, et al. A comprehensive listing of bioactivation pathways of organic functional groups. Curr Drug Metab 2005; 6:161-225.&#xD;
	&#xD;
	&#xD;
	Rahman F, Salam MA, Rahman A, Sultan MZ. Studies of interactions of valsartan, glimepiride and ciprofloxacin HCl by DSC and HPLC. Bangl Pharm J 2017;20:195-200.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Study to Evaluate the Adverse Drug Reactions in a Teritary Care Teaching Hospital in Tamilnadu - A Cross-Sectional Study&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>70</FirstPage><LastPage>74</LastPage><AuthorList><Author>Kumari PM</Author><AuthorLanguage>English</AuthorLanguage><Author> Jamuna Rani R</Author><AuthorLanguage>English</AuthorLanguage><Author> Shivani KP</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: The ADR monitoring centre is under the PvPI working for the safety and welfare of patients, in coordinating all the clinical and respective paramedical departments by prompt detection, monitoring and reporting of the ADR and providing proper management. This study aims to evaluate the ADRs from our hospital so that physicians will be cautious while prescribing these drugs with ADRs. Objective: To study the adverse drug reaction in various departments of a tertiary care teaching hospital. Methods: A cross-sectional study conducted on 50 patients of all age groups who developed adverse drug reactions. Causality assessment was done based on Naranjo&#x2019;s probability scale. Modified Hartwig&#x2019;s criteria were used to assess the severity of ADRs into seven levels. Results: A total of 50 ADRs were reported, 44% were males and 56% were females. The female adult population was 42%. The majority of ADRs were due to antimicrobial agents, especially beta-lactam antibiotics (32%) followed by quinolones (10%). A maximum number of patients (74%)were reported with dermatological manifestations. The department of medicine reported the highest number of ADRs (20%). As per Naranjo&#x2019;s scale,56% of reports were assessed as possible. 54% of reports were documented as moderate according to Modified Hartwig&#x2019;s criteria for severity assessment. Conclusion: Hospital admissions due to adverse drug reactions (ADRs) are a major concern in the health care system. Healthcare practitioners need to be more conscious not only of the potential for adverse drug reactions but also of the avoidance (or) minimization of the incidence of ADRs.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Pharmacovigilance, Adverse drug reactions, Tertiary care teaching hospital, Antimicrobial agents</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
One of the main unavoidable risk factors in the use of drug therapy is the adverse reactions to the drugs. &#xA0;It is, therefore, one of the major concerns in medicine. Most of the drugs do not cause adverse drug effect; even those reactions which had occurred might be attributed to their Pharmacogenomics pattern. The World Health Organization has described ADR as a response to a drug that is noxious and unintended and that develops at doses commonly used in individuals for prophylaxis, diagnosis, or management, or alterations in physiological function.1 ADRs are common, at times can be life-threatening and in general leads to increased expenses. &#xD;
&#xD;
This is the reason that the clinicians are requested to be aware of the reactions that can be caused by the drugs before prescribing them. ADRs are common in the hospital setup. They have been classified into two types, one that is the cause of hospitalization and the other which occurs after hospitalization. It is estimated that 5% of the hospitalizations and one in 10-20% of the hospitalized patients are due to drug reactions. &#xA0;In 1994, it was suggested by Lazarou J et al., that 10000 deaths in the USA had occurred due to ADRs, although this was considered to be biased and inflated data.2,3 Consequently, a few studies were conducted wherein the data accumulated was small, and thus the documentation of the ADRs was minimal. The study found that hospital admissions due to ADR accounted for 0.7% of total admissions and ADR deaths reported for 1.8% of total admissions to the Territorial Referral Center in South India.4&#xD;
&#xD;
Pharmacovigilance&#xA0; Programme of&#xA0; India&#xA0; (PvPI)&#xA0; 2014&#xA0; stated that&#xA0; 6.7%&#xA0; of patients had serious adverse events. Similar studies have documented those hospital admissions due to ADR were 3.4%, hospital readmissions 3.7%, and mortality 1.8%. Adverse reactions are recognized as the fourth-leading cause of death in the developed world.5 Currently, 179 teaching hospitals and multi-speciality&#xA0;hospitals approved by the Medical Council of India have been established across the country as ADR Monitoring Centers (AMCs). These centres are covered for administrative and organisational purposes by four zonal offices of the Central Drugs Standard Control Organization&#xA0;(CDSCO).6 These AMCs (reporting through VigiFlow; WHO-Uppsala Monitoring Centre [UMC] software) are associated with international networking. Via VigiFlow, the programme owned by WHO-UMC, (Sweden), these AMCs report ADRs to NCC. The reluctance to report is now evolving as the PvPI has released a detailed plan for a proactive pharmacovigilance framework that will raise understanding of the benefits of ADR reporting. The NCC has played a significant role in raising concern among healthcare professionals over five years of reporting ADRs with more than 1,49,000 registered ADRs until December 2015. India&amp;#39;s contribution to the global Individual Case Safety Reports (ICSRs) database of the WHO is currently 3%. Our hospital is one of the centres for monitoring and reporting ADRs through this programme.7-9&#xD;
&#xD;
The causality algorithm of the Naranjo is commonly used to assess the probability that an ADR was related to the medication found by the clinical event monitor rather than the product of other variables. To determine a weighted score based on responses to a brief standardised questionnaire that correlates with the likelihood of causality, the Naranjo algorithm is used. Computer warning signals with a score of 1 on the Naranjo scale, suggesting a potential ADR, were rated as true positives, similar to other clinical event monitoring tests.10-12&#xD;
&#xD;
The process by which the degree of the relationship between a drug and a suspected reaction is determined is causality evaluation. Actually, in individual patients or case studies, a wide range of causality assessment scales exist to assign clinical outcomes to medications, each with its advantages and disadvantages. These measures include the WHO probability scale, the scale of Naranjo, the scale of Karch &amp; Lasagna, the quantitative imputation scale of Spanish, the scale of Kramer, the scale of Jones, the method of European ABO and the Bayesian system. The most widely used scales are the Naranjo scale and the WHO scale of evaluation.13-15&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
A&#xA0; cross-sectional study was conducted for a&#xA0; duration of&#xA0; 16&#xA0; months from&#xA0; June 2019&#xA0; to&#xA0; September 2020 at SRM Medical College Hospital and Research Centre after obtaining the approval of the Institutional Ethics Committee. ADR details were collected from the patient after the written informed consent. 50 patients of all age groups who developed adverse drug reactions were included in the study. During this period, routine ward rounds were carried out and awareness was given to all healthcare professionals for the voluntary reporting system. The ADR information was documented based on the treating physician&#x2019;s report.&#xA0; Patient information such as age, gender, IP number, weight, diagnosis, relevant investigations, and drug information such as the name of the drug, dose, route of administration,&#xA0; frequency of administration,&#xA0; duration of therapy,&#xA0; types of&#xA0; ADR,&#xA0; treatment and outcome of the reaction were collected and the data were documented in the study proforma; each reported patients were assessed individually.&#xA0; Causality assessment was done based on Naranjo&#x2019;s probability scale.&#xA0; The total score was calculated based on the score and it was categorized as certain&#xA0; (score &gt;9), probable (score 5-8), and possible (score1-4). Modified Hartwig&#x2019;s criteria were used to assess the severity of ADRs into seven levels:&#xA0; Levels&#xA0; 1&#xA0; and&#xA0; 2&#xA0; was classified as a mild category;&#xA0; levels&#xA0; 3&#xA0; and&#xA0; 4&#xA0; as a moderate category;&#xA0; levels&#xA0; 5,&#xA0; 6,&#xA0; and&#xA0; 7&#xA0; were grouped as the severe category.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
During the period of this study, 50 ADRs were reported. Of these 22 (44%) were males and 28(56%) were females (Figure 1). The maximum number of ADRs which were reported in this study was adult females (42%) of age group 18-60 years followed by adult males (34%) of the same age group adolescent age group (12-18yrs) is 2% only, children of age group </Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3441</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3441</Fulltext></URLs><References>&#xD;
	&#xD;
	World&#xA0; Health&#xA0; Organisation:&#xA0; International drug monitoring:&#xA0; the role of the hospital.&#xA0; In Technical report series no.&#xA0; 425.&#xA0; Geneva, Switzerland:&#xA0; World Health Organization; 1966: 1-24.&#xD;
	&#xD;
	&#xD;
	Lazarou J, Pomeranz BH, Corey PN. Incidence of adverse drug reactions in hospitalized patients: a meta-analysis of prospective studies. JAMA 1998;279(15):1200-1205.&#xD;
	&#xD;
	&#xD;
	Juntti-Patinen L, Neuvonen P. Drug-related deaths in a university central hospital. Eur J Clin Pharmac 2002;58(7):479-482.&#xD;
	&#xD;
	&#xD;
	Ramesh M, Pandit J, Parthasarathi G. Adverse drug reactions in a south Indian hospital&#x2014;their severity and cost involved. Pharmac Drug Safety 2003;12(8):687-692.&#xD;
	&#xD;
	&#xD;
	Lihite RJ, Lahkar M. An update on the pharmacovigilance programme of India. Front Pharmacol 2015;6:194.&#xD;
	&#xD;
	&#xD;
	Kalaiselvan V, Thota P, Singh GN. Pharmacovigilance Programme of India: Recent developments and future perspectives. Ind J Pharmacol 2016;48(6):624.&#xD;
	&#xD;
	&#xD;
	Biswas P, Biswas AK. Setting standards for proactive pharmacovigilance in India: The way forward. Ind J Pharmacol 2007;39(3):124.&#xD;
	&#xD;
	&#xD;
	Saravanan SS, Kavitha P, Ponnuswamy TK. Patterns of adverse drug reactions in the medical intensive care unit of an Indian tertiary care hospital. Int J Pharm Biol Arch 2014;5(3):64-68.&#xD;
	&#xD;
	&#xD;
	James J, Rani J. A prospective study of adverse drug reactions in a tertiary care hospital in south india. Asian J Pharm Clin Res 2019;13(1):89-92.&#xD;
	&#xD;
	&#xD;
	Naranjo CA, Busto U, Sellers EM, Sandor P, Ruiz I, Roberts EA, Janecek E, Domecq C, Greenblatt DJ. A method for estimating the probability of adverse drug reactions. Clin Pharmac Therap 1981;30(2):239-245.&#xD;
	&#xD;
	&#xD;
	Palanisamy S, Arul Kumaran KSG, Rajasekaran A. A study on assessment, monitoring, documentation and reporting of adverse drug reactions at a multi-specialty tertiary Care teaching hospital in south India. Int J Phar Rev 2009;1:1519-1522. &#xD;
	&#xD;
	&#xD;
	Kumar A, Kansal D, Sharma PK, Bhardwaj A, Sawaraj S. To study the pattern of adverse drug reactions among patients hospitalized in the medical wards of a tertiary care hospital. Int J Bas Clin Pharmac 2016;5(5):1972.&#xD;
	&#xD;
	&#xD;
	Vora MB, Trivedi HR, Shah BK, Tripathi CB. Adverse drug reactions in inpatients of internal medicine wards at a tertiary care hospital: A prospective cohort study. J Pharmac Pharmacother 2011;2(1):21.&#xD;
	&#xD;
	&#xD;
	Rodriguez-Pena R, Antunez C, Martin E, Blanca-Lopez N, Mayorga C, Torres MJ. Allergic reactions to &#x3B2;-lactams. Exp Opin Drug Safety 2006;5(1):31-48.&#xD;
	&#xD;
	&#xD;
	Raut A, Pawar A, Pankaj M, Srivastava P, Mishra A. Clinical pattern and severity of cutaneous adverse drug reactions. Int J Pharm Sci 2013;5(2):612-616.&#xD;
	&#xD;
	&#xD;
	Chawla S, Kalra BS, Dharmshaktu P, Sahni P. Adverse drug reaction monitoring in a tertiary care teaching hospital. J Pharmacol Pharmac 2011;2(3):196-198.&#xD;
	&#xD;
	&#xD;
	Martin T, Li Severe cutaneous adverse drug reactions: a review on epidemiology, etiology, clinical manifestation and pathogenesis. Chin Med J (Engl) 2008;121(8):756-761.&#xD;
	&#xD;
	&#xD;
	Shamna M, Dilip C, Ajmal M, Linu Mohan P, Shinu C, Jafer CP, et al. A prospective study on Adverse Drug Reactions of antibiotics in a tertiary care hospital. Saudi Pharm J 2014;22(4):303-308.&#xD;
	&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Factors of Working Hours on the Quality of Healthrelated Life of Coronary Arterial Diseases in Korea: National Health and Nutrition Survey data from the Korea Centers for Disease Control and Prevention (2013-2017)&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>75</FirstPage><LastPage>82</LastPage><AuthorList><Author>Eunhee Jo</Author><AuthorLanguage>English</AuthorLanguage><Author> Soo Jin Lee</Author><AuthorLanguage>English</AuthorLanguage><Author> Soon-jung Hwang</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Risk factors for coronary artery disease vary, but among them, factors that can be controlled by improving lifestyles include obesity, alcohol, smoking, lack of physical activity, stress, high blood pressure, diabetes, and hyperlipidemia. Objective: This study is a secondary data analysis study to identify the factors affecting working hours on health-related quality of life for people with coronary artery disease. The raw data is the National Health and Nutrition Survey (KNHANES) surveyed by the Korea Centers for Disease Control and Prevention from 2013 to 2017. Method: The subjects were 10,133 adults aged 19 or older who answered questions from doctors about whether to diagnose myocardial infarction or angina. EQ-5D was used as a tool for quality of life. The collected data were analyzed by using the SPSS WIN 25.0 program, using a stratified sample analysis method using stratification, colonization, and weighting. In the case of more than 40 hours per week and less than 50 hours, the subject&#x2019;s quality of life score was high (p</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Working hours, Cardiovascular disease, Health-related quality of life, EQ-5D</Keywords><Fulltext>&#xD;
&#xD;
Introduction&#xD;
&#xD;
From the provided facts, it seems that the number of deaths from heart disease in 2018 is not correct, according to the latest WHO data published in 2018 Coronary Heart Disease Deaths in South Korea reached 26,172 or 10.56% of total deaths. The age-adjusted Death Rate is 30.29 per 100,000 population ranks South Korea at 183 in the world. Coronary artery disease is the number one major cause of death in the world,1,2 and as social costs due to coronary artery disease increase, we are trying to come up with and implement policies for prevention and management not only in Korea but also around the world.&#xD;
&#xD;
Risk factors for coronary artery disease vary, but among them, factors that can be controlled by improving lifestyles include obesity, alcohol, smoking, lack of physical activity, stress, high blood pressure, diabetes, and hyperlipidemia.3 To reduce controllable risk factors for coronary artery disease, the American College of Cardiology and the American Heart Association have developed practical guidelines to improve lifestyle habits including diet and physical activity. It was recommended to develop and practice measures to reduce the risk of coronary artery disease by improving professional management.4&#xD;
&#xD;
The Republic of Korea is included in the developed countries, but along with economic development, the average life expectancy has been extended, and the westernization of eating habits and lifestyles has led to an increase in instant and meat intake due to past vegetarian diets, resulting in increased stress. Lifestyles are changing due to a decrease in the amount of exercise, and coronary artery disease is increasing. 5&#xD;
&#xD;
Therefore, to reduce the risk of coronary artery disease, efforts to change lifestyle, such as active physical activity in daily life and improvement of healthy eating, are important. To practice health promotion through lifestyle changes, individual will and efforts are important, but time is essential. Looking at the working hours of the Republic of Korea, according to Article 50 of the Labor Standards Act, work exceeding 40 hours a week is prohibited, and even if the parties agree in Article 53, overtime work is allowed only up to 12 hours a week. Therefore, the longest working hours per week permitted by the current laws of the Republic of Korea is 52 hours. Despite the reduction of working hours by presenting legal working hours in the Labor Standards Act, Korea&amp;#39;s 2018 working hours based on OECD statistics (data.oecd.org) were 1,993 hours, the second largest among OECD countries after Mexico (2,148 hours). Compared to the average annual working hours of 2,228 hours in 2008 of the last Korean workers, it decreased by 10.5%, but compared to the OECD average of 1,734 hours, it was found that they were working an average of 259 hours more.6&#xD;
&#xD;
An extension of working hours, such as overtime, makes it difficult to have personal time to improve health,6 leading to overwork or work stress, causing blood pressure to rise and coronary artery disease.7 Overtime is also a factor that increases the incidence of coronary artery disease as a cause of overwork for workers.8,9&#xD;
&#xD;
Therefore, it is necessary to maintain proper working hours to reduce the incidence of coronary artery disease. Securing adequate working hours gives coronary artery disease patients time to improve their lifestyle, such as physical activity, to reduce risk factors for heart disease and improve quality of life.10&#xD;
&#xD;
Therefore, it is necessary to maintain appropriate working hours to reduce the occurrence of coronary artery disease. Securing appropriate working hours gives coronary artery disease patients time to improve lifestyle habits such as physical activity, thereby reducing risk factors for heart disease and improving quality of life.10 Quality of life is a comprehensive concept that reflects all areas related to human well-being and is a subjective indicator of self-awareness from a subjective perspective such as one&amp;#39;s social function, role, symptom, physical function and emotional state.11 Health-related quality of life implies not only the level of health and disease but also the comprehensive meaning of physical, mental and social quality of life affected by motor skills, self-care, daily life, pain and discomfort, anxiety and depression.12,13&#xD;
&#xD;
In a study of public officials in the UK, the risk of developing heart disease was 1.6 times higher than those who worked 7-8 hours after 3-4 hours of overtime working a day.14 In a study involving people who visited the hospital, the risk of acute myocardial infarction was doubled when the weekly working hours exceeded 61 hours compared to those who worked less than 40 hours.15 Besides, as a result of estimating how the reduction of legal working hours in France affects health-related changes, the reduction of working hours had a significant effect on positive health status and changes in health behaviour.16&#xD;
&#xD;
Many factors affect the quality of life-related to health. The higher the education level, the better the working conditions, such as income and appropriate working hours, so you can spend time on activities to improve lifestyles with time to get better health. Status,17 and occupation also reflects personal income and working hours as one of the socioeconomic indicators that affect health.18,19 Therefore, working hours have a significant effect on health behavior changes as a health-related indicator. It is necessary to analyze the factors affecting the health-related quality of life of people with coronary artery disease.&#xD;
&#xD;
In addition, the role of nurses is increasing as local health care personnel who can play an important role in the reality of the importance of health-related quality of life, and it will be necessary to check how working hours are related to coronary diseases in order to establish various health coaching nursing strategies for the management of coronary artery diseases, one of the chronic diseases.&#xD;
&#xD;
In this study, it is expected that working hours will be a practical basis for nursing arbitration and national policy to identify factors affecting the quality of life related to the health of coronary diseases and come up with measures to improve the quality of life related to health.&#xD;
&#xD;
&#xD;
&#xD;
MATERIALS AND METHODS &#xD;
&#xD;
Study design&#xD;
&#xD;
This study is a secondary data analysis study to understand the factors that influence working hours on health-related quality of life for people with coronary artery disease. The raw data is the National Health and Nutrition Survey (KNHANES) surveyed by the Korea Centers for Disease Control and Prevention from 2013 to 2017&#xD;
&#xD;
Research subject&#xD;
&#xD;
&#xD;
&#xD;
This study is 19 years of age or older out of the 27,224 people who responded with yes&amp;#39; or no&amp;#39; to the medical team for myocardial infarction and angina out of 39,225 subjects of the Korea Centers for Disease Control and Prevention from 2013 to 2017. 10,133 subjects with no missing values in the variable were analyzed.&#xD;
&#xD;
The target population of the National Health and Nutrition Survey is citizens residing in the Republic of Korea, and the sampling frame was based on the data from the most recent population and housing survey available at the time of sampling design. The National Health and Nutrition Survey consists of national health surveys, screening surveys, and nutrition surveys, and the sampling method used a two-stage stratified sampling method with the surveying district and household as the first and second extraction units.&#xD;
&#xD;
&#xD;
&#xD;
Research tools&#xD;
&#xD;
General characteristics&#xD;
&#xD;
Sex, age, subjective health, stress cognition, activity limit, and working hours per week were used to understand the general characteristics of the subjects of this study. Subjective health was reclassified as &amp;#39;very good&amp;#39;, &amp;#39;good&amp;#39; to &amp;#39;good&amp;#39;, &amp;#39;moderate&amp;#39; to &amp;#39;moderate&amp;#39; and&amp;#39; bad&amp;#39;, and &amp;#39;very bad&amp;#39; to &amp;#39;bad&amp;#39;. Stress cognition was reclassified as &amp;#39;very much feeling&amp;#39;, into &amp;#39;much&amp;#39; &amp;#39;feeling a little&amp;#39; into &amp;#39;moderate&amp;#39;, and &amp;#39;little feeling&amp;#39; into &amp;#39;little&amp;#39;. limit on activities were made using the data &amp;#39;Yes&amp;#39; and &amp;#39;No&amp;#39;. As for the working hours per week, the average working hours per week was categorized into &amp;#39;less than 40&amp;#39;, &amp;#39;Greater than or equal to 40 hours and less than 50&amp;#39;, &amp;#39;Greater than 50 hours and less than 60&amp;#39;, and &amp;#39;Greater than or equal to 60&amp;#39;.&#xD;
&#xD;
Characteristics of health behaviour&#xD;
&#xD;
The health-related characteristics of the subjects of this study were analyzed using smoking, alcohol and depression. Smoking was reclassified as "daily smoking" as smoking and "smoking in the past, but not currently smoking" as non-smoking. Drinking frequency was used for 1 year. &amp;#39;No drinking at all in the last year&amp;#39; was reclassified as no&amp;#39; and &amp;#39;less than once a month-more than 4 times a week&amp;#39; as &amp;#39;yes&#x2019;. For depression, data that responded with &#x2018;yes&#x2019; and &#x2018;no&#x2019; were used in the variables of the depression doctor group.&#xD;
&#xD;
Health related quality of life&#xD;
&#xD;
The health-related quality of life of this study subject was analyzed using the EQ-5D (EuroQol-5 dimension). EQ-5D is a health-related quality of life measurement tool that was developed to measure overall health and is composed of multiple-choice questions in five areas: mobility, self-care, usual activities, pain/discomfort, and anxiety/depression. Each question is answered in one of three levels:&amp;#39;no problems&amp;#39;,&amp;#39;some problem&amp;#39;, and &amp;#39;very problem&amp;#39;, and if the items answered from 5 questions are combined, a total of 35 = 243 health conditions can be measured. I can. The EQ-5D index was calculated by applying a quality weight to the measured value of the EQ-5D item. The higher the score, the higher the health-related quality of life.&#xD;
&#xD;
Data collection and analysis method&#xD;
&#xD;
In this study, the research results calculated from the sample data of the Korea Centers for Disease Control and Prevention from 2013 to 2017 represent the whole of Korea, and weights, stratification variables, and colony variables were considered to obtain unbiased estimation results. To calculate the analysis results considering complex sample factors such as strata, colony, and weight, SPSS/WIN 25.0 program was used and analyzed by the complex sample analysis method. The general characteristics and health-related characteristics of the subjects according to the diagnosis of coronary artery disease were analyzed by the composite sample frequency and percentage, and the difference between them was analyzed using Rao_Scott&#x3C7;2-test. For the health-related quality of life score according to the working hours of coronary artery disease patients, composite sample descriptive statistics were used and the difference was analyzed by t-test. A complex sample general linear model multiple regression analysis was performed to identify the factors affecting the subject&amp;#39;s health-related quality of life.&#xD;
&#xD;
&#xD;
&#xD;
Ethical considerations&#xD;
&#xD;
The raw data of KNHANES, the data of this study, are government-designated statistics based on Article 17 of the Statistical Act (approval number 117002) as a legal investigation conducted based on Article 16 of the National Health Promotion Act from 2013 to 2017 as a National Health and Nutrition Survey. KNHANES is a research conducted by the state directly for public welfare according to Article 2, No. 1 of the Bioethics Act and the Enforcement Rule of the same Act, Article 2, No. 2, No. After familiarizing yourself with, it was approved by e-mail and downloaded and analyzed. The KNHANES raw data was conducted after receiving approval of the use of the raw data from the National Health and Nutrition Survey and the confirmation of exemption from IRB deliberation [P01-202006-21-016] from the National Health and Nutrition Survey website according to the procedure for use.&#xD;
&#xD;
Results&#xD;
&#xD;
Differences in coronary artery disease according to the general characteristics of the subject&#xD;
&#xD;
The number of patients diagnosed with coronary artery disease was male, 92.7% (318), and the male was significantly higher than female (Rao_Scott &#x3C7;2=8.40, p=0.001). In terms of age, 67.3% (270 people) were over 60 years old, and those over 60 were significantly higher than those between 19-39 and 40-59 years old (Rao_Scott &#x3C7;2=374.43, p</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3442</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3442</Fulltext></URLs><References>&#xD;
&#xD;
	&#xD;
	Korea S. statistics of causes of death for Korea. Seoul: Statistics Korea; 2019 [cited 2020 October 1].&#xD;
	&#xD;
	&#xD;
	Al-Ansary LA, Grove JT. Monitoring health for The SDGs, Sustainable development goals. World health statistics 2018. Geneva: World Health Organization; 2018 May. Report No.:CC BY-NC-SA 3.0 IGO.&#xD;
	&#xD;
	&#xD;
	Jinnouchi H, Kolodgie FD, Romero M, Virmani R, Finn AV. Pathophysiology of coronary artery disease. In: Chun Y, Thomas S. Hatsukami, Mahmud MB editors. Vessel Based Imaging Techniques, Seattle. Springer, Cham. 2020:211-227. &#xD;
	&#xD;
	&#xD;
	Eckel RH, Jakicic JM, Ard JD, de Jesus JM, Miller NH, Hubbard VS, et al. 2013 AHA/ACC guideline on lifestyle management to reduce cardiovascular risk: a report of the American College of Cardiology/American Heart Association task force on practice guidelines. J Am Coll Cardiol 2014;63(25):2935-2958. &#xD;
	&#xD;
	&#xD;
	Jo MS, Kim J, editors. A study on the influence of the change of working hours on the quality of life. 2019 Korea Labor Panel Conference; 2019 December; Seoul National University Hoam Professor Hall Convention Center, Seoul City, korea labor and income panel study; 2019:14.&#xD;
	&#xD;
	&#xD;
	Uehata T. Long working hours and occupational stress-related cardiovascular attacks among middle-aged workers in Japan. J Human Ergol 1991;20(2):147-153.&#xD;
	&#xD;
	&#xD;
	Karasek R, Baker D, Marxer F, Ahlbom A, Theorell T. Job decision latitude, job demands, and cardiovascular disease: a prospective study of Swedish men. Am J Public Health 1981;71(7):694-705. &#xD;
	&#xD;
	&#xD;
	Liu Y, Tanaka H. Overtime work, insufficient sleep, and risk of non-fatal acute myocardial infarction in Japanese men. Occup Env Med 2002;59(7):447-451.&#xD;
	&#xD;
	&#xD;
	Hwang, WJ, Hong O, Kim MJ. Factors associated with blue-collar workers&amp;#39; risk perception of cardiovascular disease. J Korean Acad Nur 2012;42(7):1095-1104. &#xD;
	&#xD;
	&#xD;
	Winzer EB, Woitek F, Linke A. Physical activity in the prevention and treatment of coronary artery disease. J Am Heart Assoc 2018;7(4):117.007725. &#xD;
	&#xD;
	&#xD;
	Mesbah M, Cole BF, Lee MT. Statistical methods for quality of life studies. Boston: Kluwer Academic Publishers. 2002:353.&#xD;
	&#xD;
	&#xD;
	Wilson IB, Cleary, PD. Linking clinical variables with health-related quality of life: a conceptual model of patient outcomes. J Am Med Assoc 1995;273(1):59-65. &#xD;
	&#xD;
	&#xD;
	Lee, JJ, Lee, HJ, Park, EJ. Effect of staged education Program for hypertension, diabetes patients in a community (Assessment of quality of life using EQ-5D). J Agr Med Comm Health 2014;39(1):37-45.&#xA0; &#xD;
	&#xD;
	&#xD;
	Virtanen M, Ferrie JE, Singh-Manoux A, Shipley MJ, Vahtera J, Marmot MG, et al. Overtime work and incident coronary heart disease: the Whitehall II prospective cohort study. Euro Heart J 2010;31(14):1737-1744.&#xD;
	&#xD;
	&#xD;
	Liu Y, Tanaka H. (2002). Overtime work, insufficient sleep, and risk of non-fatal acute myocardial infarction in Japanese men. Occup Envir Med 2002:59(7):447-451. &#xD;
	&#xD;
	&#xD;
	Berniell MI. The effects of working hours on health status and health behaviors. 15th IZA Eur. Summer School in Labor Econ. 2012 Mar:33p.&#xD;
	&#xD;
	&#xD;
	Lee EW. A study on inter-regional differences of self-rated health. Korea Regional Econ Assoc 2015;30(1):33-53.&#xD;
	&#xD;
	&#xD;
	Ross CE, Wu CL. Education, age, and the cumulative advantage in health. J Health Soc Behav 1996:104-120. &#xD;
	&#xD;
	&#xD;
	Lynch J, Kaplan G. Socioeconomic position. Soc Epidemiol 2000;1:13-35.&#xD;
	&#xD;
	&#xD;
	Park IS, Song RY, Ahn SH, So HY, Kim HL, Joo KO. Factors explaining quality of life in individuals with coronary artery disease. J Korean Acad Nur 2008;38(6):866-873. &#xD;
	&#xD;
	&#xD;
	Park SK, Kim, HS, Cho, IS, Ham, OK. Gender differences in factors influencing quality of life among patients with coronary artery disease. J Korean Acad Fundam &#xA0;Nur 2009;16(4):497-505.&#xD;
	&#xD;
	&#xD;
	Pocock SJ, Henderson RA, Clayton T, Lyman GH, Chamberlain DA, RITA-2 Trial Participants. Quality of life after coronary angioplasty or continued medical treatment for angina: three-year follow-up in the RITA-2 trial. J Am Coll Cardiol 2000;35(4):907-914. &#xD;
	&#xD;
	&#xD;
	Seong SS, Choi CB, Sung YK, Park YW, Lee HS, Uhm WS, et al. Health-related quality of life using EQ-5D in Koreans. J Korean Rheumatol Assoc 2004;11(3):254-262. &#xD;
	&#xD;
	&#xD;
	Jakobsson U, Hallberg IR, Westergren A. Overall and health related quality of life among the oldest old in pain. Quality Life Res 2004;13:125-136. &#xD;
	&#xD;
	&#xD;
	Burstrom K, Johannesson M, Diderichsen F. Swedish population health-related quality of life results using the EQ-5D. Quality Life Res 2001;10:621-635.&#xD;
	&#xD;
	&#xD;
	Park SK, Kim HS, Cho IS, Ham OK. Gender differences in factors influencing quality of life among patients with coronary artery disease. J Korean Acad &#xA0;Fundam Nur 2009;16(4):497-505. &#xD;
	&#xD;
	&#xD;
	Chan S, Jia S, Chiu H, Chien WT R. Thompson D, Hu Y, et al. Subjective health?related quality of life of chinese older persons with depression in shanghai and Hong Kong: relationship to clinical factors, level of functioning and social support. International Journal of Geriatric Psychiatry:&#xA0; J Psychia Late Life Allied Sci 2009;24(4):355-362. &#xD;
	&#xD;
	&#xD;
	Jayasinghe UW, Harris MF, Taggart J, Christl B, Black DA. Gender differences in health-related quality of life of Australian chronically-ill adults: patient and physician characteristics do matter. Health Quality Life Outcomes 2013;11(1):102. &#xD;
	&#xD;
	&#xD;
	Jung U, Kim SJ, Song YS. The Economic burden of diseases attributable to overwork and policy implications in Korea. Health Hazard Evaluation Report. Sejong City: Korea Inst. Health and Social Affairs; 2018 December. Report No.:2018-05.&#xD;
	&#xD;
&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Metastatic Lesions Involving Bone Marrow: 16-Year Analytical Study at a Tertiary Care Centre&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>83</FirstPage><LastPage>86</LastPage><AuthorList><Author>Nuzhat S</Author><AuthorLanguage>English</AuthorLanguage><Author> Aiman A</Author><AuthorLanguage>English</AuthorLanguage><Author> Gull S</Author><AuthorLanguage>English</AuthorLanguage><Author> Bhat IH</Author><AuthorLanguage>English</AuthorLanguage><Author> Hamid P</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: The bone marrow is one of the common organs to be involved by tumours that metastasize via the bloodstream. Screening of the bone marrow is considered one of the most valuable diagnostic tools to evaluate hematologic disorders- diagnosis, staging and therapeutic monitoring. Intracranial tumours rarely metastasize outside the cranial vault. Differences between bone marrow biopsy and aspirate findings usually result from a desmoplastic stromal reaction to the tumour cells that renders neoplastic cells more difficult to aspirate than residual haemopoietic cells. Objective: To know the diagnostic utility of bone marrow aspiration and biopsies in non-haematological lesions which can have a direct impact on treatment and prognosis of the patient. Methods: Bone marrow aspiration and bone marrow biopsy specimens received were dealt with according to the standard procedure for cytological and histological examination. In case of bone marrow biopsies, 5-6 &#xB5;m thick sections were cut and stained with routine hematoxylin and eosin stain. Results: In the paediatric age group, the most common metastatic tumour is small round cell tumour among which neuroblastoma is the most common followed by ewings and rhabdomyosarcoma. In adults, most common metastasis was from lung followed by prostate and breast. Lung and prostate were more common in males and breast in females. There was a slight male preponderance in our study with male to female ratio of 1.9:1. Conclusion: The bone marrow examination is a useful, minimally invasive and important investigation in diagnosing metastatic tumours. Further trephine biopsy and bone marrow aspiration are complementary to each other as if one procedure fails to pick up the tumour cells other may diagnose it successfully.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Bone marrow aspiration, Bone marrow biopsy, Metastasis</Keywords><Fulltext>Introduction&#xD;
&#xD;
The bone marrow is one of the more common organs to be involved by tumours that metastasize via the bloodstream. In adults the tumours most often seen are carcinomas of the prostate gland, breast and lung, although any tumour that gives rise to bloodborne metastases may infiltrate the marrow.1,2 In children, neuroblastoma, rhabdomyosarcoma, Ewing&#x2019;s sarcoma, other primitive neuroectodermal tumours (PNET) and retinoblastoma account for the majority of metastases.3,4 Intracranial tumours rarely metastasize outside the cranial vault. Of those cases reported with bone marrow involvement, glioblastoma multiforme has been the most frequent.5 Examples of metastatic medulloblastoma6 and oligodendroglioma7 have also been recorded. If bone marrow aspiration is found to be impossible, imprints from the biopsy specimen are obtained, before putting it into fixative which permits a differential count similar to that performed on aspirate films.8 Further sampling allows for material to be directed towards other ancillary tests such as cytogenetic, molecular studies, microbiologic cultures, immunohistochemistry, and flow cytometry. Malignancy is on an increase globally and bone marrow examination has gained a lot of importance in the management of such patients. The present study has been undertaken to know the diagnostic utility of bone marrow aspiration and biopsies in non-haematological lesions which can have a direct impact on treatment and prognosis of the patient.&#xD;
&#xD;
Material and Methods&#xD;
&#xD;
The present study was conducted in the department of pathology and the department of clinical Hematology, 8-year retrospective extending from June 2002 to May 2010 and 8-year prospective extending from June 2010 to December 2018 in a tertiary care hospital Sheri-i-Kashmir institute of medical science (SKIMS), Srinagar, Kashmir. Clinical information as per the Performa was gathered, which included information on age, sex, hemogram, and most common symptoms. Bone marrow aspiration and bone marrow biopsy specimens received were dealt with according to the standard procedure for cytological and histological examination. In case of bone marrow biopsies, 5-6 &#xB5;m thick sections were cut and stained with routine hematoxylin and eosin stain. The positive ones were subjected to special stains and immunohistochemistry where ever necessary.&#xD;
&#xD;
Results AND DISCUSSION&#xD;
&#xD;
Bone marrow examination is a very important investigation for evaluation of the number of disease processes involving bone marrow, primary and secondary, and has an important role in establishing the final diagnosis. A limited number of studies have been conducted to evaluate the diagnostic utility of bone marrow examination in non-haematological disorders. Of the total 217 cases, most of them were from the pediatric age group, and most of the cases of metastasis were from small round cell tumours. This can be because our institute is the only institute in our state having developed pediatric surgery and medical oncology departments. The metastasis in adults mainly affected middle-aged to elderly patients with a mean of (55 years) Most of the adult cases are above 50 years of age accounting for 66.6% and most of the pediatric cases are below 10 years. They found 62.8 % of adult patients above 50 years of age and most of the pediatric patients were below 10 years of age.&#xD;
&#xD;
Out of 217 patients studied 141 patients were males (65.3%) and 75 patients were females (34.5%), with male to female ratio of 1.9: 1.&#xD;
&#xD;
&#xD;
&#xD;
The youngest patient was 5 months old and the eldest patient recorded was 80 years of age. The mean age of presentation was 35.8 with a standard deviation of 23.016.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
In our study, the most common primary location was lung (Figure 1 and 2) and was also comparable to the previous studies.1,9,10 &#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
However against the study done by Saadettin kilickap11 et al which showed breast (Figure 3) and prostrate as the most common primary location respectively.&#xD;
&#xD;
&#xD;
&#xD;
The lung is the most common primary site here because here in our part of world people smoke Huka, cigarette and use Bukhari and firepots inside their clothing in the winter season.&#xD;
&#xD;
Neuroblastoma is the most common tumour among small round cell tumours (Figure 4 and 5) in our study being followed by rhabdomyosarcoma frequency; similar findings were seen in the study done by Lashiram et al where neuroblastoma and rhabdomyosarcoma tumour metastasis was 42.8% and 28.5 % respectively.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
In our study, anaemia was the most frequent finding (79.6%). We also found that bone marrow aspirate detects only 53 % of all the tumours that were diagnosed on bone marrow biopsy. Bone marrow biopsy being more sensitive procedure, as bone marrow tumour cells show a desmoplastic reaction, thus the demonstration of tumour metastasis by bone marrow biopsy was far superior to the bone marrow aspirate in our study.&#xD;
&#xD;
Conclusion&#xD;
&#xD;
We would like to conclude that bone marrow examination is a useful, minimally invasive and important investigation in diagnosing metastatic tumours. Further trephine biopsy and bone marrow aspiration are complementary to each other as if one procedure fails to pick up the tumour cells other may diagnose it successfully.&#xD;
&#xD;
Acknowledgement: We would like to acknowledge all the researchers mentioned in the bibliography whose previous research added to our knowledge and guided us in our endeavour.&#xD;
&#xD;
Conflict of interest: we declare that there is no conflict of interest.&#xD;
&#xD;
Funding: no funding. &#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3443</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3443</Fulltext></URLs><References>&#xD;
	&#xD;
	Anner RM, Drewinko B. Frequency and significance of bone marrow involvement by metastatic solid tumours. Cancer 1977;39:1337-1344.&#xD;
	&#xD;
	&#xD;
	Singh G, Krause JR, Breitfeld V. Bone marrow examination for metastatic tumour. Cancer 1977;40: 2317-2321.&#xD;
	&#xD;
	&#xD;
	Finkelstein JZ, Ekert H, Isaacs H and Higgins G, Bone marrow metastases in children with solid tumours. Am J Dis Child 1970;119:49-52.&#xD;
	&#xD;
	&#xD;
	&#xA0;Delta BG, Pinkel D. Bone marrow aspiration in children with malignant tumours. J Paediatr 1964;64:542-546.&#xD;
	&#xD;
	&#xD;
	Kleinschmidt-Demasters BK. Bone marrow metastases from glioblastoma multiforme: the role of dural invasion. Hum Pathol 1997;27:197-201.&#xD;
	&#xD;
	&#xD;
	Hoffmann M, Henrich D, Dingeldein G, Uppenkamp M. Medullo blastoma with osteoblastic metastasis and bone marrow fibrosis. Bone Marrow Transpl 1999;23:631.&#xD;
	&#xD;
	&#xD;
	Dawson TP. Pancytopenia from a disseminated anaplastic oligodendroglioma. Neuropathol Appl Neurobiol 1997; 23:516-520.&#xD;
	&#xD;
	&#xD;
	Aboul-Nasr R, Estey EH, Kantarjian HM, et al. Comparison of touch imprints with aspirate smears for evaluating bone marrow specimens. Am J Clin Pathol 1999;111:753-758.&#xD;
	&#xD;
	&#xD;
	Syed NN, Moiz B, Adil SN, Khurshid M. Diagnostic importance of bone marrow examination in non-haematological disorders. JPMA 2007;57:123.&#xD;
	&#xD;
	&#xD;
	Wong KF,&#xA0;Chan JK,&#xA0;Ma SK. Solid tumour with an initial presentation in the bone marrow--a clinicopathologic study of 25 adult cases. Hematol Oncol&#xA0;1993;11(1):35-42.&#xD;
	&#xD;
	&#xD;
	Kilickap S, Erman M, Dincer M, Aksoy S. Bone marrow metastasis of solid tumours: Clinicopathological evaluation of 73 cases. Turk J Cancer 2007;37(3):85-88.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Diabetes Mellitus with Non-Alcoholic Fatty Liver Disease-Challenges in Nutritional Therapy&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>87</FirstPage><LastPage>90</LastPage><AuthorList><Author>Suchitra MR</Author><AuthorLanguage>English</AuthorLanguage><Author> Parthasarathy S</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Diabetes mellitus (DM) and non-alcoholic fatty liver disease (NAFLD) are inseparably entwined, each worsening the condition of the other. Different types of drugs are being described to counter the disease. Nutritional challenges are far more in combined illness. We wanted to focus on the intricate difficulties of managing such a comorbid case about diet and nutrition. A detailed search of the articles from Pubmed, Cochrane and Scopus databases were made to consolidate the findings in a concise way to be presentable highlighting the nucleus of the problem. A nominal 10 &#x2013; 15 % decrease in the calories will be beneficial in both illnesses. Strict avoidance of excess alcohol and soft drinks is a must. Diet with added fructose should be avoided. Still, garlic with oligofructose is beneficial. Use of vegetable oils rich in polyunsaturated fatty acids will help in decreasing the incidence of fatty liver. The intake of unprocessed food like whole grains, nuts, legumes, fruits and seeds with high fibre content and fewer simple sugars are recommended. Spaced slow intake of restricted calorie diet is ideal. Five planned menus for a 600-calorie diet are given. The diet can be adjusted to 1500 &#x2013; 2000 calories according to the need of the patient. The confounding factors which modify these plans are age, sex, Body mass index and the regular physical activities of each individual. A mildly modified but eatable menu in the diet can be achieved to counter the comorbid conditions of diabetes mellitus and NAFLD. A very low calorie (600 calories/day) diet may be beneficial to NAFLD but needs caution in the incidence of abnormal glycaemic swings. A 10 % reduction in weight is useful in NAFLD.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Diabetes, Fatty liver, Nutrition, Diet, Recipes</Keywords><Fulltext>Introduction&#xD;
&#xD;
Diabetes mellitus is one of the most common non-communicable epidemics ruining the world. India has become the diabetic capital with a maximum number of cases. Nutritional management of diabetes mellitus plays an important role in the control of the disease. There are many complications associated with the disease as it progresses over years. The duration of diabetes increases the incidence of its associated complications.1 Non-alcoholic fatty liver disease (NAFLD) is emerging as a new entity with changing lifestyles. The combination of NAFLD with pre-existing dietary modifications for diabetes mellitus (DM) pushes the attending dietician in a fix regarding the modification of diet to arrest the progress of the liver disease.2 In this narrative review, we have tried to address the dietary factors which may influence a combined illness. &#xD;
&#xD;
The genesis of NAFLD in DM&#xD;
&#xD;
NAFLD is hepatic steatosis: There should be macrovesicular steatosis in &gt;5% of hepatocytes: There should not be any secondary cause of steatosis. The prevalence of NAFLD is around 60%. The most important health problem associated with it is the progression of NAFLD to non-alcoholic steatohepatitis and further to cirrhosis and hepatic cellular carcinoma. The presence of DM worsens the progress of NAFLD and the vice versa is also true and both being proved on a scientific basis beyond doubt. The unexplained interactions between NAFLD, visceral adiposity and insulin resistance thereby its close association with DM is still being explored by scientists. NAFLD disease per se depends on so many factors like genetic predisposition, ethnicity, age, gender, and metabolic status.3 Recently a few gene variants have been described where the prevalence of the disease is found to be significantly higher than those who don&#x2019;t possess that variant.4 In patients with T2D, liver lipogenesis is increased: fatty acid oxidation and triglyceride secretion decreased: the insulin resistance increased: making the liver transform to a fatty liver.&#xA0; Hence, we can decipher that in a genetically susceptible individual, increased insulin resistance and abnormal lipid metabolism in the liver makes patients vulnerable to develop NAFLD than in non-diabetic individuals. We also know that the NAFLD progresses faster to worsen to cirrhosis in diabetics. Hence avoiding the development and the progress of NAFLD in diabetic patients form an essential part of the management of diabetes mellitus.5 Still, renal cardiac and neurological complications of DM are well studied, but NAFLD as a dangerous predecessor to hepatocellular carcinoma in uncontrolled patients is not recognized. The presence of NAFLD also increases the cardiovascular complications of DM. &#xD;
&#xD;
Management of NAFLD in diabetics &#xD;
&#xD;
Metformin, glitazones, Gliflozins, gliptins have been prescribed with varying results as targets to NAFLD among the other many drugs used for control of hyperglycaemia. Recent studies have shown more negative results with the use of metformin and NAFLD. Pioglitazone and lobeglitazone are described as insulin sensitizers with peroxisome proliferator-activated receptor (PPAR)-&#x3B3; agonist effects. Both these drugs have been proved to decrease the fat content of the liver over six months. Among the gliptins which are DPP 4 inhibitors, significant decreases in liver enzymes were reported after 16 weeks of treatment of combined NAFLD and T2DM with sitagliptin. Sodium-glucose co-transporter 2 (SGLT2) inhibitors like gliflozins also play a significant role in the arrest of the progress of the disease other than significant HbA1C reductions.3 This part may be due to their weight-reducing potential. Even though many pharmacological interventions are described, weight reduction, dietary changes and lifestyle modifications are essential and form the key management strategy in such patients. &#xD;
&#xD;
Dietary changes &#xD;
&#xD;
Commonly patients who take high carbohydrate diet with an increased portion of soft drinks and meat are more prone to develop NAFLD. Soft drinks are the most common source of simple sugar and its responsible for worsening Intake of polyunsaturated fatty acids is favourable which is not likely to increase the progress of the disease. Intake of simple carbohydrates especially fructose has been incriminated. Foods which are high in added fructose include sauces, salads, sugary drinks, yoghurt, baked and fast foods. Foods which are naturally rich in fructose include honey, dried fruits and fruit juices.6 There are some studies which state that artificially added fructose is more dangerous in causing NAFLD than natural resources.7 Oligofructose supplementation decreases blood glucose and optimises the lipid profile so that its beneficial to both DM and NAFLD.&#xA0; Garlic and chicory are rich sources of oligofructose. Fruits like apple, guava and Jamun have benefits for both (DM and NAFLD) diseases.8 Sitaphal has antidiabetic properties but the calorific content should be kept in mind (100 cal/100 grams).9 Certain types of leaves like asparagus which are also rich in oligofructose are not easily available for routine use.&#xA0; In a study, the effectiveness of one-year continuous consumption of an n-3 PUFA rich olive oil resulted in decreased liver enzymes in patients with NAFLD. Hence a fat restriction is also being proved to arrest the progress of the disease. Foods which are rich in PUFA (vegetable oils) like corn oil, flaxseed oil, mustard oil, sunflower oil rice bran oil can be consumed to tackle NAFLD. Regarding the protein part of the diet, the ingestion of red meat is associated with worse prognosis in patients with NAFLD.10&#xA0; Egg white, pulses are a few protein options. The intake of unprocessed food like whole grains, nuts, legumes, fruits and seeds have high fibre content and less simple sugars and they are recommended for NAFLD. Hence a plant-based unrefined high fibre diet is having a definite negative correlation with the progress of the disease to Non-alcoholic steatohepatitis (NASH) and hepatocellular carcinoma (HCC).11 Regular coffee consumption is being studied to have an inhibitive effect on the progression of fibrosis in patients with NAFLD when tested using the Fibro-Test.12 To be clear and concise, the carbohydrates should be around 40%-50% of the total calorie intake with a predominant complex carbohydrate-rich in fibre. A maximum of 10 % is only allowed for simple sugars without fructose.&#xA0; A fatty intake of 30 % with a PUFA or MUFA is preferred than saturated fatty acid intake. A 10&#x2013;15 % of energy can be gained from protein which is needed to decrease the associated insulin resistance in such patients.13 All diabetic patients should have their calories spread over the day and with intermittent healthy snacks and this idea should synchronize with the dietary prescription of NAFLD. A lot of vitamin supplementation like vitamin E, C have been studied with varied results. Alpha-tocopherol and ascorbic acid supplements are being tried.14 Citrus fruits, green leafy rich foods and nuts can be recommended with caution and a note on their calorie output. Guava, apple and avocados have less calorific value and can be added to the diet.15 On a miscellaneous note, bitter gourd, fenugreek with rich fibre content and tofu with soy protein can lessen the damage to liver associated with DM.16 &#xD;
&#xD;
Weight reduction&#xD;
&#xD;
Weight reduction has been the numero uno factor in managing NAFLD. A 10 % decrease in the calorie need for any patient is essential in the management of NAFLD with DM. this usually causes a weight loss of around 0.5 kg/week. Any additional calorie restriction may trigger a ketogenic milieu which is detrimental to DM. the very low caloric diet (VLCD) VLCD-450 Kcal/day and 800kcal/d can effectively and safely reduce body weight and improve NAFLD in 12 weeks in obese 132 Taiwanese participants.17 The weight reduction was more than 10% and the enzyme improvement showed 41% and 50% in 450 and 800 calorie groups. Exactly how far this VLCD is clinically practical in patients with normal lifestyle is to be explored. Hence a low-calorie diet of 1400 kcal/ day is easily feasible and achieves the needed in a sufficient period. There should be complete abstinence from alcoholic beverages. The dietary pattern should be spread over a five to six meal times and each meal should be taken slowly over some time but not in haste.18 &#xD;
&#xD;
&#xD;
&#xD;
The menu described is for complete restriction to VLCD so that the calorie intake is around 600 calories. Addition of intake in the number of dosa, idlis or chapathi can be done to increase the calorific value to 1500 calories. The value-added nutrition in the form of ragi biscuits, bitter gourd pakodas can be added to facilitate control of DM along with regression of NAFLD. The total calorie intake can be easily adjusted from the above described according to the needs of the patient. The diet will vary with patients&#x2019; age, sex, weight and physical activity. &#xD;
&#xD;
Conclusion &#xD;
&#xD;
In patients with combined DM and NAFLD, a strict but cautious calorie restriction with a 10 % weight reduction is more beneficial for the latter. Intake of whole grains, nuts and fibre rich food is good for both. Garlic with oligofructose, chicory, avocados and tofu are liver-friendly dishes. A well-planned dietary pattern with adequate nutritious energy-producing foods but with fewer calories are advised to contain the dreaded combination of two diseases. &#xD;
&#xD;
Acknowledgement: We acknowledge the help of Dr.S.Balachandar, JIPMER, Karaikkal for the critical help in the preparation of the manuscript&#xD;
&#xD;
Funding &#x2013; NIL &#xD;
&#xD;
Conflict of interest &#x2013; NIL for both authors &#xD;
&#xD;
MRS: Generation of the concept and collection of material &#xD;
&#xD;
SPS: Write-up and overall supervision &#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3444</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3444</Fulltext></URLs><References>1. Kaveeshwar SA, Cornwall J. The current state of diabetes mellitus in India. Aus Med J 2014;7(1):45-48. &#xD;
&#xD;
2. Loomba R, Abraham M, Unalp A, Wilson L, Lavine J, Doo E, et al. Nonalcoholic Steatohepatitis Clinical Research Network. Association between diabetes, family history of diabetes, and risk of nonalcoholic steatohepatitis and fibrosis. Hepatology 2012;56:943-951.&#xD;
&#xD;
3. Kim KS, Lee BW, Kim YJ, Lee DH, Cha BS, Park CY. Nonalcoholic Fatty Liver Disease and Diabetes: Part II: Treatment. Diabetes Metab J 2019;43(2):127-143.&#xD;
&#xD;
4. Xia MF, Bian H, Gao X. NAFLD and Diabetes: Two Sides of the Same Coin? The rationale for Gene-Based Personalized NAFLD Treatment. Front Pharmacol 2019;10:877. &#xD;
&#xD;
5. Arrese M. Nonalcoholic fatty liver disease: liver disease: an overlooked complication of diabetes mellitus. Nat Rev Endocrinol 2010;6(12):660&#x2013;661.&#xD;
&#xD;
6. Kargulewicz A, Stankowiak-Kulpa H, Grzymis?awski M. Dietary recommendations for patients with nonalcoholic fatty liver disease. Prz Gastroenterol 2014;9(1):18-23. &#xD;
&#xD;
7. Chiu S, Sievenpiper JL, de Souza RJ, Cozma AI, Mirrahimi A, Carleton AJ, et al. Effect of fructose on markers of non-alcoholic fatty liver disease (NAFLD): a systematic review and meta-analysis of controlled feeding trials. Eur J Clin Nutr 2014; 8(4):416-423.&#xD;
&#xD;
8. Nseir W, Hellou E, Assy N. Role of diet and lifestyle changes in nonalcoholic fatty liver disease. World J Gastroenterol 2014;20(28):9338-9344. &#xD;
&#xD;
9. Suchitra MR, Parthasarathy S. Sitaphal: Reemergence. Res J Pharm Biol Chem Sci 2015; 6(3):1560-1565.&#xD;
&#xD;
10. George ES, Forsyth A, Itsiopoulos C, Nicoll AJ, Ryan M, Sood S, et al. Practical Dietary Recommendations for the Prevention and Management of Nonalcoholic Fatty Liver Disease in Adults.&#xA0;Adv Nutr 2018;9(1):30&#x2013;40.&#xA0; &#xD;
&#xD;
11. Romero-G&#xF3;mez M, Zelber-Sagi S, Trenell M. Treatment of NAFLD with diet, physical activity and exercise. J Hepatol 2017;67(4):829&#x2013;846.&#xD;
&#xD;
12. Yamauchi R, Kobayashi M, Matsuda Y, Ojika M, Shigeoka YY, Tou Y, et al. Coffee and caffeine ameliorate hyperglycemia, fatty liver, and inflammatory adipocytokine expression in spontaneously diabetic KK-Ay mice. J Agric Food Chem 2010;58:5597-5603.&#xD;
&#xD;
13. Tendler D, Lin S, Yancy WS, Mavropoulos J, Sylvestre P, Rockey DC, et al. The effect of a low-carbohydrate, ketogenic diet on nonalcoholic fatty liver disease: a pilot study. Dig Dis Sci 2007; 52: 589-593.&#xD;
&#xD;
14. El Hadi H, Vettor R, Rossato M. Vitamin E as a Treatment for Nonalcoholic Fatty Liver Disease: Reality or Myth?. Antioxidants (Basel). 2018;7(1):12. &#xD;
&#xD;
15. Mirmiran P, Amirhamidi Z, Ejtahed HS, Bahadoran Z, Azizi F. Relationship between Diet and Non-alcoholic Fatty Liver Disease: A Review Article. Iran J Public Health 2017;46(8):1007&#x2013;1017.&#xD;
&#xD;
16. Suchitra MR, Parthasarathy S. Effect of administration of fenugreek seeds on HbA1C levels in uncontrolled diabetes mellitus &#x2013; a randomized controlled trial. Int J Pharm Tech Res 2015,8(2):180-182.&#xD;
&#xD;
17. Lin WY, Wu CH, Chu NF, Chang CJ. Efficacy and safety of very-low-calorie diet in Taiwanese: a multicenter randomized, controlled trial.&#xA0;Nutrition 2009;25(11-12):1129&#x2013;1136.&#xD;
&#xD;
18. Perdomo CM, Fr&#xFC;hbeck G, Escalada J. Impact of Nutritional Changes on Nonalcoholic Fatty Liver Disease. Nutrients 2019;11(3):677. &#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Imputation as a Technique for Enhancing the Quality of Medical Data&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>91</FirstPage><LastPage>95</LastPage><AuthorList><Author>Vinutha MR</Author><AuthorLanguage>English</AuthorLanguage><Author> Chandrika J</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: In the field of Medical data analysis Data Mining plays an influential role. We should be capable of extracting fruit-bearing information from wealthy medical data. Extraction of effective information from wealthy medical data and making the valuable decision for predicting the diseases increasingly becomes necessary. Missing data or incomplete data pose a great problem in analysis. There is a good number of traditional methods available for taking care of data cleaning. Objective: In this paper, we have attempted to throw light on various methods/tools existing for data cleaning. In our work we have imputed the missing values using different machine learning techniques and also have performed a comparative study of different machine learning techniques used. Methods: A total of five hundred records of liver cirrhosis patients is collected. Two tasks have been carried out here, one is imputing missing values and the other is finding classification accuracy. The data set with no missing values for the predictor variables are used to generate the regression equation. In Random forest multiple decision trees were built and then these trees are merged to get the more accurate and stable prediction. Results: We observed accuracy of class prediction before imputing the missing values and after imputing the missing value by using different algorithms. Conclusion: It is noticeable that the accuracy of class prediction is high when missing values are handled properly. Also, the efficiency of class prediction is very high when the random forest is used both for imputing the missing values as well as for predicting the class.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Decision Tree, K-NN Imputation, Linear Regression, Pre-Processing, Random Forest</Keywords><Fulltext>Introduction &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Medical diagnosis is extremely important which has to be carried out with a lot of care. Medical diagnosis should be performed conclusively. In the field of medicine, data mining is used to make prognosis, diagnosis and decision making. Predictions made should be Precise. Sometimes undesirable clinical decision risks the life of an individual. So there should be no compromise of the decision taken towards the health of the patient. For this one should have quality data. Any noisy, defective, inappropriate data may lead to defective results. Clinical data sets1 have constituted a unique challenge, especially for data mining algorithms. Some Medical data set has large dimensionality, data may be noisy, there may be multiple classes, multiple values, and irrelevant values may be because of human errors. Data preprocessing has to be carried out with utmost care and also data preprocessing is an important step in KDD process. One simple way of taking care of missing value is imputation. The most common imputation method is the mean imputation. However, data mining techniques can also be used for taking care of missing values in an appropriate manner. Different data mining techniques like association rules, clustering methods can be used to predict the missing value. Some of the other imputation methods are ANN imputation, K-NN imputation, Regression imputation, Mean Imputation, Hot Deck Imputation.&#xD;
&#xD;
Usha et al.1 Focus on handling data quality problems using data mining techniques. The common sources of errors are lexical errors, syntactical errors, irregularities, duplicates and data entry problems. Researchers proposed a new algorithm called HECT - Hybrid Error Correction Techniques which combines the concept of context-independent and context-dependent for data standardization and correction. In&#xA0; HECT researchers used the parameters such as occurrence relation, minimum support threshold, distance threshold, Levenshtein distance and modified Levenshtein distance.&#xD;
&#xD;
Swapna et al.2 Proposed an algorithm which constructs a decision tree for every attribute and missing values are to be replaced with the leaf node values. Decision trees consist of a set of nodes. Each node is a test for an attribute and the output is given as two branches from each node except for the leaf nodes. One branch will be associated with yes and the other branch with no. Researchers endorsed that they can have more quality data on which mining techniques can be applied for a quality analysis&#xD;
&#xD;
Multiple imputation approach was developed by Houari.3 This approach is based on sampling techniques to take care of missing values problems. Multiple imputation approach has two objectives. The first objective is to guess missing values, which is performed by using the most effective method. The second objective is to improve the efficiency of the data mining process. The method proposed by the researcher&#x2019;s works in 2 steps. The raw data sets are compared by taking into account heterogeneous data in the first step. Estimation of missing data is done in the second step and the outcome of the second step is the estimated value and this value is used to fill in the missing data.3&#xA0;&#xA0; &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Krishnamoorthy et al.4 Contemplated a new technique called Effective Data Cleaning -EDC. EDC aims to identify irrelevant instance and relevant instances from a very large data set. This identification is carried out through the degree of missing value. Then reconstruction of missing value is performed through its closest instance especially within the instance set. EDC comprises 2 methods. The first method carries out the task of identifying relevant instances (IRV). Missing values are reconstructed in the second method (RMV). The reconstruction of the missing value is based on the distance metric. &#xD;
&#xD;
Mohammed et al.5 Developed a system whose framework is based on ETL process - Extract, Transform and Load Processes. The data cleaning process is carried out by splitting into three smaller sub-processes. This process helps to reduce the complexity of data cleaning. Researchers urged that system developed by them is capable of detecting errors, perform data deletion and programmatically create a knowledge base for valid values and table merging functions.&#xD;
&#xD;
Kavitha Kumar et al.6 Applied Data Mining Techniques for cleaning the data set. Techniques such as Association Rule Mining used as context-dependent attribute correction and Clustering techniques used for context-independent attribute correction. The algorithms were applied to cardiology dataset. To generate the rules entire data set was used but to carry out the task of corrections of attributes only random samples were used. &#xD;
&#xD;
Vateekul et al.7 proposed an ITree or Imputation tree. First, a missing pattern tree is constructed, which is also a binary classification tree. Study of predictability of missingness is made. This is carried out by making all the observations. If there are any missing values in the terminal node or cluster then such missing values are estimated by a regression tree. Researchers stated that it is advantageous compared to numerous other imputation methods. The reason is ITree states that the missingness of a variable is influenced by the existence of other variables in the data set. It also gives the knowledge of missingness type by analyzing the data, rather than assuming. &#xD;
&#xD;
Kusumasariet et al.8 used Open Refine Tool. Various techniques were outlined by the researchers for profiling data. Data quality was assured through data profiling. The type of analysis for data profiling is data profile classification. Researchers carried out both multi-column analysis and single-column analysis. Single column analysis is carried out for checking data completeness. Single column analysis consists of checking for duplication of text, text pattern and null value. The multi-column analysis is been done using association rules and identifying correlation. The researchers have written the Metadata rules on metadata. Data profiling is performed using built-in features of Open Refine or custom regular expression or combination of both.&#xD;
&#xD;
Widera et al.9 presented a classification method that differentiates the issues of cleaning into two classes of problems. One class of problem is found during the process of cleaning of single data sources and another class of problem is with several data sources. Both classes of problems are then divided into schema level problems and instance-level problems. The single source instance-level problems may be missing values, misspelling, cryptic values, missed values, violated attribute dependencies. Multisource schema level problems are naming and structural conflicts. The prototype application has been implemented using Python programming language.&#xD;
&#xD;
Katherine et al.10 Proposed a framework called BIOAJAX. BIOAJAX uses principles of data cleaning to improve data quality. BIOAJAX is a data cleaning tool Kit for the biological information system. BIOAJAX is designed to enhance the quality of data at the schema level as well as at the data level. It adopts and modifies the conceptual operations. BIOAJAX was originally developed in the declarative framework AJAX.&#xD;
&#xD;
Wang et.al. 11 Used Gibbs sampling for refining missing values. It is useful in analysing stochastic systems. It uses multi-variant distribution for generating random numbers. To handle the missing values, simulation of data is achieved which is based on existing population information. Researchers stated that Gibbs sampling has better performance when large samples were taken. Missing values processing in Gibbs is good even though all the relevant data of related attributes are missing. When the Gibbs sampling is used it is assumed that the simulation data still comply with existing data&amp;#39;s statistical properties.&#xD;
&#xD;
After carrying out the extensive literature survey we have planned to make use of different machine learning techniques for imputing the missing values and to do the comparative study of different algorithms used. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xD;
&#xD;
Imputation&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Imputation &#xA0;is a process of filling the missing value with some valid related value and then carrying out the analysis as if there were no missing values.12 Numerous imputation methods are available.&#xA0;&#xA0; &#xD;
&#xD;
Mean Imputation&#xD;
&#xD;
Mean Imputation calculates the mean of the observed value of a particular feature. This value is used to fill in all the missing value. It is one of the simplest methods of all the imputation methods &#xD;
&#xD;
Cold deck Imputation&#xD;
&#xD;
A value is chosen systematically from an individual who has similar values on other variables.13 Random variation can be removed. &#xD;
&#xD;
Hot deck Imputation&#xD;
&#xD;
In this method, missing value is filled in with a value of an estimated distribution for the missing value from the current data. The implementation of the hot deck is a two-step process. Data is partitioned into different clusters in the first step. In the second step associate each record of missing data with one cluster. Then missing values are filled in with the complete cases in a cluster by calculating mode or mean of the attribute, especially within the cluster.&#xD;
&#xD;
Material and Methods&#xD;
&#xD;
Data Set: A total of five hundred records of liver cirrhosis patients is collected and that is taken for the study. Forty-one attributes are considered such as Duration of alcohol consumption, Quantity of alcohol consumption, Triglycerides(TG), High-Density Lipoprotein (HDL), Low-Density Lipoprotein (LDL), MCV, MCH, Polymorphs, Lymphocytes, Albumin, Globulin etc. Records with no missing values for any features is taken as a training data set and records with missing values or records for which the values have to be imputed are taken as testing data set. Two tasks have been carried out here, one is imputing missing values and the other is finding classification accuracy. We have used three different techniques for imputing the missing values and to find the efficiency of classification, they are decision tree, random forest and linear regression. &#xD;
&#xD;
Linear Regression Imputation: The data set with no missing values for the predictor variables are used to generate the regression equation. Then this equation is used for predicting the missing values. The relationship between the variables that have been used in the imputation model is conserved.&#xD;
&#xD;
Decision Tree: Decision tree classification technique14 is based on the concept of splitting basis. The decision tree is a flow chart like structure where the classification of records is carried out by sorting the instances based on the values of attributes. Each node represents&amp;#39; an attribute, all branches of an intermediate node represent an outcome of the test, each leaf node represents&amp;#39; the class label. Construction of Decision Tree is processed in a top-down approach and a greedy method.&#xA0; The process of constructing the tree starts with training set recursively finding a split feature by maximizing some local criterion. Methods like Gini Index, Information Gain Ratio etc. can be used for finding the feature which best splits the data. The data set is split into two subsets. Records having all the values are taken as one subset and the other subset has the records with the missing values. Then the decision tree is used for constructing the model. This model is used for imputing missing values.&#xA0; &#xD;
&#xD;
Random Forest: It is a&#xA0;supervised learning algorithm. In Random forest multiple decision trees are built and then these trees are merged to get the more accurate and stable prediction. Random Forest method take care of missing values in two ways they are: i) If there are missing values then such data points are dropped ii) If there are missing values and they are of numeric value type then those values are filled with mean value iii) If there are missing values and they are of categorical type then those values are filled with the mode value.&#xD;
&#xD;
Results&#xD;
&#xD;
The data pre-processing is the first step and it is one of the most important steps in KDD. The quality results are completely dependent on quality data. Many times, data that is collected is of not good quality. The data collected may be incomplete, inappropriate, noisy data and redundant. So the collected data has to be cleansed. In this work, we have implemented a decision tree algorithm, random forest algorithm and linear regression for imputing the missing values in the collected medical data set. A total of five hundred records of liver cirrhosis patients were taken. &#xD;
&#xD;
First case: We have used decision tree for imputing the missing values. After imputing the prediction of the missing value of classes are carried out by using three different algorithms and the corresponding accuracy of classification is expressed in the table1 and graph1.&#xD;
&#xD;
Second case: Random forest is used for imputing the missing values and class prediction is carried out by using three different methods and the corresponding accuracy of classification is exhibited in table 2 and graph 2.&#xD;
&#xD;
Third case: Linear Regression is used for imputing missing values and class prediction is accomplished by using three different methods and the corresponding accuracy of classification is plotted in table 3 and graph 3&#xD;
&#xD;
Table 4 and graph 4 shows the accuracy of class prediction before imputing the missing values and after imputing the missing value by using different algorithms.&#xD;
&#xD;
Discussion&#xD;
&#xD;
The outcome of the study is, from table 4 and graph 4 it is noticeable that the accuracy of class prediction is high when missing values are handled properly. Also, the efficiency of class prediction is very high when the random forest is used both for imputing the missing values as well as for predicting the class. It is evident from the above tables that when the data values are not imputed the accuracy is comparatively less.&#xD;
&#xD;
In this paper, an attempt is made to review the valuable work carried out by various researchers in imputing the missing values. We have summarized various approaches and tools used for cleansing the data. In this work, we have applied the Decision tree, Random forest, and Linear Regression algorithms for imputing the missing values. From the results shown in sec V, it is clear that the accuracy of predicting the diseases is completely dependent on the quality of the data collected. This study unfolds the importance of having good data. Disease prediction should be highly accurate. The incorrect prediction will have an unfavourable effect on patients. To achieve good accuracy of prediction it is very much important to have quality data. In our future work, we have planned to use the ensemble methods for imputing missing values on the large number of liver cirrhosis patient data set. &#xD;
&#xD;
Conclusion&#xD;
&#xD;
This work was focused on applying data mining techniques for imputing the missing values. In our work, we have used three different data mining techniques that is the random forest, decision tree and linear regression. For the liver data set that we have collected random forest performs considerably better than the decision tree and linear regression. However, still there is a scope for applying various other data mining techniques and do the comparative study and arrive at the best method for imputing the missing values.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3445</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3445</Fulltext></URLs><References>1. Usha T. Data Cleaning of Medical Datasets using Data Mining Techniques. Int J Adv Res Comput Comm Engg 2018;7(6):283. &#xD;
&#xD;
2. Swapna S, Niranjan P. Data Cleaning for data quality. IEEE International Conference on Engineering and Technology. 2016;3(1): 56. &#xD;
&#xD;
3. Rima H, Ahcene B. &#xA0;Handling Missing Data Problem with Sampling Methods, IEEE International Conference on Engineering and Technology, 2014.&#xD;
&#xD;
4. Krisgnamoorthy R, Sreedhar KR. &#xA0;A New Approach for Data Cleaning Process, IEEE International Conference on Engineering and Technology, 2014; 3(1): 123.&#xD;
&#xD;
5. Hasimah&#xA0; HM, Tee LK, Chee C.A Data Cleaning Framework for Patient Data. International Conference on Informationand Computer Intelligence. 2011;12(2):189.&#xD;
&#xD;
6. Kavitha Kumar R, Chandrashekaran RM. Attribute correction -Data Cleaning using Association Rule and Clustering Methods. Int J Data Mining &#xA0;Knowl Mgmt Process 2011;2(1):781.&#xD;
&#xD;
7. Peerapon V, Tree-based Approach to Missing Data Imputation, IEEE International Conference on Engineering and Technology 2009;2(3):834.&#xD;
&#xD;
8. Adam W, Michal W, Daniel F. Data Cleaning of medical data sets, J Med Informa Tech 2004;8(3):123.&#xD;
&#xD;
9. Tien FK, Fitria D. Data profiling for data quality Improvement with Open Refine, Int. conf.&#xA0; Info-Tech Sys. Inno, 2016; 4(5): 871.&#xD;
&#xD;
10. Herbert KG, Gehani NH, Piel WH, Wang JTL, Wu CH. BIO-AJAX: An Extensible Framework for Biological Data cleaning. ACM Sigmod 2004: 33(2): 51-57&#xD;
&#xD;
11. Wang Yi, Zhou Li. Processing of missing values using Gibbs Sampling. Third International Conference Measuring Tech Mech Auto 2011; 23(4):46-49&#xD;
&#xD;
12. Gustavo EP. Batista A, Maria CM. An Analysis of Four Missing Data Treatment Methods for Supervised Learning. Info Comm Embedd System 2007;4(2): 562.&#xD;
&#xD;
13.Sivagowry .S, Dr Durairaj.M and Persia.An et al. An Empirical Study on Applying Data Mining Techniques for the Analysis and Prediction of Heart Disease. International Conference on Information Communication Embedd System 2013;10(4):82-86.&#xD;
&#xD;
&#xA0;14. Han J, Kamber M, Pei J. Data Mining -concepts and Techniques, Third Edition. 2016;561.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Analysis of Kubernetes for Distributed Healthcare System Development using COVID-19 Healthcare App&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>96</FirstPage><LastPage>102</LastPage><AuthorList><Author>Prassanna J</Author><AuthorLanguage>English</AuthorLanguage><Author> Mohanty S</Author><AuthorLanguage>English</AuthorLanguage><Author> Jinturkar PS</Author><AuthorLanguage>English</AuthorLanguage><Author> Pandey P</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Distributed computing is a field of computer science which deals with the study of distributed systems A system which has communication and coordination with each of its nodes and which interacts with each other to achieve a common target which is to effectively compute the computation. These capabilities are conducive to implementing a systematic and efficient COVID-19 tracking application which can be accessed and worked on by numerous entities. Objective: To provide information about a client-server architecture which is a platform for managing and maintaining containerized workloads and services that forms a base for automation. Methods: A Kubernetes cluster IS created with a calico pod network along with the main drivers of Kubelet, Kubeadm and Kubectl. Secure Shell (SSH) protocol is used for secured shell and data management and authentication between the client and server. Results: We have performed and distributed our tasks in such a way to show the developers that multiple tasks can be performed at the same time using Kubernetes orchestration platform and used to parallelize multiple tasks. This increases the efficiency of the machine and the performance of the system becomes much faster. Conclusion: A system which has communication and coordination with each of its nodes and which interacts with each other to achieve a common target which is to effectively compute the computation. One such application which helps in the distribution of tasks and helps do the computation is Kubernetes. It is based on a client-server architecture which is a platform for managing and maintaining containerized workloads and services that forms a base for automation. Key Words: Kubernetes, Microservices, Docker, Kubeadm, Kubelet, Kubectl, COVID-19&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Kubernetes, Microservices, Docker, Kubeadm, Kubelet, Kubectl, COVID-19 Tracking</Keywords><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3446</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3446</Fulltext></URLs></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Diagnostic Role &amp; Accuracy of Intra-Operative Frozen Section in The Surgeries for Gastric and Gastro-Esophageal Malignancies&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>103</FirstPage><LastPage>108</LastPage><AuthorList><Author>Mohita Ray</Author><AuthorLanguage>English</AuthorLanguage><Author> Pranita Mohanty</Author><AuthorLanguage>English</AuthorLanguage><Author> Sunil Agarwal</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Frozen section (FS) is an important and rapid intra-operative tool to assess primary pathology/ malignancy, diagnose metastatic malignancy and to ensure negative resection margins during the respective surgeries for gastric and gastrooesophageal malignancies, which can subsequently impact patient prognosis and management. Objective: To assesses the accuracy, sensitivity and specificity of intraoperative FS consultation in surgeries for gastric and gastro-oesophageal malignancies, in correlation with the final histopathology. Methods: Over a period of 2 and &#xBD; years, the results of gastric cancer patients who had undergone intraoperative FS consultation, were prospectively analyzed in comparison with the corresponding histopathology. The overall accuracy, sensitivity and specificity were calculated for all the specimen, as well as for margins. The discordant cases were reviewed to analyze the cause of the error. Results: In total, 67 specimens were obtained from the 45 patients undergoing total and partial gastric resection surgery. The accuracy, sensitivity, and specificity of frozen-section assessments were 94.02%, 96% and 92.8% respectively for all the specimen. There were 4 discordant cases. The accuracy, sensitivity and specificity for margin assessment were 100%, 100% and 100% respectively. Conclusion: Intraoperative FS examination is a highly accurate method which can be utilized for achieving rapid intra-operative diagnosis and negative margins, which is very essential for complete tumour extirpation in gastric and gastro-oesophagal malignancies.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Frozen section, Histopathology, Discordance, Error</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Gastric cancer is the fourth most common cancer and the second leading cause of cancer death worldwidewith the only possible curative treatment being complete resection with negative surgical margins along with lymph node clearance.1,2 Tumour cells in gastric cancer can spread intra-murally beyond the lesion, which is not macroscopically visible or palpable intra-operatively. Hence the resection margins must be far from the tumour edge to avoid the involvement of the margins by the malignancy. The short distance between tumour mass and resection margins also increases the possibility of local recurrence hence it is important to have a wide tumour free clearance margin with complete tumour extirpation.3 Intra-operative consultation (IOC) by frozen section (FS) is frequently performed for assessment of surgical margins during surgeries for resection of gastro-oesophageal and gastric carcinoma to achieve tumour-free resection margins. The main purpose of the frozen section is to provide a rapid diagnosis to guide intra or perioperative patient management. Other than evaluation of margins, indications of the frozen section are the identification of tissue and detection of primary pathology/lesion, identification metastasis in lymph node/ detection of metastatic malignancy in a suspicious nodule identified during intra-operative inspection/palpation and confirmation of the presence of representative samples for paraffin section diagnosis.&#xD;
&#xD;
The purpose of this study is to analyze the accuracy of IOC by FS during surgeries of gastric and gastro-oesophageal malignancies and to review the causes of error.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
The present study was a prospective analysis is done in the department of pathology of a tertiary care hospital throughout 2 and &#xBD; years during which all the intra-operative FS performed for patients undergoing resection surgery for gastro-oesophageal and gastric malignancy were analyzed. Fresh intra-operative tissue samples were included from general surgery and other surgical super-specialities like on-surgery and gastro-surgery. Patients undergoing gastric surgeries for non-neoplastic conditions were excluded from the study. Samples from operation theatre were transported immediately within a gauge piece soaked in normal saline to the laboratory. The request slip was verified for patient identification, clinic-radiological details and previous biopsy report if any. Tissue was examined and gross findings noted following which embedding, freezing and sectioning was done. Wet tissue was blotted with a paper towel to reduce freezing artefacts. Blocks were sectioned on LEICA CM1860 cryostat. The slides were stained with haematoxylin and eosin (H and E) stain and studied. In cases of positive margins, results were immediately informed to the surgeon over the phone and revised margins were sent till the final negative margin was achieved. The turn around time was noted per specimen. Tissue remainder were then fixed in 10% formalin solution and sent for histopathological examination after making paraffin embed sections and H and E Stain. IOC was done with 3 indications, i.e., 1. Margin assessment 2.Diagnosis of primary pathology/lesion 3.Evaluation of metastasis in lymph node/ suspicious nodule. Other than evaluation of margins during total/partial gastrectomy for gastric malignancy, diagnostic FS was also performed if the malignant diagnosis was suspected on clinical grounds, but biopsy results were negative. Such negative results included gastric ulcers macroscopically and clinically suggestive of malignancy, perforation in suspected malignancies requiring emergency intervention, or high-grade dysplasia/intramucosal carcinoma.&#xD;
&#xD;
The IOC results were compared with reports on their respective formalin-fixed, paraffin-embedded sections. The accuracy rate, sensitivity and specificity of the FS report for gastric surgeries were determined, comparing with the gold standard histopathology. Any discrepancy was noted and all cases with discordant diagnoses were reviewed for the cause of the error. The &#x2018;reasons for discordance&#x2019; were categorized into three categories, i.e. 1-Interpretative errors, 2-sampling errors and 3- technical errors, after re-examination of all the slides with discordant diagnoses. Sampling errors included both gross and microscopic error. Gross sampling error occurred when the diagnostic material is not present in the FS sample, but tissue sent for histopathology other than frozen section, contained the diagnostic material or vice versa. Microscopic sampling error occurred when the diagnostic tissue was not seen on the frozen section itself (i.e. the block was not sectioned deep enough during intra-operative consultation) but subsequent deeper sections on the paraffin block of the same tissue showed the presence of diagnostic material. The reverse is also true, sometimes frozen section contains the pathologic lesion that was exhausted during intra-operative consultation hence not identified in the tissue submitted for permanent section. Surgical sampling error - Tissue not given from the representative site of the lesion. Technical errors &#x2013; includes; suboptimal quality of the frozen section slide like tissue folding, improper freezing and staining.&#xD;
&#xD;
Types of error in correlation- As described by the ADASP, the types of error in co-relation leading to a change in the final report were categorized under the following headings: 1. Change in the category, (i.e., from benign to malignant or vice versa) leading to false-positive or false-negative; 2.Change within the same category (e.g., the histological variant of malignancy); 3.Change in the status of the resection margin (i.e., false-positive or false-negative for malignancy); and 4.Change in lymph node status (i.e., false-positive or false-negative for malignancy).4&#xD;
&#xD;
The study design was approved by the Research Ethics Committee of IMS and SUM Hospital, Bhubaneswar.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
Over 2 and 1/2 years, intra-operative FS consultation was done in 45 cases of gastric surgery, which yielded 67 FS specimen for evaluation. Most of the patients were male (80%) and the mean age of presentation was 48.68. Of these, 24 cases (24 specimens) were sent with an indication of establishment/confirmation of primary pathology/malignancy, 12 cases (35 specimens) for assessment of margin status and 8 cases (8 specimens) were sent for assessment of metastatic malignancy in lymph node/suspicious nodule. 24 FS specimen were sent for establishment/ confirmation of malignancy, 12 of which presented clinically with gastric ulcers highly suspicious of malignancy, but negative for malignancy on biopsy, 4 cases presented with perforation, 5 cases with high-grade dysplasia and 3 cases with carcinoma-in-situ on biopsy. Of these 24, 14 were given the diagnosis of positive for malignancy in the final histopathology. Adenocarcinoma was the most common malignant diagnosis (13), of which 4 cases showed signet ring cell morphology and rest 9 were intestinal-type adenocarcinoma. Of the 8 cases sent for assessment of metastatic malignancy, 3 were from peri-gastric lymph nodes, 3 were suspicious omental nodules, 1 omental lymph node and 1 from liver deposits, all of which showed the presence of metastatic adenocarcinomatous deposits on FS, which was later confirmed on histopathology of the remainder tissue (Table 1).&#xD;
&#xD;
There were total 4 discordant diagnoses of which 2 were false positive (FP) and 2 were false negative (FN). Reason for discordance was misinterpretation in 2 cases sent for diagnostic frozen section and sampling error in 2 cases for margin evaluation. On review of the cases with interpretative error, we saw a case of Gastro-esophageal junction Carcinoid tumour was diagnosed as false negative on FS due to misinterpretation of tumour cells as normal lymphocytes of chronic inflammation. (Figure 1A) Subsequent paraffin sections showed a monotonous population of small round cells arranged in solid, insular and glandular pattern with finely granular cytoplasm, small nucleoli, salt and pepper chromatin.(Figure 1B, 1C) On subsequent IHC positivity of NSE in tumor cells, final histopathology impression of Carcinoid tumour was given. (Figure1D) In another discordant case due to interpretative error, review of a Gastric antral growth diagnosed as Adenocarcinoma on frozen section, permanent sections showed a diffuse infiltrate comprised of atypical lymphoid cells, and a final histopathological diagnosis of Non- Hodgkin&#x2019;s Lymphoma, B-cell type was confirmed after immunohistochemical positivity with LCA and CD20. The misinterpretation was due to freezing artifacts imparting the neoplastic lymphoid cells a fragile neoplastic epithelial morphology leading to a change in category. In both the cases with false-positive results, the reason for discordance was due to microscopic sampling error wherein the diagnostic material was exhausted during the intra-operative consultation, hence deeper sections of the block sent for histopathology did not show the tumour. Amongst the concordant cases, there was a case of gastric antral growth reported as adenocarcinoma on FS (Figure 2A). Subsequent paraffin sections showed neoplastic cells with moderate to marked nuclear pleomorphism arranged diffusely giving a concordant diagnosis of adenocarcinoma of the stomach (Figure 2B). IOC was done during a gastrectomy surgery for carcinoma stomach, wherein an omental lymph node was sent to diagnose for the presence of metastatic deposits. FS showed scattered neoplastic cells amidst lymphoid cells exhibiting moderate nuclear pleomorphism. An FS diagnosis of positive for malignancy was given (Figure 2C, 2D) which was subsequently confirm to be metastatic adenocarcinomatous deposits on histopathology (Figure 2E, 2F)&#xD;
&#xD;
Of the 67 specimens submitted, FS diagnosis was concordant with histopathology in 63 specimens and discordant in 4 specimens. In comparison with the permanent sections (PS), there were 24 true positives (TP), 39 true negatives (TN), 2 false positives (FP) and 2 false negatives (FN) diagnoses. (Table 1) The overall accuracy of 94.02% (95% CI: 85.4, 98.3). The sensitivity and specificity of intraoperative FS in gastric surgeries were found to be 96% (95% CI: 79.6, 99.9) and 92.8% (95% CI: 80.5, 98.5) respectively. The positive predictive value and negative predictive value for FS in detecting stomach pathologies were found to be 88.9% (95% CI: 72.8, 95.9) and 97.5% (85, 99.6) respectively (Table 2). The positive likelihood ratio and negative likelihood ratio of FS were found to be 13.44 and 0.04 respectively. Hence the FS had a weak LR+ and LR- values for the specimen from Gastric surgeries. &#xD;
&#xD;
In the total of 13 cases, IOC was done for margin assessment, which yielded 35 specimens for evaluation. Of these, 17 were gastric margins, 13 were oesophagal margins and 5 were small bowel margins. Of these 6 margins (17%) showed the presence of tumour tissue, which was reported as Margin positive for malignancy in the FS report. In all the cases with positive margins, revised margins were sent till the final negative margin was achieved. The overall accuracy of FS for margin assessment in gastric surgeries was 100%. The sensitivity and specificity of FS in margin assessment was found to be 100% (95% CI: 54.1, 100) and 100% (95% CI: 88.1, 100) respectively. Receiver operating curve (ROC) area was found to be 1 (95% CI: 0.67, 0.75) thus justifying that FS can be used to detect margins against the gold standard for samples collected for margin assessment during Gastric surgeries. The positive predictive value and negative predictive value for FS were the same as sensitivity and specificity.&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
The purpose of FS on surgical margins, unknown lesions and lymph nodes/nodules is to assure complete tumour extirpation. Our study found that the overall accuracy of FS during gastric surgeries was 94.02%, sensitivity was and specificity was which is comparable with previously reported data in the literature. The overall discordance rate in this study was 5.98% (2.99% FN and 2.99% FP results). &#xD;
&#xD;
McAuliffe et al reported overall specificity of 99.8%, the sensitivity of 77.0%, the positive predictive value of 96.3%, the negative predictive value of 98.2% for the IOC on surgical margins. They reported an overall diagnostic accuracy of 98.1% for all IOC of gastric and gastro-oesophageal surgeries, which is comparable to our study. They also found that signet ring cell and diffuse-type final diagnoses had higher rates of FN results.5 Spicer et al. reported their experience with IOC during margin assessment of gastro-oesophageal and gastric adenocarcinoma surgeries and shed light the diagnostic difficulty posed in signet ring cell disease.13-15 Of the 6 cases with FN IOC results, 5 were signet ring disease.6 Challenges in the FS examination of gastrointestinal poorly cohesive and signet ring cell carcinomas have also been discussed by Zhu et al.7 In our study, the challenges were sampling errors leading to false-positive diagnoses and misinterpretation due freezing artifacts leading to bloated cell morphology. Squires et al noted 13% of positive proximal margins, Celli et al. reported 21% positive margins and Berlth et al. reported 1% margin positivity, as compared to 17% positive margins seen in our study.8,16,17 The CAP has established benchmarks for anatomical pathologic error based on large studies.9-12 that evaluated the discordance rate of FS consultation in comparison with final pathologic diagnoses. In IOCs performed for margin assessment, the discordance rate was 0.00%, which was within the CAP benchmarks (discordance rate of approximately 2.0% for neoplastic cases, based on the studies).10-12 Accuracy of FS in margin assessment in our study was 100%, which is in line with the findings of other authors (Table 2).&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Tumour infiltration at resection lines (positive resection margins) can have an adverse prognostic factor with increased chances of tumour recurrence. Hence negative resection margins and complete tumour extirpation are of utmost importance in the curative resection for gastric malignancies. FS, though it provides rapid intra-operative diagnosis, which can help the surgeon in rapid intra-operative decision-making, this technique has its limitations. As has been the experience at our institute, despite the challenges in sampling and difficulties in interpretations due to technical errors, the results of FS for gastro-oesophageal and gastric malignancies are accurate, especially for margin assessment and comparable to the results of other studies in the literature. With effective communication and correlation of relevant clinic-radiological and other investigational data between the operating surgeon and the pathologist, the error rates can be minimized. The results of this study may shed light on the importance of FS at the time of resection of the gastro-oesophagal junction and gastric malignancies, which acts as a guiding hand for the operating surgeon to decide the appropriate course of management for the patient intra- and peri-operatively.&#xD;
&#xD;
Conflict of interest &#x2013; Nil.&#xD;
&#xD;
Financial support - Nil.&#xD;
&#xD;
Authors&#x2019; Contribution: &#xD;
&#xD;
MR-manuscript writing, editing, literature search, drafting and data acquisition. &#xD;
&#xD;
PM- concept, design, manuscript editing.&#xD;
&#xD;
SA- clinical studies, data acquisition.&#xD;
&#xD;
ACKNOWLEDGMENT&#xD;
&#xD;
The author acknowledges the help received from Professor and Head, Department of for her guidance. I am also thankful to my Guide for her kind co-operation and meticulous supervision of the work. I would like to give my special thanks to all the technicians of Histopathology and cytology Section, for helping me while conducting the present study. The author is also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed, discussed and cited.&#xD;
&#xD;
ABBREVIATIONS&#xD;
&#xD;
FS- Frozen section&#xD;
&#xD;
PS- Permanent section&#xD;
&#xD;
IOC- Intra-operative consultation&#xD;
&#xD;
H and E- Hematoxylin and eosin.&#xD;
&#xD;
FP- False positive&#xD;
&#xD;
TP- True positive&#xD;
&#xD;
FN False negative&#xD;
&#xD;
TN- True negative&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Figure 1. A. FS from GEJ growth reported as negative for Malignancy in Frozen section (FS, H and E, 100x). B. Subsequent PS of the same case showing the presence of Carcinoid tumour (PS, H and E, 100x). C. Other areas of PS of the same case showing the presence of Carcinoid tumour (PS, H and E, 400x). D. Final HP Impression- Carcinoid tumour, GEJ, confirmed by NSE Positivity (PS, NSE, 400x).&#xD;
&#xD;
&#xD;
&#xD;
Figure 2: A. FS from a gastric antral growth Reported as Adenocarcinoma, Stomach (FS, H and E, x400). B. Subsequent PS given final histopathological diagnosis of Adenocarcinoma, Stomach (PS, H and E, &#xA0;x400). C. FS of an Omental Lymph node,given diagnosis of Metastatic adenocarcinomatous&#xA0; deposits on FS(FS, H and E, &#xA0;x100). D. Higher power view of the same field showing presence of tumor cells scattered singly and in small clusters (arrow) amidst lymphoid cells (FS, H and E, x400) E. PS of the same node showing the presence of tumour tissue(arrow) amidst the lymphoid cells(PS, H and E, &#xA0;x100). F. Higher power view of the same field showing the presence of scattered tumour cells (arrow) rendering a final histopathological diagnosis of Metastatic Adenocarcinomatous deposits, Omental Lymph node. (PS, H and E, x400).&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3447</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3447</Fulltext></URLs><References>&#xD;
	&#xD;
	Crew KD, Neugut AI. Epidemiology of gastric cancer. World journal of gastroenterology: World J Gastroenterol 2006;12(3):354.&#xD;
	&#xD;
	&#xD;
	Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA:Can J Clin 2011;61(2): 69-90.&#xD;
	&#xD;
	&#xD;
	Shin D, Park SS. Clinical importance and surgical decision-making regarding the proximal resection margin for gastric cancer. World J Gastroenterol Onco 2013;5(1):4.&#xD;
	&#xD;
	&#xD;
	Association of Directors of Anatomic and Surgical Pathology. Recommendations for quality assurance and improvement in surgical and autopsy pathology. Human Pathology 2006;37(8):985-988.&#xD;
	&#xD;
	&#xD;
	McAuliffe JC, Tang LH, Kamrani K, Olino K, Klimstra DS, Brennan MF, et al. Prevalence of false-negative results of intraoperative consultation on surgical margins during resection of gastric and gastroesophageal adenocarcinoma. JAMA Surg 2019;154(2):126-132.&#xD;
	&#xD;
	&#xD;
	Spicer J, Benay C, Lee L, Rousseau M, Andalib A, Kushner Y, et al. Diagnostic accuracy and utility of intraoperative microscopic margin analysis of gastric and oesophagal adenocarcinoma. Anna Surg Oncol 2014;21(8):2580-2586.&#xD;
	&#xD;
	&#xD;
	Zhu X, Bledsoe JR. Frozen section diagnosis of gastrointestinal poorly cohesive and signet-ring cell adenocarcinoma: useful morphologic features to avoid misdiagnosis. Virchows Arch 2020;34:1-10.&#xD;
	&#xD;
	&#xD;
	Squires MH, Kooby DA, Pawlik TM, Weber SM, Poultsides G, Schmidt C, et al. The utility of the proximal margin frozen section for resection of gastric adenocarcinoma: a 7-Institution Study of the US Gastric Cancer Collaborative. Ann Surg Oncol 2014;21(13):4202-4210.&#xD;
	&#xD;
	&#xD;
	Nakhleh RE, Nos&#xE9; V, Colasacco C, Fatheree LA, Lillemoe TJ, McCrory DC, et al. Interpretive diagnostic error reduction in surgical pathology and cytology: a guideline from the College of American Pathologists Pathology and Laboratory Quality Center and the Association of Directors of Anatomic and Surgical Pathology. Arch Pathol Lab Med 2016;140(1):29-40.&#xD;
	&#xD;
	&#xD;
	Gephardt GN, Zarbo RJ. Interinstitutional comparison of frozen section consultations: a College of American Pathologists Q-Probes study of 90 538 cases in 461 institutions. Arch Patho Labo Med 1996;120(9):804.&#xD;
	&#xD;
	&#xD;
	Novis DA, Gephardt GN, Zarbo RJ, College of American Pathologists. Interinstitutional comparison of frozen section consultation in small hospitals: a College of American Pathologists Q-Probes study of 18,532 frozen section consultation diagnoses in 233 small hospitals. Arch Pathol Lab Med 1996;120(12):1087-1093.&#xD;
	&#xD;
	&#xD;
	Raab SS, Tworek JA, Souers R, Zarbo RJ. The value of monitoring frozen section&#x2013;permanent section correlation data over time. Archi Pathol Labo Med 2006; 130(3):337-342.&#xD;
	&#xD;
	&#xD;
	Chatelain D, Shildknecht H, Trouillet N, Brasseur E, Darrac I, Regimbeau JM. Intraoperative consultation in digestive surgery. A consecutive series of 800 frozen sections. J Visce Surg 2012;149(2):e134-142.&#xD;
	&#xD;
	&#xD;
	Shen JG, Cheong JH, Hyung WJ, Kim J, Choi SH, Noh SH. Intraoperative frozen section margin evaluation in gastric cancer of the cardia surgery. Hepato-Gastroenterology 2006;53(72):976-978.&#xD;
	&#xD;
	&#xD;
	Nakanishi K, Morita S, Taniguchi H, Otsuki S, Fukagawa T, Katai H. Diagnostic accuracy and usefulness of intraoperative margin assessment by frozen section in gastric cancer. Annl Surg Oncol 2019;26(6):1787-1794.&#xD;
	&#xD;
	&#xD;
	Celli R, Barbieri AL, Colunga M, Sinard J, Gibson JA. Optimal intraoperative assessment of gastric margins. Am J Clin Pathol 2018;150(4):353-363.&#xD;
	&#xD;
	&#xD;
	Berlth F, Kim WH, Choi JH, Park SH, Kong SH, Lee HJ, et al. Prognostic Impact of Frozen Section Investigation and Extent of Proximal Safety Margin in Gastric Cancer Resection. Ann Surg 2020;272(5):871-878.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Dynamics of Infectivity and Fatality of COVID-19 Pandemic&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>109</FirstPage><LastPage>114</LastPage><AuthorList><Author>Abdur Rashid Ahmed</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: There is much debate about the growing incidence and fatality of COVID-19 in the entire globe that whether this incidence and fatality of the pandemic are really and statistically varying among the countries particularly with different health status and economic development. Objective: Based on the above research problem, the paper investigates the variations in average death, infection rate, fatality rate and mortality rate and looks into the statistical significance of their growth trends among different group of countries. Methods: The data on total confirmed cased and the total number of death for 178 countries used in this research has been collected from the World Health Organization (WHO) Coronavirus Disease (COVID-19) Dashboard. The paper explains the current status estimating of average death, incidence rate, fatality rate and mortality rate. Moreover, the paper also investigates the statistical significance of average death, incidence rate, fatality rate and mortality rate applying compound monthly growth rate and one-way ANOVA. Results: The paper reveals that average death and infection rate of COVID-19 in all countries are increasing irrespective of economic and other categories. However, the fatality rate is found to be very low in relatively low level-income countries as well as low human developed countries. Moreover, one-way ANOVA results also show that infection and mortality rates are significantly very high among high-income countries and high Human Development Index (HDI) level countries. But fatality rate which is significantly high among low-income countries and very low among Global Health Security (GHS) least-prepared countries. Conclusion: The average death and infection rate of COVID-19 in all countries are increasing irrespective of economic and other categories but the fatality rate is found to be very low in relatively low level-income as well as low HDI level countries.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> COVID-19, Fatality rate, Mortality rate, Compound monthly growth rate</Keywords><Fulltext>Introduction&#xD;
&#xD;
The unexpected emergence and expansion of SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus-2) have changed much of the present world in the beginning few months of the year 2020. This is an unprecedented pandemic the world has ever faced when no country across the globe remained unaffected by the disease. SARS-CoV-2 or simply known as COVID-19 is a viral and infectious disease which is newly discovered in China (Wuhan city) in December of 2019. The Government of China officially reported it to WHO on December 31, 2019. Later, the WHO declared the COVID-19 outbreak is a global health emergency on January 30, 2020, and subsequently it was declared as a global pandemic on March 11, 2020. After the H1N1 influenza pandemic of 2019, COVID-19 has been given such tag by WHO. According to WHO, there have been 22,256,219 confirmed cases of COVID-19 including 782,456 deaths (fatality rate of 3.5%) reported as of 20 August 2020 globally.1 Hence, COVID-19 has become a greater threat to the existence of entire humanity and posed a major cause of ongoing economic depression across the globe. However, the major brunt of the pandemic will be borne by the poor countries like sub-Saharan African countries where the medical facilities are not easily available for the poor people and these lower-income or lower-middle-income countries neither have many resources nor have the scientific capacity to contain the spread of COVID-19.2&#xD;
&#xD;
According to WHO, most of the COVID-19 infected patients will experience mild to moderate respiratory illness and recover without requiring special treatment. But COVID-19 can be manifested fatal with the presence of co-morbidities and higher risk for aged people or older section of population those with underlying medical problems like cardiovascular disease, diabetes, chronic respiratory disease, and cancer are more likely to develop serious illness.3 Currently, there are no proven treatments for COVID-19. However, the whole scientific community especially virologists are busy with many clinical trials and researches evaluating potential treatments of the pandemic. A slew of such studies already has shared the facts and findings of their ongoing researches and clinical trials. Within such a short period, scientists and researchers have found several facts and findings of the emergence and pathogenicity of COVID-19. According to WHO, the COVID-19 virus spreads primarily through tiny droplets and aerosols from the nose when an infected and inattentive person coughs or sneezes.4 The spread of this zoonotic disease can be reduced on certain weather conditions like high temperature and humidity which may help to contain the spread of COVID-19 some countries with these weather conditions.5 The select preliminary studies while attempting to estimate the pattern of the spread of COVID-19 finds that this virus replicates very fast as like the SARS-CoV-1 (Severe Acute Respiratory Syndrome Coronavirus-1) and the Middle East Respiratory Syndrome corona&#xAD;virus (MERS-CoV).6&#xD;
&#xD;
However, there is a much debate about the growing incidence and fatality of COVID-19 in the entire globe that whether this incidence and fatality of the pandemic are significantly varying among the countries particularly with different health status and economic development. Seeking the answer to this question, the paper investigates the variations in average death, infection rate, fatality rate and mortality rate of 178 countries.&#xD;
&#xD;
Materials and Methods&#xD;
&#xD;
Data and Sources&#xD;
&#xD;
The data on total confirmed cased and the total number of death for 178 countries used in this research has been collected from the WHO Coronavirus Disease (COVID-19) Dashboard.7 However, the various country classifications of these countries have been carried out based on WHO region, Income classification, HDI classification and GHS classification provided by WHO, World Bank, United Nations Development Program, and Global Health Security Index respectively. The Global Health Security (GHS) Index is a comprehensive assessment of health security and related capabilities and it is a jointly developed by the Nuclear Threat Initiative (NTI) and the Johns Hopkins Center for Health Security (JHU)&#xA0;with the help of the Economist Intelligence Unit (EIU).&#xD;
&#xD;
Statistical Tools&#xD;
&#xD;
To analyze the data, I have used simple statistical tools like infection rate, fatality rate, mortality rate, compound monthly growth rate and ANOVA (Analysis of Variance).8 Infection, fatality and mortality rates indicate total confirmed cases per million populations, total deaths per million confirmed cases and total deaths per million populations respectively calculated using the following formulas.&#xD;
&#xD;
&#xD;
&#xD;
Also, ANOVA (Analysis of Variance) has been applied to test variation of the infection rate, fatality rate, mortality rate among the various country groups.&#xD;
&#xD;
Results and Discussion&#xD;
&#xD;
Spread and Status&#xD;
&#xD;
The spreading out of COVID-19 and current status of the pandemic has been discussed with the help of an average number of death, infection rate (number of confirmed cases per million populations), fatality rate (number of deaths per million confirmed cases) and mortality rate (number of deaths per million populations) as defined in the methodology.9&#xD;
&#xD;
Table-1 displays the average death, infection, fatality and mortality rates of COVID-19 pandemic in different geographical regions.10 This table shows that infection rate and mortality rate are highest in South American countries whereas the fatality rate is very high in European countries. In contrast, more specifically as per World Bank classification, East and South Asian countries show having very less infection, fatality and mortality rates compared to European and North American countries.&#xD;
&#xD;
Table 1: Infection, Fatality and Mortality rates of COVID-19 by Geographical Regions&#xD;
&#xD;
&#xD;
&#xD;
However, Table-2 exhibits the infection, fatality and mortality rates of COVID-19 among countries with different level of economic development. The table demonstrates that infection, fatality and mortality rates are significantly very lofty among high and upper-middle-income countries (i.e. countries with GNI per capita greater than US$3996) whereas low-income countries (i.e. countries with GNI per capita less than US$1026) register low infection and mortality. Moreover, classification by HDI (Human Development Index) shows that countries with very high and high human development are having the soaring infection, fatality and mortality rates.11 Similarly, the countries with high Global Health Security Index (GSHI) grouped as most prepared countries (i.e. countries with overall GHS Index of 66 or greater out of 100) are also register high infection, fatality and mortality rates compared to more and least prepared countries.&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Growth of infection and fatality&#xD;
&#xD;
The current status discussed in the above tables is silence about the trend of the COVID-19 i.e. whether it is growing or shrinking in the different regions. Hence, to capture the aspects I have applied compound monthly growth rate (using a similar method of calculating compound annual growth rate, CAGR). The compound monthly growth rate (CMGR), estimated for February-July of 2020, will help us to track the growth of COVID-19 pandemic in terms the average number of death, infection rate, fatality rate and mortality rates among the countries with different level of health-related and economic development has been shown in the following table and panels.12,13&#xD;
&#xD;
Table-3 displays that average death and infection rate of COVID-19 in all continents are increasing at an alarming rate but unlike in other continents, the fatality rate in Asia and Africa registers a decreasing trend. In a similar vein, average death and infection rate of COVID-19 in all countries irrespective of economic and other categories are increasing whereas the fatality rate in relatively low-level income countries (lower-middle and low-income countries) and or low human development countries, it is declining. Moreover, the least prepared countries in GHS index also shows declining fatality rate.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Results of one-way ANOVA&#xD;
&#xD;
But the variations of the numbers observed in the above tables may be random and we can&#x2019;t say with certainty and conviction that the variations are statistically significant in terms of infection, fatality and mortality rates among the countries/regions or countries with different level of economic development without formal confirmation with statistical analysis.&#xD;
&#xD;
&#xD;
&#xD;
Hence, several one-way ANOVA taking infection rate, fatality rate and mortality rate as the dependent variable to test them among different continents, income group, HDI group and GHS index group as independent variables (as shown in Table-4). The results show that infection and mortality rates are significantly very high among countries with high-income as well as with high HDI level. But the fatality rate is significantly high among low-income countries (see Table-2). Besides, the fatality rate is also significantly low among the least-prepared countries as classified by the GHS index.14&#xD;
&#xD;
Conclusion&#xD;
&#xD;
The paper investigates that whether the incidence, fatality and mortality of COVID-19 pandemic are really and statistically varying among the countries particularly with different health status and economic development. The paper reveals that the variations in average death, infection rate, fatality rate and mortality rate irrespective of economic and other categories are increasing significantly. The results also corroborated by the one-way ANOVA analysis which reconfirms that infection and mortality rates are significantly very high among high-income and high HDI level countries. But, the results also show that the fatality rate is significantly low-income countries as well as among the GHS least-prepared countries. However, a host of scientists working on various preventive measures to reduce the fatality rate of COVID-19. But the potential gains from these upcoming preventive strategies should incorporate the necessary precautions of economic and health consequences of that future preventive measures.15&#xD;
&#xD;
Author Contributions: All works regarding conceptualization, development of methodology, original draft preparation, review and editing etc. all carried out by the author.&#xD;
&#xD;
Acknowledgement: Authors acknowledge the immense help received from the scholars whose articles are cited and included in references to this manuscript. The authors are also grateful to authors/editors/publishers of all those ar&#xAD;ticles, journals and books from where the literature for this article has been reviewed and discussed. &#xD;
&#xD;
Conflict of Interest: Nil &#xD;
&#xD;
Source of Funding: Nil&#xD;
&#xD;
Ethical Approval: Not Applicable&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3448</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3448</Fulltext></URLs><References>&#xD;
	&#xD;
	WHO. Coronavirus disease 2019 (COVID-19) Situation Report&#x2013;46. 2020 [Available at: https://www.who.int/emergencies/diseases/novel-coronavirus-2019/situation-reports].&#xD;
	&#xD;
	&#xD;
	Alimoglu O, Kilic F, Erol CI, Eren T. What the COVID-19 pandemic means for sub-Saharan African countries.&#xA0;Int J Human Health Sci 2020;5(1):127-128.&#xD;
	&#xD;
	&#xD;
	Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020;395(10223).&#xD;
	&#xD;
	&#xD;
	WHO. Global surveillance for COVID-19 caused by human infection with COVID-19 virus. 2020. Available at [https://www.who.int/publications/i/item/global-surveillance-for-covid-19-caused-by-human-infectionwith-covid-19-virus-interim-guidance]&#xD;
	&#xD;
	&#xD;
	Colapkulu N, Simsek FI, Leblebici IM, Alimoglu O. Covid-19 pandemic and weather conditions: Can temperature curb the spread?&#xA0;Int J Human Health Sci 2020;5(2):264-266.&#xD;
	&#xD;
	&#xD;
	Jie S, Logeswaran R. Estination of the Basic Reproduction Rate (R0) of the Novel Coronavirus (COVID-19). Int J Curr Res Rev 2020;12(20):81-86.&#xD;
	&#xD;
	&#xD;
	WHO. Coronavirus Disease (COVID-19) Dashboard. August 2020, Available at [https://covid19.who.int/]&#xD;
	&#xD;
	&#xD;
	Ghani AC, Donnelly CA, Cox DR, Griffin JT, Fraser C, Lam TH, et al. Methods for estimating the case fatality ratio for a novel, emerging infectious disease. Am J Epidemiol 2005;162:479-486.&#xD;
	&#xD;
	&#xD;
	Angelopoulos A, Pathak R, Varma R, Jordan MI. Identifying and Correcting Bias from Time- and Severity- Dependent Reporting Rates in the Estimation of the COVID-19 Case Fatality Rate. Harvard Data Sci Rev 2020. https://doi.org/10.1162/99608f92.f01ee285&#xD;
	&#xD;
	&#xD;
	Public Health Agency of Sweden. The infection fatality rate of COVID-19 in Stockholm-Technical report. 2020, Available at https://www.folkhalsomyndigheten.se/contentassets/53c0dc391be54f5d959ead9131edb771/infection-fatality-rate-covid19-stockholm-technical-report.pdf]&#xD;
	&#xD;
	&#xD;
	UNDP. Human Development Report: Overcoming Barriers: Human Mobility and Development. 2009. Available at http://hdr.undp.org/en/reports/global/hdr2009/]&#xD;
	&#xD;
	&#xD;
	Sharma A, Tiwari S, Deb MK, Marty JL. Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2): a global pandemic and treatment strategies, Int J Antimicrob Agents 2020;56(2):106054. &#xD;
	&#xD;
	&#xD;
	Zhou F, Yu T, Du R. Clinical course and risk factors for mortality of adult inpatients with COVID?19 in Wuhan, China: A Retrospective Cohort Study. The Lancet. 2020; 395 (10229):1054?1062. &#xD;
	&#xD;
	&#xD;
	Pan D, Sze S, Minhas JS, Bangash MN, Pareek N, Divall P, et al. The impact of ethnicity on clinical outcomes in COVID-19: A systematic review. E Clinical Medicine. 2020;23:100404. &#xD;
	&#xD;
	&#xD;
	Godman, Brian. Combating COVID-19: Lessons learnt particularly among developing countries and the implications. Bangladesh J Med Sci 2020;19:103-108.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Assessment of Toxicity Profile Among Patients Receiving Concurrent Chemoradiotherapy in Head and Neck Cancer Patients with or Without Glutamine Supplements&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>115</FirstPage><LastPage>120</LastPage><AuthorList><Author>U. Umamaheswara Reddy</Author><AuthorLanguage>English</AuthorLanguage><Author> Pratap Kumar Reddy S</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Chemoradiation is commonly used curative treatment option for many forms of thecancer and produce synergistic effects than chemotherapy or radiation, per se. Objective: This study aims at assessing and comparing the toxicity profile and treatment breaks in patients receiving concurrent chemoradiation with 3D-Conformal Radiotherapy with or without glutamine supplements in head &amp;neck cancers. Methods: 80 patients diagnosed with squamous cell carcinoma of the head and neck who were treated with 3D-Conformal Radiotherapy in the as a prospective non-randomized double-arm observational study. 40 patients who received glutamine supplements and 40 patients who didn&#x2019;t receive glutamine supplements were reviewed weekly once for assessment of toxicity profile. Results: Out of the 80 patients, 64 patients were male and 16 female. Mean age was 54 years (range 13-74 years). 40 patients received glutamine supplements and 40 patients didn&#x2019;t receive glutamine supplements. The mean maximum grade of oral mucositis, dysphagia, skin reactions was less severe in the patients receiving glutamine compared to the patients not receiving glutamine ((p=0.0001).7.5% of patients who received glutamine supplements developed grade 3 skin reactions compared to 20% of patients who didn&#x2019;t receive glutamine supplements. 7.5% in the glutamine arm had treatment breaks with a range of 2-5 days. 32.5% in the control arm had treatment breaks with a range of 3-10 days. Conclusions: Glutamine supplementation in head and neck cancer patients receiving concurrent chemoradiotherapy may delay the onset of mucositis reactions, skin reactions, dysphagia and also the progression of the mucositis reactions, skin reactions, and dysphagia.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Radiotherapy, Glutamine, 3DCRT, Concurrent chemoradiation, Toxicity profile, Mucositis, Skin reactions, Dysphagia, Head and neck cancer</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
The greatest challenge in cancer treatment is to attain the highest probability of cure with the least morbidity. The simplest theoretical way is to increase the therapeutic ratio. With radiation this is possible by encompassing all cancer cells with sufficient doses of radiation during each fraction, simultaneously sparing surrounding normal tissues at the same time.1,2 In several types of cancer, radiation therapy may be curative if it is localised to one part of the body. To avoid tumour recurrence, it can also be used as part of curative treatment following surgery to remove a single malignant tumour. Radiation therapy is synergistic with chemotherapy and has been used with sensitive cancers before, during and after chemotherapy.1,2&#xD;
&#xD;
Over the last&#xA0;quarter of a century, clinical trials have shown improvement in treatment results for patients with squamous cell carcinoma of the head and neck, including greater local control, lower frequency of systemic recurrences, improved disease-free survival and most significantly improved overall survival. Prospective randomised phase III trials and meta-analyses and more significantly, population-wide statistics have shown an increase in overall survival. At the National Cancer Center, the Screening, Epidemiology, and End Results (SEER) programme assess improvements in cancer mortality rates in the United States.3,4&#xD;
&#xD;
The goal of radiation therapy is to provide the specified tumour volume with an appropriately measured dose of irradiation with as little damage as possible to the surrounding healthy tissue, resulting in tumour eradication, high quality of life and extended survival. In addition to curative efforts, in the successful palliation or prevention of symptoms of the disease, radiation therapy plays a significant role in cancer management: pain can be alleviated, luminal patency can be restored, skeletal integrity can be maintained, and with minimal morbidity, organ function can be restored. Our ability to recognise tumours has been significantly enhanced by technological advances in the application of x-rays, computed tomography scans, magnetic resonance imaging with and without spectroscopy, ultrasound, positron emission tomography scans, and electronic portal imaging and our awareness of their limitations. We recognised that high doses to the salivary glands caused dry mouth, reduced taste, and poor dental health while treating patients with head and neck cancers, but we were unable to eliminate these side effects without risking a cure compromise. From non-site-specific approaches using bony anatomy and hand-drawn blocking, modern radiotherapy has developed into advanced preparation combining three-dimensional image reconstructions and algorithms for computer optimization.5,6&#xD;
&#xD;
Concurrent Chemoradiation (CCRT) has proven to be the standard treatment option as an organ-preserving approach in early/ loco-regionally advanced head and neck cancers. With the improvement in tumour control and potential survival, issues regarding toxicity profile have become more pertinent. &#xD;
&#xD;
In patients with cancer, marked glutamine depletion develops over time. Cancer cachexia is marked by massive depletion of skeletal muscle glutamine. This can hurt the function of host tissues that are dependent upon adequate stores of glutamine for optimal functioning. Furthermore, the extent of normal tissue damage from radiation or chemotherapy may be influenced by the presence of adequate tissue glutamine stores. Both of these facts support a possible therapeutic role for glutamine in the prevention of host normal tissue toxicity during cancer treatment.7,8 In the present study, we tried to assess the toxicity profile and compare them with the patients receiving and not receiving glutamine supplements. &#xD;
&#xD;
MATERIALS AND METHODS &#xD;
&#xD;
Prospective non-randomized observational clinical study This study involved the assessment and comparison of toxicity profile in 80 patients who were diagnosed with biopsy-proven squamous cell carcinoma of head and neck region between April 2014 to May 2015 at Apollo Speciality Hospitals, Chennai. (Consent form approval number:141-41102-131-107619). The study was designed as a prospective non-randomized double-arm observational study. Each arm consisted of 40 patients of a biopsy-proven, non-metastatic Squamous cell carcinoma of head and neck region. . The patient and attendant were explained regarding the mechanism of action, tolerance, usefulness, available literature about glutamine administration in head &amp; neck cancer. This study was commenced after obtaining clearance from the hospital ethics and scientific committee&#xD;
&#xD;
After staging workup was completed, patients were subjected to radiation concurrent with chemotherapy. Radiation technique [3DCRT] and frequency of chemotherapy (weekly) was planned for all the patients. &#xD;
&#xD;
Inclusion Criteria: &#xD;
&#xD;
&#xD;
	&#xD;
	Head &amp; Neck cancers (Subsites to be included: Oral cavity, Oropharynx, Hypopharynx, Larynx) with documented Squamous cell carcinoma histopathology. &#xD;
	&#xD;
	&#xD;
	Stage - T2-4 N1-2c M0. &#xD;
	&#xD;
	&#xD;
	Performance status - Karnofsky &gt;80. &#xD;
	&#xD;
	&#xD;
	Concurrent Chemoradiation with Cisplatin-based chemotherapy. &#xD;
	&#xD;
	&#xD;
	Patients who were willing to participate in this study. &#xD;
	&#xD;
&#xD;
&#xD;
Exclusion Criteria: &#xD;
&#xD;
1. Prior Radiation to the neck region.&#xD;
2. Age &gt; 75 yrs.&#xD;
3. Patients who are unable to undergo Radiation treatment.&#xD;
4. Patients who are unable to undergo Chemotherapy concurrent with radiation. &#xD;
&#xD;
5. Non-squamous cell cancers of head &amp; neck. &#xD;
&#xD;
6. Patients with N3 nodes/ any distant metastases at the time of diagnosis. &#xD;
&#xD;
7. Concurrent chemo other than Cisplatin-based chemotherapy. &#xD;
&#xD;
After obtaining informed consent, patients were taken up for radiotherapy preparation. All the demographic data of the patients were collected at the time of preparation. All patients were properly immobilized with a suitable neck rest and aquaplanet mask. Shoulder retractor was used when necessary. After proper immobilization in treatment position technique &#x2013; Plain CT images of head and neck were taken from the base of the skull to clavicle with a Simulator CT machine. &#xD;
&#xD;
The acquired axial images were transferred to the treatment planning system (Oncentra Treatment planning system version 4.1) in DICOM format. These images received in the Treatment planning system were first registered and re-constructed for contouring. The primary and node volume with adequate margins (gross tumour&#xA0;volume &amp; clinical target volume&#xA0;) were contoured along with organs at risk (OAR) in the axial plane. All the contours were verified by the radiation oncology consultant before treatment planning. The treatment planning was done by the qualified medical physicist using Oncentra (version 4.1) treatment planning system. Each plan was evaluated by the radiation oncology author, consultant and the thesis guide. On approval of the plan, treatments were delivered on linear accelerator 6 MV photons. &#xD;
&#xD;
In 3D-CRT, the dose to the spinal cord was limited to 44 Gy. Patients were treated with three dimensional conformal RT (3D-CRT) with concurrent cisplatin-based chemotherapy as per protocol. 40 patients who received glutamine supplements (Glutamine arm) and 40 patients who didn&#x2019;t receive glutamine supplements (Control arm) were reviewed weekly once for assessment of toxicity profile. &#xD;
&#xD;
Glutamine was administered as 10 grams of L-Glutamine mixed with 200 ml of water two times a day. Every 15 grams of sachet contains L-Glutamine 10 grams, Vitamin C 250 mg, Zinc sulphate equivalent to elemental zinc 10 mg, Astaxanthin 10% 4 mg, Copper Sulphate equivalent to elemental Copper 1 mg and Selenium Selenomethionine equivalent to elemental selenium 100 mcg Other ingredients are Mannitol, Sucralose. All the patients were reviewed weekly for toxicity assessment and were given grades using RTOG Acute Radiation Morbidity Grading System. All documented toxicity profile was taken up for analysis. &#xD;
&#xD;
Data entry was done in Micro Soft Excel spreadsheet. Data validation and analysis were carried out by SPSS version 16.0. All the continuous variables were assessed for the normality using Shapiro Wilk&#x2019;s test. If the variables are normally distributed, they are expressed as Mean &#xB1; Standard deviation. Otherwise Median (Interquartile range). All the categorical variables were expressed either as percentage or proportions. Comparison of non normally distributed continuous variables was carried out by the Mann-Whitney U test. Comparison of categorical variables was done by chi-square test or fisher&#x2019;s exact test based on the number of observations. All the p values </Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3449</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3449</Fulltext></URLs><References>&#xD;
	&#xD;
	Vidal-Casariego A, Calleja-Ferne?ndez A, Ballesteros-Pomar MD, Urioste-Fondo A, Rodriguez-Domi?nguez D, Se?nchez-Aparicio E, et al. PP293 Prevention of oral and oesophagal radiation mucositis with glutamine: a retrospective study. Clin Nutr Suppl 2010;5(2):137-148. &#xD;
	&#xD;
	&#xD;
	Chattopadhyay S, Saha A, Azam M, Mukherjee A, Sur PK. Role of oral glutamine in alleviation and prevention of radiation-induced oral mucositis: A prospective randomized study. Sou Asi J Canc 2014 Jan;3(1):8-1 &#xD;
	&#xD;
	&#xD;
	Sarumathy S, Ismail AM, Palasimany A. Efficacy and safety of oral glutamine in radiation-induced oral mucositis in patients with head and neck cancer. Asian J Pharm Clin Res 2012;5:138-40. &#xD;
	&#xD;
	&#xD;
	Platteaux N, Dirix P, Dejaeger E, Nuyts S. Dysphagia in head and neck cancer patients treated with chemoradiotherapy. Dysphagia 2010 Jun;25(2):139-152. &#xD;
	&#xD;
	&#xD;
	&#xA0;Salvo N, Barnes E, van Draanen J, Stacey E, Mitera G, Breen D, et al. Prophylaxis and management of acute radiation-induced skin reactions: a systematic review of the literature. Curr Oncol 2010 Aug;17(4):94-112. &#xD;
	&#xD;
	&#xD;
	Klimberg VS, Kornbluth J, Cao Y, Dang A, Blossom S, Schaeffer RF. Glutamine suppresses PGE2 synthesis and breast cancer growth. J Surg Res 1996 Jun;63(1):293-7. &#xD;
	&#xD;
	&#xD;
	Hensley CT, Wasti AT, DeBerardinis RJ. Glutamine and cancer: cell biology, physiology, and clinical opportunities. J Clin Invest 2013;123(9):3678-3684. &#xD;
	&#xD;
	&#xD;
	Huang EY, Leung SW, Wang CJ, Chen HC, Sun LM, Fang FM, et al. Oral glutamine to alleviate radiation-induced oral mucositis: a pilot randomized trial. Int J Radiat Oncol Biol Phys 2000;46(3):535-539. &#xD;
	&#xD;
	&#xD;
	Tsujimoto T, Yamamoto Y, Wasa M, Takenaka Y, Nakahara S, Takagi T, et al. L- glutamine decreases the severity of mucositis induced by chemoradiotherapy in patients with locally advanced head and neck cancer: a double-blind, randomized, placebo-controlled trial. Oncol Rep 2015 ;33(1):33-3 &#xD;
	&#xD;
	&#xD;
	Iba?n?ez JP, A?ngel BQ, Gironzini VS. Best oral presentation: Prevention of mucositis in head and neck cancer (HNC) with glutamine. Rep Pract Oncol Radiother 2013;18:S110. &#xD;
	&#xD;
	&#xD;
	Zygogianni A, Kyrgias G, Kouvaris J, Pistevou-Gombaki K, Capezzali G, Zefkili S, et al. Impact of acute radiation induced toxicity of glutamine administration in several hypofractionated irradiation schedules for head and neck carcinoma. Head Neck Oncol 2012;4(5):86. &#xD;
	&#xD;
	&#xD;
	Imai T, Matsuura K, Asada Y, Sagai S, Katagiri K, Ishida E, et al. Effect of HMB/Arg/Gln on the prevention of radiation dermatitis in head and neck cancer patients treated with concurrent chemoradiotherapy. Japan J Clin Oncol 2014 May;44(5):422-7.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Steam Inhalation as an Adjuvant Treatment in Covid-19 Positive Health Care Professionals: Our Experiences at Tertiary Care Teaching Hospital&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>121</FirstPage><LastPage>125</LastPage><AuthorList><Author>Santosh Kumar Swain</Author><AuthorLanguage>English</AuthorLanguage><Author> Ansuman Sahu</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Steam inhalations are often used for the treatment of the viral infections of the respiratory tract such as common cold or croup. Objective: This study was aimed to evaluate the effect of the steam inhalation on COVID-19 infection. Methods: This is a prospective and descriptive study. The participants of this study were COVID-19 positive health care professionals and divided into two groups such as Group-A and Group-B. Group-A included 52 asymptomatic COVID-19 patients whereas Group-B included 44 symptomatic COVID-19 patients. The steam with a temperature of 42 0C to 45 0C was inhaled by all of Group-A and Group-B patients. Results: There were 52 asymptomatic COVID-19 patients in Group-A where 34 male and 18 female patients with a male to female ratio was 1.8:1. Out of the 44 symptomatic COVID-19 patients, 28 male and 16 female with male to female ratio was 1.75:1 The age ranges of the participant patients were 22 years to 68 years with a mean age of 38&#xB1;16 years. All the mild and moderate symptomatic patients except one became symptom-free by one week use of steam inhalation. Conclusions: The symptoms of the COVID-19 patients were drastically reduced after use of the steam inhalation. The favourable effect of the steam inhalation for reducing the symptoms of the COVID-19 infections is to decrease the severity and duration of this infection and it also justifies its therapeutic application and acts as a ray of hope in this dreaded pandemic.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> COVID-19 infection, SARS-CoV-2, steam inhalation, CO-RADS</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Coronavirus disease 2019(COVID-19) is caused by a novel virus called severe acute respiratory coronavirus 2(SARS-CoV-2).1 Rapid transmission of the SARS-CoV-2 leads to COVID-19 pandemic. The route for the entrance of the SARS-CoV-2 is usually through the nose, mouth and eyes. The common clinical manifestations of the COVID-19 patients are fever, dry cough, fatigue, dyspnea, decreased taste and smell sensation. Some COVID-19 patients are asymptomatic but act as silent carriers of this infection.2 Currently medical authorities are emphasizing the preventive strategies such as the use of face mask, social distancing and hand washing. Till now there is no effective treatment protocol for curing the COVID-19 infections. In traditional home remedy, steam inhalation has been used as adjuvant treatment in several respiratory conditions such as common colds, croup and bronchitis.3 The use of the steam inhalation is based on their heat and humidity of warm and moist air. Steam inhalation has been used for centuries for the treatment of Influenza virus or common flu. SARS-CoV-2 is structurally similar to the influenza virus. Previous studies on the influenza virus and coronavirus show strong support towards the effect of the steam inhalation.&#xA0; The rationale behind the use of steam inhalation in common colds was the reduced replication of the human rhinovirus (common aetiology of the common cold) in vitro at the temperature of 33 to 43 0C.4 Humidity is also functioned as secretolytic in case of bronchiolitis.5 In case of croup, steam inhalation soothe inflamed mucosa of the laryngeal surface, reduce the viscosity of mucus and make easy airflow.6 The effect of the heat or steam inhalation on the novel SARS-CoV-2 in contrast to the rhinovirus has been less established. This study aims to evaluate the effect of steam inhalation as an adjuvant treatment among health care professionals with COVID-19 infections.&#xA0;Inhalation of humidified warm air has long been&#xA0;r an effective means of alleviating cold&#xD;
&#xD;
MATERIALS AND METHODS&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xD;
&#xD;
This is a prospective and descriptive study done among the COVID-19 positive health care professionals such as doctor, staff nurse and health care workers in a tertiary care teaching hospital. All these patients were diagnosed based on the reverse transcription-polymerase chain reaction (RT-PCR) and computed tomography (CT) of the thorax. This study was conducted between April 2020 to September 2020. This study was approved by the Institutional Ethical Committee (IEC) with reference number IEC/IMS/SOAU/23/2020. The steam with a temperature of 42 0C to 45 0C was inhaled. All the patients were using ordinary steamer available in the market for steam inhalation (Figure 1).&#xA0; Different variables were obtained before and after steam inhalation was compared. The study participants were divided into two groups: Group A and Group B. Group A was consisting of 52 asymptomatic&#xA0;&#xA0; COVID-19 positive health care professionals. These asymptomatic patients were advised for inhaling steam thrice daily for two weeks by ordinary steamer available in the market and the duration of each inhalation was 5 minutes. Group-B was consisting of 44 symptomatic COVID-19 health care professionals and symptoms were ranging from mild to moderate symptoms. Mild symptoms include only nasal or throat symptoms and moderate symptoms include both nasal and throat symptoms along with more other symptoms. Severe symptoms include dyspnea requiring oxygen or ventilation along with nasal and throat symptoms. In this study patients with severe symptoms were excluded. We also analyzed the CO-RADS score from the CT scan of the thorax of the study patients. CO-RADS score varies from CO-RADS 1 to CO-RADS 5. CO-RADS 6 score indicates proven COVID-19 involvement which supported by RT-PCR test. Each of the five lung lobes in CT thorax were assessed for degree of involvement and classified as none (0%), minimal (1-25%), mild (26-50%), moderate (51-75%), and severe (76-100%). No involvement to a lobe score of 0, minimal to a lobe score of 1, mild to a lobe score of 2, moderate to a lobe score of 3 and severe to a lobe score of 4. The total scores of the five lobes of lungs range from 0 to 20. All these mild to moderate symptomatic patients were advised to take steam inhalation every three hours and each inhalation for 5 minutes along with COVID-19 treatment in the COVID hospital. All the 52 the asymptomatic patients were taking Tab. Zinc, Tab. Vitamin-C, Tab. Vitamin-D3(60K once weekly), Tab. Famotidine (20 mg) twice daily and in mild to moderate symptomatic patients were taking Tab. Azithromycin, Tab. Paracetamol, Tab. Vitamin-C, Tab. Vitamin-D3 and Vitamin Zinc. All of these asymptomatic and mild to moderate symptomatic patients were taking steam inhalation along with the above treatment. Group A was consisting of 52 asymptomatic COVID-19 patients and Group-B consisting of 44 symptomatic COVID-19 patients and all of them under observation for any improvement at the follow-up visit at the 1st week, 2nd weeks, one month and 2 months. In this study, all the data were recorded and analyzed by using Statistical Package for Social Science (SPSS) software, v25(IBM, Armonk, New York, USA).&#xD;
&#xD;
RESULTS&#xD;
&#xD;
There were 52 asymptomatic and 44 symptomatic COVID-19 patients. The age ranges of the patients were 22 years to 68 years with a mean age of 38&#xB1;16 years. There were 62 males and 34 females in this study. The male to female ratio of the participants in this study was 1.8:1. There were 52 asymptomatic COVID-19 in Group-A where 34 male and 18 female patients with a male to female ratio was 1.8:1. In Group-B, out of the 44 symptomatic COVID-19 patients, 28 male and 16 females with male to female ratio was 1.75:1 (Table 1). All the patients were treated with steam inhalation with follow up visit at 1st week, 2nd weeks, one month and two months. Out of the 52 asymptomatic patients, 48 (92.30%) were symptom-free as before at the follow-up visit at 2 weeks, one month and two months whereas 4 patients (7.69%) developed mild symptoms at the first week follow up visit. All these 52 patients became negative for COVID-19 infection during the second weeks with reverse transcription-polymerase chain reaction (RT-PCR) test. In Group-B, there were 44 symptomatic. Out of the 44 symptomatic, 36 were mild symptomatic and 8 were moderate symptomatic. All the mild symptomatic COVID-19 patients became symptom-free in 5 days with steam inhalation whereas in moderate symptomatic patients (except one patient), all of them became symptom-free after 7 days. One moderate symptomatic patient has developed pneumonia followed by orotracheal intubation and this patient extubated at the COVID intensive care unit (ICU) and discharged for home quarantine.&#xA0; The COVID-19 test (RT-PCR) was done in all cases after 10days of the treatment and found negative in 84 cases (87.50%) out of the 96 positive cases. By the second week, all patients of Group-A return to negative after 14 days of treatment. In Group-B, 8 COVID-19 tests came to negative in 20 days. The CO-RADS score was 6 in all cases because of the positive RT-PCR before steam inhalation. The involvements of the lobes of lungs in the CT scan of the thorax were analyzed before and after steam inhalation (Table 2). The entire Group-A and Group-B patients those were using the steam inhalation recovered and became negative for COVID-19. No death occurred from this study patients.&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
The COVID-19 infection is a highly contagious disease which spread rapidly from human to human via droplets. The initial COVID-19 case with pneumonia due to novel coronavirus SARS-CoV-2 manifesting COVID-19 was found in Wuhan, Hubei Province, China in December 2019.7 Then these infections were transmitted from human to human and lead to a pandemic with disastrous manifestations all over the world. The transmission of the SARS-CoV-2 usually occurs through the upper respiratory tract such as the nose, nasopharynx, oral cavity, pharynx and larynx with high levels of viral shedding.7 It typically spreads via droplets but the aerosols generating procedures are more responsible for the transmission of the virus among health care professionals and enhance the spread to the surrounding persons.8 So, health care workers are an important person to stay away from the infections otherwise the health care service will be stopped once they become infected.9 In this study, the focus was on the health care workers as they are more vulnerable and challenge to the health care delivery system of a hospital. Symptomatic or asymptomatic patients of COVID-19 infections are responsible for spreading the disease in approximately 79% of the documented cases.10 The transmission of the COVID-19 occurs because the shedding of the SARS-CoV-2 virus begins before the onset of the symptoms.11 A significant number of COVID-19 patients do not present with symptoms. In this study, out of the 96 COVID-19 positive participating patients, 52 were with no symptoms and 44 were symptomatic. All of them treated with steam inhalation. Steam inhalation has been used as home remedies for relieving the nasal obstruction in patients with allergic rhinitis and the common cold. Inhalation of humid and hot air enhances the temperature of the nasal mucosa, leading to inhibition of the chemical secretion from the mast cells in allergic rhinitis or the common cold.12 One study showed that histamine level in the nasal mucosa significantly reduced after steam inhalation, causing decreased nasal obstruction and vascular leakage.13 So, steam inhalation is helpful for quick relieve of the cold symptoms by reducing the respiratory virus such as rhinovirus or coronavirus.14 It also lowers the inflammatory process and immunological responses by viral infections of the respiratory tract specifically upper airway. Steam inhalation surely relieves nasal symptoms such as nasal block, itching, sneezing, running nose, postnasal drip, facial pain and headache in COVID-19 patients. In this study, 44 patients (Group-B) were COVID-19 positive with mild to moderate symptoms. Mild symptoms include only nasal or throat symptoms whereas moderate symptoms include both nasal and throat manifestations. &#xD;
&#xD;
All of our patients in this study were diagnosed with RT-PCR test. There are certain investigations are used for diagnosis of the COVID-19 infection such as RT-PCR, rapid antigen test and computed tomography (CT) scan of the thorax. The CT thorax is high sensitivity and specificity for an immediate result.15 CT scan of the lungs shows infiltrates, ground-glass opacities and segmental consolidation. CT picture is also abnormal in asymptomatic COVID-19 positive cases. So, CT scan is also useful for diagnosis of the COVID-19 suspected patients with a negative report, however, these patients may show positive molecular tests report on a repeat test.16 COVID-19 reporting and data system (CO-RADS) is a categorical evaluation scheme for pulmonary involvement in COVID-19 infections at an un-enhanced chest CT which performs well for predicting the COVID-19 patients.15 It assesses the pulmonary involvement in COVID-19 infection on a scale from 1 (very low) to 5 (very high). There are two additional categories respectively encode a technically insufficient examination (CO-RADS 0) and RT-PCR positive for SARS-CoV-2 infection at the time of examination (CO-RADS 6). In this study, CO-RADS score varies from CO-RADS 0 to CO-RADS 5. CO-RADS 6 score indicates proven COVID-19 involvement which supported by RT-PCR test. In this study, the asymptomatic patients were showing the score of 0 to 5 in CT thorax before steam inhalation and became to 0 after steam inhalation.&#xA0; The negative tested COVID-19 may not accurate. Patients should be screened for respiratory symptoms and fever before performing the laryngeal and trachea-bronchial examinations and surgical procedures. Clinical should obtain the COVID-19 test report (RT-PCR) although it has a significant false-negative rate.17&#xA0; &#xD;
&#xD;
One infected patient of COVID-19 infects an average of three new persons, the reproductive number (R0) being 3 for SARS-CoV-2.18 As this is a novel viral infection of the human being, antiviral drugs and vaccinations are not yet been developed for this rapidly spreading illness. So, currently, the major emphasis is given on hand wash, social distancing and use of the face mask.19 Steam inhalations with humidified warm air is usually regarded as an effective tool for alleviating the cold symptoms. Increasing the intranasal temperature is reportedly effective for decreasing the nasal resistance whereas the exposure of the cold air to the nasal mucosa increases the nasal cavity resistance. High temperature inside the nasal cavity is also helpful to minimize the infectivity of the rhinoviruses. Rhinoviruses are an important group of cold viruses causing respiratory tract infections. The steam inhalation is one of the widely used home remedies for soothing and opening the nasal passages. There are several studies regarding the effect of the different temperature on the virus. On smooth surfaces, the dried virus retains its viability for over five days at a temperature of 22 to 25 0C and relative humidity of 40 to 50% that is typical air-conditioned environments.20 Steam inhalation has a temperature of about 70 0C to 80 0C which is above the instability temperature for the SARS-CoV-2. The study of the influenza virus on human and Guinea pigs showed a similar pattern and the majority of the influenza virus were inactivated above the temperature of the 30 0C.21 &#xD;
&#xD;
One study documented that incubating the SARS-CoV-2 at the temperature of 70 0C make inactivation from 14 days to 5 minutes.22 So, it implies that the higher temperature of the steam may be useful for COVID-19 infection. Effects of steam inhalation on other respiratory infections may give indirect evidence for effectiveness on the COVID-19. Steam inhalation must be differentiated from the cool mist therapy. The cool mist therapy is preferentially used in hospital and developed countries because of its relative uniformity and safety of the delivery.5 Cool veils of mist may help similarly in case of croup by reducing the viscosity of the secretions and mucosal oedema.23 Usually cool mist has been provided via hospital beds or tents whereas steam inhalation is a home-based practice. In home-based practice, steam inhalation is frequently used for minor respiratory complaints. There are several techniques available and some are traditional such as boiling a kettle, staying in a sauna and leaning over a bowl of boiling water or running a hot water shower whereas some utilize the specialized devices like delivering steam via nozzles or nasal cannula. Some devices produce steam at 41 to 47 0C while sauna temperature may attend 80 to 95 0C.24 The practice of tu-ob(leaning over a bowl of boiling water)&#xA0; in the Philippines got the attention of medical specialties about its therapeutic effects of COVID-19 infections.25&#xD;
&#xD;
Steam inhalation may be hazardous to pediatric age patients and should be done carefully. Steam inhalation may result in scalds and even require hospitalization for these complications and disfigurement. In this study, no patients were affected by any complications like scalds. However, the steam inhalation improves the ciliary function, so helps in mucociliary clearance, decongestion enhances the breathing and reduce the cough.26 Steam inhalation is one of the effective adjuvant treatments in asymptomatic and symptomatic COVID-19 patients. It usually relieves the respiratory symptoms and helps to the speedy recovery of the COVID-19 patients. Steam inhalation is one of the effective adjuvant treatments for COVID-19 infections.&#xD;
&#xD;
This is an observational study on small size population. It warrants an extended randomized control trial for evaluating the effect of steam inhalation on a larger size population of patients and health care professionals. Further confirmation can be done by the study of a larger scale in Asian and Western populations.&#xD;
&#xD;
CONCLUSIONS&#xD;
&#xD;
The clinical symptoms in COVID-19 patients are dramatically reduced by administration of steam inhalation. Steam inhalation can be used as an adjuvant treatment along with the use of face masks, social distancing and hand wash with sanitisers for prevention and treatment of the COVID-19 infection. Steam inhalation is an easily available technique and affordable addition to the treatment for COVID-19 infections which curb the severity of the infections and transmission of the SARS-CoV-2. As we await a definitive treatment to fight this pandemic, steam inhalation currently a safe technique will act as a ray of hope in the treatment of the COVID-19 infection.&#xD;
&#xD;
Author Contribution: SKS: Concept, data collection and data analysis; AS: Data collection, data analysis, and drafting the manuscript. &#xD;
&#xD;
Conflict of interest: Nil&#xD;
&#xD;
Funding: No Funding sources were granted or used specifically for this work.&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3450</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3450</Fulltext></URLs><References>1. Swain SK, Behera IC. Managing pediatric otorhinolaryngology patients in coronavirus disease-19 pandemic-A real challenging to the clinicians. Indian J Child Health 2020;7(9):357-362.&#xD;
&#xD;
2. Swain SK, Agrawal R. Mastoid surgery: a high-risk aerosol-generating surgical procedure in COVID-19 pandemic. Int J Otorhinolar Head Neck Surg 2020;6(10):1941-1946.&#xD;
&#xD;
3. Vathanophas V, Pattamakajonpong P, Assanasen P, Suwanwech T. The effect of steam inhalation on nasal obstruction in patients with allergic rhinitis. Asian Pac J Allergy Immunol 2019. doi: 10.12932/AP-090818-0393. Online ahead of print.&#xD;
&#xD;
4. Sahin O, G&#xFC;len F. Approach to the common cold in children. J Ped Res 2015;2(1):1-6.&#xD;
&#xD;
5. Umoren R, Odey F, Meremikwu MM. Steam inhalation or humidified oxygen for acute bronchiolitis in children up to three years of age. Cochrane Database Syst Rev 2011;(1): CD006435. &#xD;
&#xD;
6. Szilagyi PG. Humidifiers and other symptomatic therapy for children with respiratory tract infections. Pediatr Infect Dis J 1991;10(6):478-479.&#xD;
&#xD;
7. Li Q, Guan X, Wu P, et al. Early transmission dynamics in Wuhan, China, of Novel Coronavirus-infected pneumonia. N Engl J Med 2020:382;1199-1220.&#xD;
&#xD;
8. Tran K, Cimon K, Severn M, et al. Aerosol generating procedures and risk of transmission of acute respiratory infections tohealthcare workers: a systematic review. PLoS One. 2012;7(4):e35797.&#xD;
&#xD;
9. Swain SK, Das S, Padhy RN. Performing tracheostomy in intensive care unit-A challenge during COVID-19 pandemic. Siriraj Med J 2020;72(5):436-442.&#xD;
&#xD;
10. Li R, Pei S, Chen B, et al. Substantial undocumented infection facilitates the rapid dissemination of novel coronavirus (SARS-CoV-2). Science 2020;368(6490):489-493.&#xD;
&#xD;
11. He X, Lau EH, Wu P, et al. Temporal dynamics in viral shedding and transmissibility of COVID-19. Nature Med 2020;26(5):672-675.&#xD;
&#xD;
12. Ophir D, Elad Y, Dolev Z, et al. Effects of inhaled humidified warm air on nasal patency and nasal symptoms in allergic rhinitis. Ann Allergy 1988;60:239-242.&#xD;
&#xD;
13. Salman SD, Proctor DF, Swift DL, et al. resistance: description of a method and effect of temperature and humidity changes. Ann Otol Rhinol Laryngol 1971;80:736-743.&#xD;
&#xD;
14. Rouadi P, Baroody FM, Abbott D, et al. A technique to measure the ability of the human nose to warm and humidify the air. J Appl Phys 1999;87(1):400-406.&#xD;
&#xD;
15. Levine R, Caputo N. CT scan of a COVID positive patient. J Am Coll Emerg Physic 2020; 18(6):123-128.&#xD;
&#xD;
16. Huang P, Liu T, Huang L, et al. Use of chest CT in combination with negative RT-PCR assay for the 2019 novel coronavirus but high clinical suspicion. Radiology 2020; 295(1):22-23.&#xD;
&#xD;
17. Yu P, Zhu J, Zhang Z, Han Y. A familial cluster of infection associated with the 2019 novel coronavirus indicating possible person-to-person transmission during the incubation period. J Infect Dis 2020;221(11):1757-1561.&#xD;
&#xD;
18. Guo YR, Cao QD, Hong ZS, et al. The origin, transmission and clinical therapies on coronavirus disease 2019 (COVID-19) outbreak&#x2013;an update on the status. Military Med Res 2020;7(1):1-10.&#xD;
&#xD;
19. Swain SK, Acharya S, Sahajan N. Otorhinolaryngological manifestations in COVID-19 infections: An early indicator for isolating the positive cases. J Sci Soc 2020;47(2):63.&#xD;
&#xD;
20. Chan KHI, Peiris JS, Lam SY, et al. The effects of temperature and relative humidity on the viability of the SARS coronavirus. Adv Virol 2011;2011:734690.&#xD;
&#xD;
21. Lowen AC, Mubareka S, Steel J. Influenza virus transmission is dependent on relative humidity and temperature. PLoS Pathog 2007;3(10):1470-1476.&#xD;
&#xD;
22. Chin A, Chu J, Perera M, et al. Stability of SARS-CoV-2 in different environmental conditions. Med Rxiv 2020;1:10. &#xD;
&#xD;
23. Knutson D, Aring A. Viral croup. Am Fam Physic 2004;69 (3):535-540.&#xD;
&#xD;
24.Pach D, Kn&#xF6;chel B, L&#xFC;dtke R. Visiting a sauna: does inhaling hot dry air reduce common cold symptoms? A randomised controlled trial. Med J Aus 2010;193(11-12):730-734.&#xD;
&#xD;
25. Uy TM, Miranda MC, Aro SJ, et al. Should steam inhalation be used in the treatment and prevention of COVID-19? Asia Pac Center Evid Based Health Care 2020;1:1-6.&#xD;
&#xD;
26.Fehr AR, Perlman S. Coronaviruses: An overview of their replication and pathogenesis. Methods Mol Biol 2015; 1282:1-23.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Characterisation of Mutations Associated with Rifampicin Resistance in Patients Attending a Tertiary Care Centre, Kerala&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>126</FirstPage><LastPage>131</LastPage><AuthorList><Author>Sreeja Nair</Author><AuthorLanguage>English</AuthorLanguage><Author> Seema Oommen</Author><AuthorLanguage>English</AuthorLanguage><Author> Vidya Pai</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Resistance to rifampicin is considered to be a surrogate marker for multidrug-resistant Mycobacterium tuberculosis (MDRTB). Objective: The present study was undertaken to evaluate the drug resistance profile and the resistance-conferring mutations of MDR-TB species in a tertiary care hospital, Central Kerala. Methods: Clinical specimens (n=404) were subjected to Ziehl-Neelsen (Z-N) staining and culture and drug susceptibility testing (DST) using liquid (BD BACTECTM Micro MGITTM {Mycobacteria Growth Indicator tube). RIF resistant isolates (n=5) detected phenotypically along with randomly selected RIF sensitive isolates (n=5) were randomly selected and rpoB gene of all the amplified strains was sequenced and mutations analysed. Results: Out of 404 samples from clinically suspected cases of M. tuberculosis, Mycobacteria was grown in 48 (11.9%) samples. Amongst the forty-eight M. tuberculosis isolates, 41.6 % were sensitive to all five drugs and 6.2 % were resistant to all five drugs. Of the total of 48 culture-positive TB cases, one (2.08%) was found to be MDR-TB and additional resistance was observed in one (2.08%) isolate. Of the ten isolates (five RIF resistant isolates detected phenotypically along with five RIF sensitive isolates) which was amplified by PCR, M. tuberculosis DNA was not detected by PCR in one of the isolates. Mutations detected occurred in codon 531 with Ser &#x2192; Leu substitution. Conclusion: Molecular methods along with conventional detection methods help in understanding the transmission dynamics of tuberculosis and could be used as a tool in controlling the transmission of tuberculosis and thereby achieving the elimination of tuberculosis by 2030.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Rifampicin, M. tuberculosis, Mutation</Keywords><Fulltext>Introduction&#xD;
&#xD;
Tuberculosis (TB) is one of the major infectious diseases and is the leading cause of death from a single infectious agent.1 According to the world TB report (2019) by World Health Organization (WHO), an estimated 10 million new active TB diseases cases and 1.2 million deaths occurred in 2018.2 India ranks first among the eight high burden countries which contribute to the 2/3rd of the global TB burden.2&#xA0; In 2018, there were about half a million new cases of rifampicin-resistant TB out of which 78% had multidrug-resistant TB.2 Even though there is an increase in the notification rates, there is still a gap between the number of new cases and the estimated cases reported. This gap is mainly due to the under-reporting of detected cases or under-diagnosis. Also in resource-poor settings like India, the detection and treatment of multidrug-resistant tuberculosis (MDR-TB) is all the more difficult especially due to the high expenses and more toxic treatment regimens which lead to higher rates of clinical failure and disease relapse.3&#xD;
&#xD;
The evolution of drug resistance in clinical M. tuberculosis strains is mainly due to chromosomal mutations in target genes. Other mechanisms include disruption of prodrug activation and the activation of efflux pump. World health organisation (WHO) has issued a recommendation that drug susceptibility testing (DST) of M. tuberculosis isolates should be carried out for all patients with TB to aid treatment plans and to increase the outcome.3,4 The main mechanisms of resistance leading to drug resistance include drug target alteration, overexpression of drug target, disruption of prodrug activation and the activation of efflux pump.4 Gene mutations are usually associated with resistance to specific drugs used in&#xA0;treating M. tuberculosis.5 Rifampicin is one of the most potent first-line drugs available for TB treatment. Early detection of rifampicin resistance is of particular importance since &gt;90% of rifampicin-resistant isolates are also resistant to isoniazid. Therefore, the detection of rifampicin resistance represents a valuable surrogate marker for MDRTB.6 Resistance to rifampicin has been demonstrated as a result of single or multiple mutations in the rpoB gene, the RNA polymerase &#x3B2;-subunit-encoding gene.7 The &#x3B2; subunit of RNA polymerase is coded by the rpoB gene. Sequencing studies have shown that 90&#x2013;95% of rifampicin-resistant M. tuberculosis isolates have a mutation within an 81-bp hot-spot region (codons 507&#x2013;533; Escherichia coli numbering) of the rpoB gene which is the core region (Rifampicin Resistance Determining Region, RRDR).8 Molecular techniques are used to differentiate&#xA0;M. tuberculosis&#xA0;strains and are important tools in public health issues related to TB outbreaks and to unravel the transmission patterns.5 M.tuberculosis complex (MTBC)&#xA0; lineages have differences in virulence, transmissibility, and capacity of acquiring drug-resistance conferring mutations.9 One of the most used genotyping methods is spacer oligonucleotide typing (spoligotyping), which is based on the polymorphism of direct re&#xAD;peat (DR) locus present within M. tuberculosis. The DR contains 36-bp well-conserved repeat sequences inter&#xAD;spersed with 34-41-bp nonrepetitive spacers and therefore used to differentiate strains.10 The spoligotyping method was also the basis for making the largest genotype database for&#xA0;M. tuberculosis, containing a global distribution and phylogenetic analysis for worldwide spoligotype.11&#xD;
&#xD;
The importance of molecular typing of M. tuberculosis has been useful in the outbreak investigations in health care settings, as it helps to understand the transmission dynamics of M. tuberculosis strains and their distribution at a particular region/area.12 This study was carried out to investigate the predominant M. tuberculosis strains responsible for causing tuberculosis in a tertiary care hospital in Kerala using spoligotyping and identify drug resistance gene and its mutations associated, prevalent in M. tuberculosis strains. With the increased number of cases and many of them becoming multidrug-resistant (MDR) or extensively drug-resistant TB (XDR-TB), a better knowledge of the molecular mechanisms of antitubercular drug-resistance will have a significant impact on the improvement of rapid detection of drug resistance, especially when using molecular formats for detection of drug resistance. As such, little information is available on the aetiology of MDR-TB in the area where the present study is conducted.&#xA0; Therefore, the present study was undertaken to determine the characteristics, and evaluate the drug resistance profile of MDR-TB species and to investigate the drug resistant conferring mutations and to ascertain their epidemiological linkages using molecular genotyping.&#xD;
&#xD;
Materials and Methods&#xD;
&#xD;
A total of 404 specimens were obtained from suspected cases of tuberculosis (TB) and from patients who were previously treated for TB from different wards and outpatient departments of a 1200 bedded tertiary care centre located in Central Kerala for a period of two years from November 2015 to October 2017. The institutional ethical committee clearance was obtained for the study (PIMSRC/E1/388A/44/2015 dated 29-10-2015). Consecutive pulmonary and extrapulmonary specimens (except blood) were collected from patients, suspected of TB, irrespective of their age and gender from various clinical departments like pulmonary medicine, general medicine, surgery, and paediatrics in sterile; leak-proof containers. The samples were processed in the mycobacteriology laboratory within 48 h of receipt of specimen. All specimens were subjected to direct smear microscopy using Ziehl-Neelsen (ZN) staining method followed by N-acetyl-L-cysteine and sodium hydroxide (NALC-NaOH) digestion, decontamination technique. Decontamination is not required for sterile body fluid. After decontamination, one drop of the specimen was taken and smear is prepared. The liquid culture medium used was the BBL Mycobacteria Growth Indicator Tube (MGIT BD BACTECTM) containing modified Middle Brook 7H9 broth (7 mL), to which an enrichment supplement, as well as a mixture of antimicrobials consisting of polymyxin B, amphotericin B, nalidixic acid, trimethoprim, and azlocillin, was added. The MGIT tubes along with the solid media were incubated at 37&#xBA;C. The tubes were examined daily up to 8 weeks of incubation in a 365 nm wavelength UV light source fluorescence detector (BACTEC TM Micro MGIT device). To validate the test a positive and a negative control tube were included with every batch of test tubes examined. The tubes were checked for the presence of granular appearance and fluorescence which indicates growth. On solid media, growth was observed as rough, cream coloured colonies. All positive tubes were confirmed for the presence of AFB by Z-N staining and were subcultured on a blood agar plate to rule out contamination. The smears were observed for the presence of AFB, as well as for the presence of cording a characteristic feature of M. tuberculosis complex (MTBC). MTBC isolates were further confirmed using BD MGIT MTBC identification test (TBC ID).&#xD;
&#xD;
The MTBC isolates were further subjected to drug susceptibility testing using the drugs streptomycin (1 &#xB5;g/mL) (STR), isoniazid (0.1 &#xB5;g/mL) (INH), rifampicin (1 &#xB5;g/mL) (RIF), ethambutol&#xA0; (5 &#xB5;g/mL ) (ETH) and also pyrazinamide (100 &#xB5;g/mL) (PZA). BD BACTEC MGIT 960 SIRE kits were used for drug susceptibility testing. Five RIF resistant isolates detected phenotypically along with five RIF sensitive isolates were randomly selected and were analysed. The point mutations within the 81 bp RRDR were detected using PCR and DNA sequencing methods and the sequences were compared with wild type M. tuberculosis (H37Rv) strain to check for any mutations within the hotspot region. Finally, the amplicons were subjected to spoligotyping.&#xD;
&#xD;
DNA extraction, PCR and sequencing&#xD;
&#xD;
DNA extraction was performed as per the manufacturer&amp;#39;s instructions using the QIAamp DNA Mini Kit (Qiagen). Samples from the broth culture were subjected to centrifugation and the pellet dissolved in minimum volume in buffer/Milli-Q for further Qiagen DNA Extraction method. The isolated mycobacterial DNA was subjected to PCR amplification using species-specific primers. The &#xA0;DNA was measured using the Nanodrop ND-1000 Spectrophotometer (Thermofisher) and visualized on 0.8% agarose gel stained with ethidium bromide. The 81 bp hot spot, flanking regions of rpoB gene of M. tuberculosis was amplified using polymerase chain &#xA0;PCR primers rpoB F forward &#x2013; 5&#x2019;- GGATCAGCTCGCCGACCGTA 3&#x2019; and PCR primers rpoB R Reverse &#x2013; 5&#x2019;- TACGGCGTTTCGATGAACC-3&#x2019; were used.&#xD;
&#xD;
Applied Biosystem thermal cycle was used for the PCR reaction. The conditions set for PCR reaction were, initial denaturation at 95?C for 2 min; 34 cycles of 95?C for 40 sec, 55&#xB0;C for 50 sec and 72?C for 30 sec; and final elongation at 72?C for 7 min, followed by holding at 4&#xB0;C. The positive control used was M. tuberculosis H37Rv and negative control used was nuclease-free water. Post amplification, the samples were run on a 1.5% agarose gel and visualization was done under a UV Transilluminator. After obtaining the desired amplification, the PCR products are subjected to Exo SAP purification. Post ExoSAP purification of the PCR products, cycle sequencing was carried out using the ABI Big Dye Terminator v.3.0 (Applied biosystems) kit. Products were resolved by electrophoresis on an ABI 3730xl capillary sequencer. The 411 bp amplicons were purified and sequenced using the primer rpoB F or rpoB R and the sequences were aligned with gi|448814763:759807-763325 M. tuberculosis H37Rv, reference sequence for the screening of rpoB gene mutations.&#xD;
&#xD;
Results&#xD;
&#xD;
A total of 404 specimens were obtained from suspected cases of tuberculosis (TB) and from patients who were previously treated for TB from different wards and outpatient departments during the study period. &#xD;
&#xD;
Of the 404 samples collected, 188 (46.5%) samples were from pulmonary TB suspected patients and 216 (53.5%) from extrapulmonary TB (EPTB) suspects. These 404 specimens were processed by smear and further by culture on to Micro MGIT and Lowenstein- Jensens (L-J) medium. Among the 188 pulmonary samples, 27 (14.4%) specimens were found to be positive for M. tuberculosis complex (MTBC), and out of the 216 extrapulmonary samples processed, 21 (9.7%) were found to be positive for MTBC by the Micro MGIT culture. Thus, of the 404 samples processed, a total of 11.9% (48/404) were found to be positive for TB.&#xD;
&#xD;
Amongst the forty-eight M. tuberculosis&#xA0;isolates, 41.6 % (n=20) were sensitive to all five drugs and 6.2 % (n=3) were resistant to all five drugs. The highest rate of mono resistance was towards streptomycin (STR) (n=7, 14.9&#xA0;%), followed by isoniazid (INH) (n=6, 12.5%) and pyrazinamide (PZA) (n=4, 8.3&#xA0;%). Among the total of 48 culture-positive TB cases, one (2.1%) was found to be MDR-TB and additional resistance (resistance to STR, INH, RIF and PZA) was observed in one (2.1%) isolate.&#xA0; The MDR isolates obtained was from a pulmonary TB patient. Around 12.5 % (n=6) of the total culture-positive TB cases were poly-resistant.&#xD;
&#xD;
Five RIF resistant isolates detected phenotypically along with five randomly selected RIF sensitive isolates was subjected to M. tuberculosis DNA isolation. The isolated mycobacterial DNA was subjected to PCR amplification using species-specific primers. A clear band in the agarose gel at 411 bp confirmed the presence of M. tuberculosis. Of the ten isolates subjected to PCR amplification, M. tuberculosis DNA was not detected by PCR in one of the resistant isolates (Figure 1). The reason may be or that the isolate could be non-tuberculous mycobacteria which cannot be detected by M. tuberculosis species-specific primers. This isolate was considered as M. tuberculosis complex phenotypically. &#xD;
&#xD;
Five phenotypically RIF-resistant isolates and four RIF sensitive isolates were tested for mutations in the rpoB gene. DNA sequence analysis revealed that 60% (3/5) strains of RIF-resistant showed rpoB gene mutation versus 40% (2/5) strains to have no mutation. The only rpoB gene mutation described by sanger sequencing occurred in codon 531 in three isolates with Ser &#x2192; Leu substitution (TCG &#x2192; TTG) (Figure 2). Two isolates, although resistant to RIF, did not show any mutation.&#xD;
&#xD;
Discussion&#xD;
&#xD;
Worldwide, resistance to standard anti-tuberculosis drugs is a major constrain in the control and treatment of tuberculosis.13,14 Accurate determination of the species and strains is critical in inpatient management. A total of 404 specimens were obtained for culture from suspected pulmonary and extrapulmonary TB patients of which 188 (46.5%) was from pulmonary TB suspects and 216 (53.5%) from extrapulmonary TB suspects. In this study samples (n=404) were received in the laboratory and were processed for Zeihl-Neelsen staining and liquid and solid culture simultaneously. The positivity rates using smear microscopy was 5.0% (pulmonary and EPTB specimens) when compared to liquid culture method which was 11.9% and solid culture method which detected 8.7% of TB cases. &#xD;
&#xD;
Drug-resistant TB is still a major public health problem. In the present study, DST was carried out for all first-line anti-tubercular drugs &#x2013; streptomycin (STR) (1.0 &#xB5;g/mL), isoniazid (INH) (0.1 &#xB5;g/mL), rifampicin (RIF) (1 &#xB5;g/mL), ethambutol (ETB) (5 &#xB5;g/mL) and pyrazinamide (PZA) (100 &#xB5;g/mL). It was found that 41.7% (n=20/48) isolates were sensitive to all five drugs. Similar observations from North India by Sethi et al., (2012), who reported 47.5% pan-sensitive isolates.15 Resistance to one drug was observed in 17/48 (35.4%) of the isolates in the present study. This is similar to a study conducted in China by Ning-ning Tao et al., (2017),&#xA0; where resistance to a single drug was found to be&#xA0; 24.1%.16 In the present study, only one isolate (2.8%) was identified as MDR phenotypically as per the definition. Globally, 3.5% of new cases and 18% of previously treated cases had MDR/RR-TB (1). In 2017, there were an estimated 558,000 (range: 483,000&#x2013; 639,000) incident cases of MDR/RR-TB. The countries with the largest numbers of MDR/RR-TB cases (47% of the global total) were China, India and the Russian Federation.1&#xD;
&#xD;
The use of molecular methods to identify mutations associated with drug resistance has drastically decreased the turnaround time and is highly specific to phenotypic DST. High burden of drug-resistant TB makes a serious problem the TB control in India. Treatment of TB infection relies primarily on the use of first-line drugs including Isoniazid (INH) and rifampicin (RIF) with ethambutol (ETB), streptomycin&#xA0; (STR) and pyrazinamide (PZA).17 RIF due to its excellent bactericidal activity is considered to be the efficient drug in the treatment regimen for tuberculosis18. Whereas mono resistance to INH is quite common, mono resistance to RIF is rare. Instead, RIF resistance occurs most often in strains that are also resistant to INH; thus, RIF resistance can be used as a surrogate marker for MDR.19,20&#xD;
&#xD;
DNA sequencing of rpoB gene in MDR TB has an added advantage of increased knowledge of mutation profile of rpoB gene, which may help in the development of a screening protocol, relevant to the geographical area, for early detection of MDR TB.21&#xD;
&#xD;
The mechanism of action of RIF is to inhibit mycobacterial transcription by targeting DNA-dependent RNA polymerase. &#xA0;RIF resistance in M. tuberculosis complex strains emerge as a result of point mutations, or small deletions, or insertions, in a limited region of the gene encoding for the rpoB gene (codons 507-533) encoding 27 amino acids.22 Mutations of the RIF-resistant M. tuberculosis isolates are located in an 81-bp core region, the RIF resistance determining region [RRDR]), of the rpoB gene in about 95-98% of RIF resistant strains.22-24 &#xA0;Two of the rifampicin-resistant isolates obtained phenotypically did not show any mutation in the RRDR region. This may be due to the presence of other rare&#xA0;rpoB&#xA0;mutations or another mechanism of resistance to rifampicin 25.&#xD;
&#xD;
Five phenotypically RIF resistant isolates detected along with the five RIF sensitive isolates were randomly selected and subjected to M.tuberculosis deoxyribonucleic acid (DNA) isolation and amplification using species-specific primers. Of the ten isolates subjected to PCR, amplification of M. tuberculosis was not observed in one isolate, which was also incidentally resistant to all five 1st line drugs including RIF. The isolate was from a diabetic patient who had chronic pain in the left leg and eventually led to the loss of sensation. The left leg had a wound and it was infected and the pus was sent for a culture which grew Mycobacterium spp. by about 40 days of incubation in liquid culture. This isolate was identified as M. tuberculosis complex (MTBC) by phenotypic species identification method, the MGIT TBC Identification Test(Becton Dickinson Diagnostic Instrument Systems, Sparks, MD. &#xA0;The reason for the absence of amplification may be because, though the assay demonstrates 100% sensitivity as reported, the specificity is between 95.2-100% 26. The isolate was a non-tuberculous mycobacterium and was falsely reported positive for MTBC by this test. Fortunately, we did not report this isolate as M.tuberuclosis complex due to the suspicion that it could be non-tuberculous&#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; mycobacteria, especially after the drug resistance pattern. Thus, it is important not to solely rely on the rapid tuberculosis identification methods for identification of M. tuberculosis complex especially if the isolate appears to be resistant to all five drugs. Further speciation of the isolate would then become necessary.&#xD;
&#xD;
In the present study, the only mutation detected was observed at codon 531 (3/5) (TCG-TTG) and was observed in three out of four RIF resistant isolates. This is similar to the reports from various parts of India by&#xA0; Makadia et al., (2012), where the most common sites of mutation were at codon 531 (TCG-TTG), 526 (CAC- TAC) and 516 (GAC-GTC, AAC), with the frequency of mutation at 66.7, 20 and 13.3%, respectively 21. Codons 531, 526, 516 and 511 are reported as the most frequent mutations in the rpoB fragment worldwide.27-29 While TTG at codon 531 and CCG at codon 511 are the dominant mutated alleles, codon 526 and codon 516 show large numbers of allelic variations [29]. Various studies show that mutations at different codons of rpoB could be associated with different levels of RIF resistance. The mutation at codon 531 or 526 was associated with high-level resistance to RIF (minimum inhibitory concentration [MIC] &gt;64 mg/mL) and high-level cross-resistance to all rifamycins, whereas mutation at codon 516 was associated with medium-level resistance to RIF (MIC= 32 mg/mL), but susceptible to rifabutin 30. Thus, our three isolates showed high-level resistance to rifampicin.&#xD;
&#xD;
A study conducted in Tamil Nadu, India,&#xA0; by Deepa et al., (2005), reported that the most commonly reported missense mutation was at codon 531(Ser&#x2192;Leu) in two isolates and one at 526. Rest two samples did not show any mutation in RRDR region.31 Similar observations were made in the present study, where one of the phenotypically detected RIF resistant isolate did not show any mutations on sequencing. A study in Brazil by Andreia et al., (2000), reported that the codons most frequently affected were 531 (TCG-TTG), 526 (CAC-TAC) and 516 (GAC-GTC) with frequencies of 54, 21 and 7%, respectively. About 18% of samples did not show any mutation in RRDR region.32&#xA0; Finding of no mutations in the RRDR of rpoB gene of the single isolate which was phenotypically resistant indicates mutations outside the 81-bp segment (RRDR) of rpoB or additional molecular mechanisms that may be involved in RIF resistance of M. tuberculosis like permeability barrier or membrane proteins acting as drug efflux pumps.33 This may be the reason for no mutations in one out of the four isolates which were showing RIF resistance using phenotypic methods.&#xD;
&#xD;
Studies show that multiple mutations can occur at different nucleotide in the same codons.21 It is also observed that some samples had multiple mutations in RRDR region of rpoB gene.21 No such findings were seen in the present study.&#xD;
&#xD;
Conclusions&#xD;
&#xD;
Molecular methods help in understanding the transmission dynamics of tuberculosis and could be used as a tool in the current control programme locally as well as internationally. It also helps in designing the primers and probes for diagnostic detection of resistance. Genotyping of M. tuberculosis strains together with epidemiological studies may throw a light regarding the transmission of the strain&#xD;
&#xD;
Acknowledgements &#xD;
&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references to this manuscript. The authors are also grateful to authors/ editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed. The authors are thankful to Mapmygenome, Hyderbad for helping with carrying out the molecular studies.&#xD;
&#xD;
&#xA0;Financial Support: None&#xD;
&#xD;
&#xA0;Conflict of Interest: Nil&#xD;
&#xD;
&#xD;
&#xD;
Figure 1: PCR amplification of&#xA0;rpoB&#xA0;gene&#xA0;of phenotypic&#xA0;MDR-TB&#xA0;isolates. PCR product of&#xA0;rpoB&#xA0;was resolved on 1.5%&#xA0;agarose gel. Lane 1-10-shows the&#xA0;&#xA0; amplification of 10 phenotypic sensitive and resistant isolates. Lane 11-Blank, Lane 12-negative control, lane 13- positive control M. tuberculosis H37RV&#xA0; strain ,Lane 14- 100 bp ladder, product size of 411 bp.&#xD;
&#xD;
&#xD;
&#xD;
Figure 2: &#xA0;Distribution of mutations in the&#xA0;rpoB&#xA0;gene among MDR isolates. The figure shows the results of DNA sequencing compared with reference DNA sequence of RRDR of rpoB gene of M. tuberculosis. The observed mutation is in codon 531 and is shown in three isolates which is rifampicin resistant. No mutation in RRDR region of rpoB gene was found in 2 isolates though it was rifampicin resistant.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3451</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3451</Fulltext></URLs><References>1. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; World Health Organization. Global TB report [Internet]. 2018. Available from: WHO/CDS/TB/2018.20&#xD;
&#xD;
2. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Tb D. Global Tuberculosis Tuberculosis. WHO/CDS/ TB/2019. 2019. &#xD;
&#xD;
3. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Ahmad S, Mokaddas E. Current status and future trends in the diagnosis and treatment of drug-susceptible and multidrug-resistant tuberculosis. J Infect Public Health 2014;7(2):75&#x2013;91. &#xD;
&#xD;
4. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Miotto P, Zhang Y, Cirillo DM, Yam WC. Drug resistance mechanisms and drug susceptibility testing for tuberculosis. Respirology 2018;23(12):1098-1113. &#xD;
&#xD;
5. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; De Freitas FAD, Bernardo V, Gomgnimbou MK, Sola C, Siqueira HR, Pereira MAS, et al. Multidrug-resistant Mycobacterium tuberculosis: A retrospective katG and rpoB mutation profile analysis in isolates from a reference centre in Brazil. PLoS One. 2014;9(8):1-11. &#xD;
&#xD;
6. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Prammananan T, Cheunoy W, Taechamahapun D, Yorsangsukkamol J, Phunpruch S, Phdarat P, et al. Distribution of rpoB mutations among multidrug-resistant Mycobacterium tuberculosis (MDRTB) strains from Thailand and development of a rapid method for mutation detection. Clin Microbiol Infect 2008;14(5):446&#x2013;453. &#xD;
&#xD;
7. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Telenti A, Imboden P, Marchesi F, Lowrie D, Cole S, Colston MJ, et al. Detection of rifampicin-resistance mutations in Mycobacterium tuberculosis. Lancet 1993;341:647-650. &#xD;
&#xD;
8. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Kapur V, Li LL, Iordanescu S&#xA0; et al. Characterization by automated DNA sequencing of mutations in the gene (rpoB) encoding the RNA polymerase beta subunit in rifampin-resistant Mycobacterium tuberculosis strains from New York City and Texas. J Clin Microbiol 1994;32(4):1095?1098. &#xD;
&#xD;
9. &#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; Molina-Moya B, Abdurrahman ST, Madukaji LI, Gomgnimbou MK, Spinasse L, Gomes-Fernandes M, et al. Genetic characterization of Mycobacterium tuberculosis complex isolates circulating in Abuja, Nigeria. Infect Drug Resist 2018;11:1617&#x2013;1625. &#xD;
&#xD;
10. &#xA0;&#xA0;&#xA0;&#xA0; Prim RI, Sch&#xF6;rner MA, Senna SG, Nogueira CL, Figueiredo ACC, de Oliveira JG, et al. Molecular profiling of drug resistant isolates of Mycobacterium tuberculosis in the state of Santa Catarina, southern Brazil. Mem Inst Oswaldo Cruz 2015;110(5):618&#x2013;623. &#xD;
&#xD;
11. &#xA0;&#xA0;&#xA0;&#xA0; Brudey K, Driscoll JR, Rigouts L, Prodinger WM, Gori A, Al-hajoj SA, et al. Mycobacterium tuberculosis complex genetic diversity?: mining the fourth international spoligotyping database ( SpolDB4 ) for classification, population genetics and epidemiology. BMC Microbiol 2006;17:1&#x2013;17. &#xD;
&#xD;
12. &#xA0;&#xA0;&#xA0;&#xA0; Barnes PF. Molecular epidemiology of tuberculosis. N Eng J Med 2003;349:1149&#x2013;1156. &#xD;
&#xD;
13. &#xA0;&#xA0;&#xA0;&#xA0; Romero BA, Aranaz L, Juan JA, lvarez J, Bezos A, Mateos EG. Molecular epidemiology of multidrugresistant Mycobacterium Bovis isolates with the same spoligotyping profile as isolates from animals. J Clin Microbiol 2006;44(9):3405&#x2013;3408. &#xD;
&#xD;
14. &#xA0;&#xA0;&#xA0;&#xA0; Zignol M, Hosseini MS, Wright A, van Weezenbeek CL, Nunn P, Watt CJ, et al. Global incidence of multidrugresistant tuberculosis. J Infect Dis 2006;194:479-485. &#xD;
&#xD;
15. &#xA0;&#xA0;&#xA0;&#xA0; Sunil S, Manisha B, Chatterjee SS, Abhishek M, Singh SKK, Meera S. Susceptibility pattern among pulmonary and extrapulmonary isolates of Mycobacterium tuberculosis in north India. African J Microbiol Res 2012;6(15):3696&#x2013;3699. &#xD;
&#xD;
16. &#xA0;&#xA0;&#xA0;&#xA0; Rahman M, Kamal SM, Mohammed FR, Alam MB. Anti?tuberculosis drug resistance pattern among the different category of tuberculosis patients. J Med 2009;10:45-47. &#xD;
&#xD;
17. &#xA0;&#xA0;&#xA0;&#xA0; World Health Organization. Treatment of tuberculosis: Guidelines for national programmes. 3rd Edition, WHO, Geneva. 2003. &#xD;
&#xD;
18. &#xA0;&#xA0;&#xA0;&#xA0; Burman WJ, Gallicano K, Peloquin C. Comparative pharmacokinetics and pharmacodynamics of the rifamycin antibacterials. Clin Pharmacokinet 2001;40, 327-341. &#xD;
&#xD;
19. &#xA0;&#xA0;&#xA0;&#xA0; Alcaide F, Ben&#xED;tez MA, Escrib&#xE0; JM, Mart&#xED;n R. Evaluation of the BACTEC MGIT 960 and the MB/BacT systems for recovery of mycobacteria from clinical specimens and for species identification by DNA AccuProbe. J Clin Microbiol 2000;38(1):398&#x2013;401. &#xD;
&#xD;
20. &#xA0;&#xA0;&#xA0;&#xA0; Yon J, Ryu M. Diagnosis of Pulmonary Tuberculosis: Recent Advances and Diagnostic Algorithms. Tuberc Respir Dis 2015;78(2):64&#x2013;71. &#xD;
&#xD;
21. &#xA0;&#xA0;&#xA0;&#xA0; Makadia JS, Jain A, Kumar S, Sherwal PBL, Khanna A. Emerging Trend of Mutation Profile of rpoB Gene in MDR Tuberculosis, North India 2012;27(4):370&#x2013;374. &#xD;
&#xD;
22. &#xA0;&#xA0;&#xA0;&#xA0; Somoskovi A, Parsons LM, Salfinger M. The molecular basis of resistance to isoniazid, rifampin, and pyrazinamide in Mycobacterium tuberculosis. Respir Res 2001;2:164&#x2013;168. &#xD;
&#xD;
23. &#xA0;&#xA0;&#xA0;&#xA0; Simon S. Drug resistance in Mycobacterium tuberculosis: a molecular perspective. Madjalah Kedokt Indones 2003;4:26-35. &#xD;
&#xD;
24. &#xA0;&#xA0;&#xA0;&#xA0; Hillemann D, Weizenegger M. Use of the genotype MTBDR assay for rapid detection of rifampin and isoniazid resistance in Mycobacterium tuberculosis complex isolates. J Clin Microbiol 2005;43:3699-703. &#xD;
&#xD;
25. &#xA0;&#xA0;&#xA0;&#xA0; Qazi O, Rahman H, Tahir Z, Qasim M, Khan S, Ahmad AA, et al. Mutation pattern in rifampicin resistance determining region of rpoB gene in multidrug-resistant Mycobacterium tuberculosis isolates from Pakistan. Int J Mycobacteriol 2014;3(3):173-177. &#xD;
&#xD;
26. &#xA0;&#xA0;&#xA0;&#xA0; Gaillard T, Fabre M, Martinaud C, Vong R, Brisou P. Assessment of the SD Bioline Ag MPT64 Rapid and the MGIT TBc identification tests for the diagnosis of tuberculosis. Diagn Microbiol Infect Dis 2011;70(1):154&#x2013;156. &#xD;
&#xD;
27. &#xA0;&#xA0;&#xA0;&#xA0; Ahmad S, Mokaddas E, Fares E. Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Kuwait and Dubai. Diagn Microbiol Infect Dis 2002;44(3):245&#x2013;252.&#xD;
&#xD;
28. &#xA0;&#xA0;&#xA0;&#xA0; Bakonyte D, Baranauskaite A, Cicenaite JS, Stakenas P. Mutations in the rpoB gene of rifampin-resistant Mycobacterium tuberculosis clinical isolates from Lithuania. Int J Tuberc Lung Dis 2005;9:936&#x2013;938. &#xD;
&#xD;
29. &#xA0;&#xA0;&#xA0;&#xA0; Cavusoglu C, Hilmioglu S, Guneri S, Bilgic A. Characterization of rpoB Mutations in Rifampin-Resistant Clinical Isolates of Mycobacterium tuberculosis from Turkey by DNA Sequencing and Line Probe Assay. J Clin Microbiol 2002;40(12):4435&#x2013;8. &#xD;
&#xD;
30. &#xA0;&#xA0;&#xA0;&#xA0; Dalal A, Pawaskar A, Das M, Desai R, Prabhudesai P, Chhajed P&#xA0; et al. Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time. PLoS One 2015;10(1):e0116798. &#xD;
&#xD;
31. &#xA0;&#xA0;&#xA0;&#xA0; Deepa P, Therese KL, Madhavan HN. Detection and characterization of mutations in rifampicin resistant mycobacterium tuberculosis clinical isolates. Indian J Tuberc 2005;6:132&#x2013;136. &#xD;
&#xD;
32. &#xA0;&#xA0;&#xA0;&#xA0; Andreia RM, Lucia M, Rossetti R, Ribeiro MO ZA. Mutations in rpoB gene of multidrug resistant Mycobacterium tuberculosis isolates from Brazil. J Clin Microbiol 2000;38:3119&#x2013;3122. &#xD;
&#xD;
33. &#xA0;&#xA0;&#xA0;&#xA0; Banik A, Das N, Wihiwot V, Lyngdoh ACP, Dut V. Prevalence and first-line drug sensitivity trends of Mycobacterium tuberculosis at a tertiary center in North-East India. Egypt J Chest Dis Tuberc 2018;67:32&#x2013;37. &#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>The Effect of Superimposed Effect of Proprioceptive Sensory Stimulation Taping (Elastic Taping) and PNF on Function Improvement and Stiffness Reduction in Neurological Injury&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>132</FirstPage><LastPage>140</LastPage><AuthorList><Author>Jung-Ho Lee</Author><AuthorLanguage>English</AuthorLanguage><Author> Yong-Jin Jeon</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Stroke and subsequent neurological damage negatively impacts patients and their families. Most prominent manifestation of stroke if loss of sensory and motor capacities of patients. Objective: This study aims to determine the effect of elastic taping applied to the upper extremities before applying the proprioceptive neuromuscular facilitation (PNF) upper extremity pattern on the rehabilitation of upper extremity functions of stroke patients. Methods: The study groups (n=28) were divided using the random selection method into an experimental group consisting of 14 patients who applied taping before the treatment of PNF upper extremity pattern and a control group consisting of 14 patients who did not apply taping before the treatment of PNF upper extremity pattern. The PNF pattern used upper extremity D2 flexion, D1 flexion, D2 extension, D1 extension, and chopping patterns, and the elastic taping on the upper extremities, all of which were applied to the deltoid, supraspinatus, infraspinatus, pectoralis major, triceps brachii, and wrist extensor. To evaluate the improvement of the upper extremity functions after the intervention, the Korean Version of Modified Barthel Index (K-MBI), the Korean version of Fugl-Meyer assessment, and the Action Research Arm Test were used. Results: The study analysis results showed that there was a significant difference in the assessment results within groups as well as between groups. Conclusion: The PNF and elastic taping treatment applied to patients with stroke have positively improved the upper extremity functions due to the synergistic effect between two interventions.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Rehabilitation, Nervous System, PNF, Taping, Function</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
A stroke is a disease that is accompanied by various symptoms as a result of the loss of cerebral functions caused by cerebrovascular ischemia or bleeding.1 A stroke can incur various disabilities depending on the damage location and intensity in the brain. Most stroke patients experience degradation in maintaining posture, functional movements, sense of balance, and gait ability due to asymmetric body alignment. Neurological damage occurs after a stroke, which negatively impacts not only patients themselves but also patients&#x2019; families and society due to the aftereffects or complications. A stroke is a disease that should be urgently treated as a medical and social problem, as clinical symptoms of stroke, such as motor disturbance, sensory disturbance, decreased consciousness, dysphasia, and cognitive impairment can be found.2 &#xD;
&#xD;
In particular, patients with stroke have a functional disability performing the independent activities of daily living, due to motor control impairments caused by muscle strength weakening, abnormal muscle tone and abnormal movement patterns.3 This impairment is followed by the limitation of functional performance levels for activities such as walking, climbing stairs, and self-caring. Stroke leads to proprioceptive sensory impairments, and its lesion in the upper motor neuron degrades the body&#x2019;s ability to balance, which worsens over time as stiffness occurs.4 Proprioception plays an important role in neuron-motor control and proprioceptors, which intervene in proprioception and are distributed in the muscles, joints, ligaments, tendons, and skin. It is divided into muscle receptors that are sensitive to mechanical stimuli, joint receptors, and skin receptors. Proprioception is information received from these three receptors. To explain this functionally, proprioception is information received at an unconscious level rather than a conscious level and is defined as the perception of posture, movements, or balance change concerning the body, as well as weight and resistance against specific objects.5&#xD;
&#xD;
Most stroke patients experience functional motor disturbance in the upper extremities, and this disturbance lasts for a long period. In particular, if the control of voluntary muscles is lost due to motor disturbance, an imbalance between flexors and extensors occurs.6 As a result, stroke patients cannot sustain the weight of their upper extremities due to muscle paralysis in the shoulder, limiting the joint range of motion as well as incurring shoulder subluxation and rigidity, resulting in the severe reduction in upper extremity functions. The problems in the upper extremities occurring in stroke patients have a significant impact on the independent activities of daily living due to the reduction in control ability of the upper extremities as a result of rigidity and muscle strength weakening.7 &#xD;
&#xD;
The degradation in upper extremity functions varies depending on the region of the brain that was damaged, which requires constant management due to the disabilities caused by the damage. Thus, the important part of the rehabilitation in the upper extremities of stroke patients aims to improve the quality of life by increasing the remaining functions through the minimization of the disabilities. The motor disturbance in the upper extremities due to stroke is one of the most general aftereffects and has a significant impact on the performance of daily living activities.8 Despite intensive and various therapeutic approaches, the recovery of upper extremity functions of stroke patients is limited. Generally, the recovery of paralysis in the upper extremities is not better than that in the lower extremities because movements in the upper extremities in the affected side are difficult due to the contracture and non-use of the paralyzed extremities, muscle strength weakening, dysaesthesia, and the frequency of their use gradually decreasing.9,10&#xD;
&#xD;
Besides, damage to proprioception occurs in stroke patients, and this damage delays the recovery of motor functions. Moreover, if the damage to proprioception continues in patients who achieve appropriate muscle strength recovery after stroke, performing daily living activities would be difficult for them.11 Proprioception is the unconscious information regarding the position and movement of the skin, muscles, tendons, and joints, which is regarded as the physical ability to deliver the body a sense of position and interpret information. Proprioception is utilized as the basic information of balance and paresthesia, and maintains the correct posture through the feedback and feedforward mechanism and achieves the proper body movements. If the damage to proprioception continues, patients will excessively depend on visual information during daily activities, which further delays the recovery of proprioception. Thus, it is important to evaluate and train proprioception correctly in the rehabilitation process of stroke patients.12 &#xD;
&#xD;
Proprioceptors that contribute to proprioception in the muscles and tendons react sensitively to the muscle length and muscle tone via muscle spindles and tendon organs of the Golgi body, thereby playing an important role in recognizing the movement and position of joints.13 Proprioceptors distributed in the joints are mostly found in articular capsules and ligaments. They react in the entire range of joint movements and provide proprioceptive sensory information that helps correct and control joint movements.14&#xD;
&#xD;
To have normal daily activities and improvements on the quality of life of hemiplegic patients due to stroke, efforts are needed to recover the performance of daily activities, muscle activities, upper extremity functions, and gait ability to the level before the outbreak of stroke through the recovery of physiological functions in the upper and lower extremities in the affected side, alleviation of weight-bearing asymmetry, and improvement of postural stability.15 For hemiplegic patients, exercises to develop the central nervous system (CNS), such as proprioceptive neuromuscular facilitation (PNF), have been applied for general functional recovery.16,17&#xD;
&#xD;
Although methods to increase the functional activities of the upper extremities and trunk strengthening exercises through PNF upper extremity patterns have been widely employed in clinical fields, few studies have been conducted on the effect of taping with a positive impact on the increase of muscle strength and muscle re-education before applying the PNF pattern about the upper extremities.18-21 Thus, this study aims to determine the effect of elastic taping applied to the upper extremities before PNF upper extremity pattern treatment on the rehabilitation of upper extremity functions of stroke patients, thereby providing foundational data to improve the activities of daily living in stroke patients. &#xD;
&#xD;
MATERIALS AND METHODS &#xD;
&#xD;
Subjects&#xD;
&#xD;
&#xA0;&#xA0; This study selected 28 stroke patients who were treated in the hospital. The subjects who participated in this study were fully informed of the purpose of the study and the methods and gave their written consent to voluntarily participate. The study groups were divided using the random selection method into an experimental group consisting of 14 patients who applied taping before the treatment of PNF upper extremity pattern, and a control group consisting of 14 patients who did not apply to tape before the treatment of PNF upper extremity pattern. The subjects voluntarily participated in the study after being fully informed of its purpose and contents, experimental procedures, and stability. They also submitted written participation consent before the experiment. All experimental procedures were performed following the Declaration of Helsinki.&#xD;
&#xD;
The selection criteria of the study subjects were hemiplegic patients who were diagnosed with stroke six months to two years ago, patients who had more than 24 points in the Korean version of the Mini-Mental State Examination (MMSE-K), patients without congenital deformity, patients without respiratory functional problems due to respiratory and cardiovascular diseases, patients without orthopaedic problems that may affect the study, and patients who could follow the instructions of the researcher. This study excluded patients who were participating in regular exercises or other exercise programs, patients with cerebellar diseases, patients with other diseases that may affect the upper extremity activities, and patients who were taking medicine to reduce spasticity.&#xD;
&#xD;
Both the experimental and control groups in this study took the treatment using the PNF upper extremity patterns during the neurodevelopmental treatment. For the experimental group, elastic taping was applied to the upper extremities before the PNF treatment. The control group was treated using the PNF upper extremity patterns without applying taping to the upper extremities for 30 min. For the assessment in this study, prior assessments were conducted before the therapeutic intervention, and then post-assessments were conducted after the last treatment. All groups had a total of 20 therapeutic interventions, five times a week for four weeks as shown in Figure 1.&#xD;
&#xD;
Treatments&#xD;
&#xD;
Elastic Taping&#xD;
&#xD;
To apply the taping therapy to the upper extremities, taping for shoulder stability and taping for suppression of flexor muscles in the upper extremities were used. The elastic taping for shoulder stability was applied to the deltoid, supraspinatus, infraspinatus, and pectoralis major, and the taping for suppression of the flexor in the upper extremities was applied to the triceps brachii and wrist extensor. &#xD;
&#xD;
For the anterior part of the deltoid, the elastic tape was applied from the tuberosity of the humerus up to the coracoid process while extending the upper extremity to the back and slightly abducting. For the posterior part of the deltoid, taping was applied to the distal 1/3 of the spine of the scapula while placing the patients&#x2019; hand at the shoulder of the opposite side. The supraspinatus taping was attached in the direction of the greater tuberosity of the humerus on the affected side to the supraspinous fossa in the scapula. The upper part of the infraspinatus taping was taped from the medial bottom of the spine of the scapula, and the lower part was taped from the angulus inferior scapulae and attached to the upper lateral part of the humerus while having the patients&#x2019; handhold the scapular region on the opposite side; thereby lifting the scapular region on the side of the tape. &#xD;
&#xD;
&#xD;
&#xD;
The pectoralis major was taped from the 1/3 of the anterior humerus, which was separated from the deltoid while maintaining the external rotation and extension of the shoulder joint a little, and both the horizontal abduction in the shoulder joint and elbow joint were bent at 90&#xB0;. The upper tape was attached to the sternoclavicular joint, and the lower tape was attached to the side of the papilla and wrapped around the sternal area of the pectoralis major. The triceps brachii was taped from the elbow joint attached to the lateral side of the scapula while maintaining the horizontal adduction of the shoulder joint at 120&#xB0; and flexion of the elbow joint at 90&#xB0; for the medial side. For the lateral side, the tape was attached to the lateral side slightly from the centre of the shoulder after the shoulder joint was lower at 70&#xB0;. The wrist extensor was taped from the volar wrist on the affected side to extend the wrist joint, and the tape was attached to both the medial and lateral sides of the humeral epicondyle.&#xD;
&#xD;
Proprioceptive Neuromuscular Facilitation (PNF)&#xD;
&#xD;
Among the several types of proprioceptive neuromuscular facilitation was used as general physical therapy for both groups in this study. PNF treatment was applied to all patients using all five patterns below.&#xD;
&#xD;
1) Upper extremity D2 flexion (Shoulder extension/adduction/internal rotation pattern): Subjects laid down in a supine hook lying position in which their hip and knee joints were flexed. In this position, the arm on the affected side, which was about to perform the exercise, was positioned at the 11 o&amp;#39;clock position, and the arm on the unaffected side was comfortably placed beside the trunk, and then shoulder flexion-abduction-lateral rotation occurred in the 7 o&amp;#39;clock direction of the patient, according to our direction.&#xD;
&#xD;
2) Upper extremity D1 flexion (Shoulder extension/abduction/internal rotation pattern): Subjects laid down in a supine hook lying position in which their hip and knee joints were flexed. In this position, the arm on the affected side, which was about to perform the exercise, was positioned at the 1 o&amp;#39;clock position, and the arm on the unaffected side was comfortably placed beside the trunk. Then, shoulder flexion-adduction-lateral rotation occurred in the 5 o&amp;#39;clock direction of the patient, according to our direction.&#xD;
&#xD;
3) Upper extremity D2 extension (Shoulder flexion/abduction/lateral rotation): Subjects laid down in a supine hook lying position in which their hip and knee joints were flexed. In this position, the arm on the affected side, which was about to perform the exercise, was positioned at the 7 o&amp;#39;clock position, and the arm on the unaffected side was comfortably placed beside the trunk. Then, shoulder extension-adduction-lateral rotation occurred in the 11 o&amp;#39;clock direction of the patient, according to our direction.&#xD;
&#xD;
4) Upper extremity D1 extension (Shoulder flexion/adduction/lateral rotation): Subjects laid down in a supine hook lying position in which their hip and knee joints were flexed. In this position, the arm on the affected side, which was about to perform the exercise, was positioned at the 5 o&amp;#39;clock position, and the arm on the unaffected side was comfortably placed beside the trunk. Then, shoulder extension-adduction-lateral rotation occurred in the 1 o&amp;#39;clock direction of the patient, according to the researcher&amp;#39;s direction.&#xD;
&#xD;
5) Upper extremity chopping pattern (Chopping pattern): In the supine hook lying position, the leading arm on the affected side of the subjects performed shoulder joint flexion/adduction/external rotation, the scapula was in anterior elevation, the elbow joint was in extension-supination, and the wrist was in flexion-radial deviation. The trailing arm on the unaffected side performed chopping (shoulder joint extension/abduction/internal rotation, the scapula posterior depression, elbow joint extension-pronation, and wrist extension-ulnar deviation) while holding the wrist on the affected side and having the shoulder joint of the arm on the unaffected side in a flexion/abduction/external rotation state, according to the instruction of the researcher. &#xD;
&#xD;
Each of these patterns was applied 10 times and a three minutes rest was given between patterns.&#xD;
&#xD;
Assessment Methods&#xD;
&#xD;
Korean Version of Modified Barthel Index (K-MBI)&#xD;
&#xD;
In this study, the daily living activities of stroke patients were assessed using the Korean Version of the Modified Barthel Index (K-MBI). The composition of the K-MBI for activity assessment if the task could not be performed at all was set to step 1 (0 point), and if the task could be done completely independently, it was set to step 5. Thus, the better the patient&#x2019;s independence in completing tasks, the higher the step was with an increasing number of points for each step. The K-MBI consisted of 10 items: personal hygiene, bathing, feeding, toilet transfer, stair climbing, dressing, bowel control, bladder control, ambulation, and chair/bed transfers, and the total score that could be reached was 100 points.&#xD;
&#xD;
Korean version of Fugl-Meyer Assessment&#xA0; (K-FMA)&#xD;
&#xD;
The Korean version of Fugl-Meyer Assessment (K-FMA) is a method used to quantitatively assess the functional recovery of stroke patients based on the recovery steps of motor functions after stroke. It consists of the upper extremity (66 points), lower extremity (34 points), balance (14 points), sensation (24 points), passive joint motion (44 points), and joint pain (44 points). Thus, it comprises six domains, and the total possible score is 226 points. For each item, zero to two points are scored, and the higher the score is, the better the motor control is. This study evaluated only the wrist (10 points) and hand (14 points), which are the distal portion items in the FMA to assess the motor performance ability in the upper extremity.&#xD;
&#xD;
Action Research Arm Test (ARAT)&#xD;
&#xD;
The Action Research Arm Test (ARAT) is an evaluative measure used to assess the functions of the upper extremities. This test consists of 19 items, and the total possible score is 57 points. Item scores are summed to create four sub-scale scores: grasp (18 points), grip (12 points), pinch (18 points), and gross motor (9 points). Prior tests were conducted before the therapeutic intervention in all of the above assessments, and the post-tests were conducted after the final therapeutic intervention.&#xD;
&#xD;
Data Analysis&#xD;
&#xD;
SPSS version 18.0 was used for the statistics of this study, and the mean &#xB1; standard deviation was described through descriptive statistics. To determine the difference between groups, an independent sample t-test and paired sample t-test were conducted to compare the results within groups before and after the intervention. The significance level of all statistical data analyses was set at &#x3B1; &lt; 0.05.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
The K-MBI score had a statistically significant difference before and after the experiment in both the experimental and control groups (P &lt; 0.05). The comparison of the difference in the therapeutic effects, according to the therapeutic intervention, showed that the experimental group had more statistically significant differences than the control group (P &lt; 0.05) (Figure 2). &#xD;
&#xD;
The K-FMA wrist score had a statistically significant difference before and after the experiment in both the experimental and control groups (P &lt; 0.05). The comparison of the differences in the therapeutic effects, according to the therapeutic intervention, showed no statistically significant difference between the experimental and control groups (P &gt; 0.05) (Figure 3). However, the FMA hand score had a statistically significant difference before and after the experiment only in the experimental group (P &lt; 0.05), and the comparison of the difference in the therapeutic effects, according to the therapeutic intervention, showed no statistically significant difference between the experimental and control groups (P &gt; 0.05) (Figure 4). &#xD;
&#xD;
&#xD;
&#xD;
Figure 2: Comparison of MBI wrist score between groups. *p</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3452</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3452</Fulltext></URLs><References>&#xD;
	&#xD;
	Koh SH, Park HH. Neurogenesis in stroke recovery. Transl Stroke Res 2017;8(1):3-13.&#xD;
	&#xD;
	&#xD;
	Winters C, Kwakkel G, van Wegen EE, Nijland RH, Veerbeek JM, Meskers CG. Moving stroke rehabilitation forward: the need to change research. Neuro Rehabilitation 2018;43(1):19-30.&#xD;
	&#xD;
	&#xD;
	Knight-Greenfield A, Nario JJ, Gupta A. Causes of acute stroke: a patterned approach. Radiol Clin North Am 2019;57(6):1093.&#xD;
	&#xD;
	&#xD;
	Findlater SE, Dukelow SP. Upper extremity proprioception after stroke: bridging the gap between neuroscience and rehabilitation. J Motor Behav 2017;49(1):27-34.&#xD;
	&#xD;
	&#xD;
	Delhaye BP, Long KH, Bensmaia SJ. The neural basis of touch and proprioception in primate cortex. Compreh Physiol 2011;8(4):1575-602.&#xD;
	&#xD;
	&#xD;
	Kim JS, Caplan LR, Wong KS (eds): Intracranial Atherosclerosis: Pathophysiology, Diagnosis and Treatment. Front Neurol Neurosci 2016;40:58-71.&#xD;
	&#xD;
	&#xD;
	Etoom M, Hawamdeh M, Hawamdeh Z, Alwardat M, Giordani L, Bacciu S, Scarpini C, Foti C. Constraint-induced movement therapy as a rehabilitation intervention for upper extremity in stroke patients: systematic review and meta-analysis. Int J Rehabilit Res 2016;39(3):197-210.&#xD;
	&#xD;
	&#xD;
	Coutts SB. Preventing unnecessary disability after stroke in Scotland. Lancet 2019 Oct 5;394(10205):1225-1226.&#xD;
	&#xD;
	&#xD;
	Choi JH, Pile-Spellman J. Reperfusion changes after stroke and practical approaches for neuroprotection. Neuroimaging Clin 2018;28(4):663-682.&#xD;
	&#xD;
	&#xD;
	Klamroth-Marganska V. Stroke rehabilitation: Therapy robots and assistive devices. In Sex-Specific Analysis of Cardiovascular Function 2018:579-587.&#xD;
	&#xD;
	&#xD;
	Jung KM, Choi JD. The Effects of Active Shoulder Exercise with a Sling Suspension System on Shoulder Subluxation, Proprioception, and Upper Extremity Function in Patients with Acute Stroke. Int Med J Exp Clin Res 2019;25:4849.&#xD;
	&#xD;
	&#xD;
	Ghai S, Driller M, Ghai I. Effects of joint stabilizers on proprioception and stability: a systematic review and meta-analysis. Phys Therapy Sport 2017;25:65-75.&#xD;
	&#xD;
	&#xD;
	Aiello BR, Hardy AR, Westneat MW, Hale ME. Fins as mechanosensors for movement and touch-related behaviors. Integr Compar Biol 2018;58(5):844-859.&#xD;
	&#xD;
	&#xD;
	Ager AL, Roy JS, Roos M, Belley AF, Cools A, H&#xE9;bert LJ. Shoulder proprioception: how is it measured and is it reliable? A systematic review. J Hand Therapy 2017;30(2):221-231.&#xD;
	&#xD;
	&#xD;
	Cassidy JM, Cramer SC. Spontaneous and therapeutic-induced mechanisms of functional recovery after stroke. Transl Stroke Res 2017;8(1):33-46.&#xD;
	&#xD;
	&#xD;
	de Oliveira KC, de Souza LA, Emilio MM, da Cunha LF, Lorena DM, Bertoncello D. Overflow using proprioceptive neuromuscular facilitation in post-stroke hemiplegics: A preliminary study. J Bodywork Movem Therap 2019;23(2):399-404.&#xD;
	&#xD;
	&#xD;
	Birinci T, Razak Ozdincler A, Altun S, Kural C. A structured exercise programme combined with proprioceptive neuromuscular facilitation stretching or static stretching in posttraumatic stiffness of the elbow: a randomized controlled trial. Clin Rehabilit 2019;33(2):241-252.&#xD;
	&#xD;
	&#xD;
	Sung YB, Lee JC, Kim K. Effects of taping and proprioceptive neuromuscular facilitation for stance phase duration of stroke patients. J Phys Therapy Sci 2017;29(11):2031-2034.&#xD;
	&#xD;
	&#xD;
	Lee SH. Related Factors of Health Behavior Compliance among Cardiac Rehabilitation Patients. Int J IT-based Public Health Mgmt 2019;6(1):73&#x2013;82.&#xD;
	&#xD;
	&#xD;
	Park YK. The Special Education Teachers&#x2019; Perception on Independent Living Skills of Students with Intellectual Disabilities. Int J IT-based Public Health Mgmt 2019;6(1);65&#x2013;72.&#xD;
	&#xD;
	&#xD;
	Chae MJ. The effect of simulation-based SBAR education program for nursing students. Int J IT-based Public Health Mgmt 2019;6(1):53&#x2013;58.&#xD;
	&#xD;
	&#xD;
	Jassi FJ, Del Ant&#xF4;nio T, Moraes R, George SZ, Chaves TC. Effects of functional taping compared with sham taping and minimal intervention on pain intensity and static postural control for patients with non-specific chronic low back pain: a randomised clinical trial protocol. Physiotherapy 2017;103(2):154-9.&#xD;
	&#xD;
	&#xD;
	Park YD, Park YJ, Park SS, Lee HL, Moon HH, Kim MK. Effects of taping therapy for carpal space expansion on electrophysiological change in patients with carpal tunnel syndrome. J Exerc Rehabilit 2017 Jun;13(3):359.&#xD;
	&#xD;
	&#xD;
	Shinozaki K, Nito M, Kobayashi S, Hayashi M, Miyasaka T, Hashizume W, Shindo M, Naito A. Monosynaptic facilitation of group I afferents between brachioradialis and extensor carpi radialis in humans. Neurosci Res 2017;114:30-34.&#xD;
	&#xD;
	&#xD;
	Lyle MA, Nichols TR. Evaluating intermuscular Golgi tendon organ feedback with twitch contractions. J Physiol 2019;597(17):4627-4642.&#xD;
	&#xD;
	&#xD;
	Nayanti AP, Prabowo T, Sari DM. The Effects of Kinesio Taping and Quadriceps Muscle Strengthening Exercise on Quadriceps Muscle Strength and Functional Status in Knee Osteoarthritis. J Med Health 2020;2(5).&#xD;
	&#xD;
	&#xD;
	Kim BR, Kang TW. The effects of proprioceptive neuromuscular facilitation lower-leg taping and treadmill training on mobility in patients with stroke. Int J Rehabilit Res 2018;41(4):343-348.&#xD;
	&#xD;
	&#xD;
	Kim M, Yoo K. Effect of Ankle Taping Type and Jump Height on Balance during Jump Landing in Chronic Ankle Instability. J Int Acad Phys Ther Res 2020;11(2):2077-2089.&#xD;
	&#xD;
	&#xD;
	Matheus JP, Zille RR, Matheus LB, Lemos TV, Carregaro RL, Shimano AC. Comparison of the mechanical properties of therapeutic elastic tapes used in sports and clinical practice. Phys Ther Sport 2017;24:74-78.&#xD;
	&#xD;
	&#xD;
	R&#xF6;ijezon U, Clark NC, Treleaven J. Proprioception in musculoskeletal rehabilitation. Part 1: Basic science and principles of assessment and clinical interventions. Manual Ther 2015;20(3):368-377.&#xD;
	&#xD;
	&#xD;
	Clark NC, R&#xF6;ijezon U, Treleaven J. Proprioception in musculoskeletal rehabilitation. Part 2: Clinical assessment and intervention. Manual Ther 2015;20(3):378-387.&#xD;
	&#xD;
	&#xD;
	Mirek E, Filip M, Banaszkiewicz K, Rudzi?ska M, Szymura J, Pasiut S, et al. The effects of physiotherapy with PNF concept on gait and balance of patients with Huntington&amp;#39;s disease&#x2013;pilot study. Neurologia i neurochirurgia polska. 2015;49(6):354-347.&#xD;
	&#xD;
	&#xD;
	Gunning E, Uszynski MK. Effectiveness of the proprioceptive neuromuscular facilitation method on gait parameters in patients with stroke: a systematic review. Arch Phys Med Rehabilit 2019;100(5):980-986.&#xD;
	&#xD;
	&#xD;
	Ribeiro TS, Silva WH, de Alencar Caldas VV, Silva DL, Cavalcanti FA, Lindquist AR. Effects of a training program based on the proprioceptive neuromuscular facilitation method on post-stroke motor recovery: a preliminary study. J Bodywork Movement Therap 2014;18(4):526-532.&#xD;
	&#xD;
	&#xD;
	Jones K, Forward M. Examining the Patterns of PNF in the Upper Limb during Normal Walking. Physiotherapy 2002;88(4):236-237.&#xD;
	&#xD;
	&#xD;
	Khamwong P, Pirunsan U, Paungmali A. A prophylactic effect of proprioceptive neuromuscular facilitation (PNF) stretching on symptoms of muscle damage induced by eccentric exercise of the wrist extensors. J Bodywork Movement Therap 2011;15(4):507-16.&#xD;
	&#xD;
	&#xD;
	Pin A, Filho S. Proprioceptive neuromuscular facilitation &#x2013; PNF influence in the change of rectus femoris fiber view through surface electromyography and analogic dynamometry. Physiotherapy 2015;101:e1213&#x2013;e1214.&#xD;
	&#xD;
	&#xD;
	Lee JH, Sung YB, Lee DH. The Rehabilitation Effect of PNF after Applying Upper Extremity Taping on Patients with Central Nervous System Injuries. Int J IT-Based Public Health Mgmt 2020;7(2):1-6.&#xD;
	&#xD;
	&#xD;
	Bertinchamp U. Facilitazione propriocettiva neuromuscolare: concetto PNF (Kabat-Knott-Voss). EMC-Medicina Riabilitativa 2017;24(4):1-2.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Study of Incidence of Persistent Sciatic Vein in Indian Population&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>141</FirstPage><LastPage>144</LastPage><AuthorList><Author>Sachin Patil</Author><AuthorLanguage>English</AuthorLanguage><Author> Vaibhav Anjankar</Author><AuthorLanguage>English</AuthorLanguage><Author> Ganesh Trivedi</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: The sciatic vein serves as the most important collector of blood from the lower limb during the prenatal period. Sciatic veins are predominant veins of developing lower limb until 22 mm stage of the embryo, after which they involutes and the femoral system develops as a major venous system. Persistent sciatic vein (PSV) may be the failure of development of femoral vessels or failure in regression of sciatic vessels. Objective: To study the incidence of persistent sciatic vein on the lower limbs and review the literature on the subject. Methods: Fifty lower limbs from 25 cadavers preserved in formaldehyde were dissected at the department of Anatomy ANIIMS, during 2016 -2020, and the sciatic vein was observed in lower limbs. Results: The normal anatomy of the femoral veins were found in 48 among 50 limbs (96%). Persistent sciatic veins (PSV) were found in 2 of 50 limbs (4%). In one of the left lower limb, PSV was 54 cm long, originating from vena committees of the anterior tibial artery in the anterior compartment of the leg, having communications with the popliteal vein in the popliteal fossa. The PSV in one right lower limb was 37 cm long, originating from a popliteal vein near the apex of the popliteal fossa, running upwards in back of thigh accompanied by sciatic nerve. Conclusion: Sciatic vein (PSV) has been associated with patients with Klippel-Trenaunay Syndrome and in patients with recurrent varicose veins There is a high incidence of pulmonary embolism is seen in patients with PSV. Therefore, it must be investigated aiming at a better clinical or surgical management.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Sciatic, Vein, Klippel-Trenaunay Syndrome, Phlebography, Varicose, Embryonic</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Persistent Sciatic Vein (PSV) is a very rare anatomic variation that was first described by Servelle M in 1978. The Persistent sciatic vein is an embryonic vein which may persist with or without the presence of femoral veins and its tributaries.1 The sciatic vein if present acts as the main venous channel for drainage when the femoral vein is blocked. The diagnosis of PSV was difficult by using phlebography but with the advance of Magnetic Resonance Imaging, it became easier to diagnose such cases.2&#xD;
&#xD;
The Persistent Sciatic vein (PSV) is mainly due to defective development of venous formation during the later stage of embryogenesis.3 The structure of sciatic vein may be defective which carry a high risk of venous thromboembolism. The lack of venous valves in a persistent sciatic vein may lead to chronic venous insufficiency.4 PSV has been associated with patients with Klippel-Trenaunay Syndrome and in patients with recurrent varicose veins. There is a high incidence of pulmonary embolism is seen in patients with PSV. Therefore, it must be investigated aiming at a better clinical or surgical management.5,6 The difficulty faced in treating patients for PSV excision is that If PSV is the only venous channel draining lower limb then it would be difficult to operate such cases in absence of alternative venous drainage from the leg.7&#xD;
&#xD;
We studied the anatomy of lower limb veins over four years in 25 cadavers to see the incidence of Persistent sciatic veins.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
This study was conducted in 50 lower limbs of 21 male and 4 female embalmed cadavers obtained from the Department of Anatomy, Andaman Nicobar islands institute of medical sciences. The study was conducted during the dissection of lower limbs for undergraduate MBBS students over four years from 2016. The limbs were dissected to study the incidence of persistent sciatic veins. After removing skin and superficial fascia, venous drainage was studied in the lower limb from thigh to foot. PSV was searched near the sciatic nerve. When PSV was found, its course, relations and tributaries were noted. The length of PSV, origin and termination was also noted with the help of measuring tape. The width of PSV was measured with the help of divider and scale. Photography was done using a CANON IXUS 95 IS digital camera. The data was collected and analysed.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The normal anatomy of the femoral veins was found in 48 among 50 limbs (96%). Persistent sciatic veins (PSV) were found in 2 of 50 limbs (4%). In one of the left lower limb, PSV was 54 cm long, originating from vena committees of the anterior tibial artery in the anterior compartment of the leg, having communications with the popliteal vein in the popliteal fossa, accompanies sciatic nerve in the back of the thigh, perforating adductor Magnus, receiving some tributaries from adductor muscles, finally terminating into the femoral vein (Figure 1,2). A popliteal vein was hypoplastic in this limb.&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The PSV in one right lower limb was 37 cm long, originating from a popliteal vein near the apex of the popliteal fossa, running upwards in back of thigh accompanied by the sciatic nerve. It was piercing adductor Magnus and finally terminated into the femoral vein (Figure 3,4). A popliteal vein was hypoplastic in this limb also. Multiple small aneurysms were present throughout PSV whenever it was present.&#xD;
&#xD;
DISCUSSION &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The persistent sciatic vein (PSV) is a rare anomaly classified into three types: complete, proximal or superior PSV, or distal or inferior.8 Incomplete type PSV, the origin from the popliteal vein while termination is into the external iliac vein and extents throughout the knee to the thigh till the buttock. In proximal or superior PSV, the origin is from higher deep veins in thigh and termination into the pelvic vein. In distal or inferior PSV, it is present mainly in lower and medial portions of the thigh.9,10&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The sciatic vein is the main venous channel draining the lower limb during embryonic life. During embryogenesis, the vascular endothelial growth factor and their receptors play important role in the differentiation of angioblasts in a primitive vascular plexus, with posterior remodelling and expansion, so vascular anomalies may occur during this process.11,12 Alteration in gene expression with the change in a gene sequence can be a possible cause of vascular anomalies. Hemodynamic alterations or defect of the mesoderm may play role in such venous variation.13&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; When our study was compared to previous studies on PSV we noted that incidence was showing a wide range from 3-51% in different studies. According to Cherry et al. out of 41 studied patients, 21 had PSV (51.22%). All these cases were associated with Klippel-Trenaunay syndrome 14. Labropoulos et al found that out of 24 cases studied, PSV was present in 3(12.5%) cases in the American population.15,16 The study by Cardoso BB et al in brazil reported the incidence of PSV in 2(6%) cases out of 32 total cases studied.17 According to Pompeo et al. out of 41 lower limbs were dissected and 169 phle&#xAD;bographies were studied. Among these total 210 lower limbs studied, 7 (3.33%) presented with PSV.18 Table 1 shows the incidence of Persistent sciatic vein in different population studies. Detailed knowledge regarding the anatomical variations such as variations in long saphenous vein and the short saphenous vein is very important in the diagnosis and management of varicose veins.19&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The sciatic vein serves as the most important collector of blood from the lower limb during the prenatal period. Sciatic veins are predominant veins of developing lower limb until 22 mm stage of the embryo, after which they involutes and the femoral system develops as a major venous system. The persistent sciatic vein may be the failure of development of femoral vessels or failure in regression of sciatic vessels. The PSV is an embryonic remnant rather than acquired one after any obstruction of femoral vein. The persistent sciatic vein may be associated with patients with Klippel-Trenaunay Syndrome or lead to chronic venous insufficiency in the lower limbs, therefore it must be investigated for better clinical or surgical management.&#xD;
&#xD;
Acknowledgement -Authors acknowledge the immense help received from scholars whose articles are cited and included in the references of this manuscript&#xD;
&#xD;
Conflicts of interest-none&#xD;
&#xD;
Source of funding-none&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3453</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3453</Fulltext></URLs><References>&#xD;
	&#xD;
	Ko&#xE7; T, Gilan IY, K&#xFC;lek&#xE7;i GD, Kurto?lu Z. Bilateral persistent sciatic vein: report of a case with developmental, histological and clinical aspects. Surg Radiol Anat 2014 Mar;36(2):189-94.&#xD;
	&#xD;
	&#xD;
	Trigaux JP, Vanbeers BE, Delcambre FE, de Fays FM, Schoevaerdts JC. Sciatic venous drainage demonstrated by varicography in patients with a patent deep venous drainage system. Cardiovasc Intervent Radiol 1989;12:103-106.&#xD;
	&#xD;
	&#xD;
	Goldhaber SZ and Bounameaux H. Pulmonary embolism and deep vein thrombosis. Lancet 2012;379:1835-1846.&#xD;
	&#xD;
	&#xD;
	Cowie Tn, McKellar MB, McLean N, Smith G. Unilateral congenital absence of the external iliac and femoral arteries. Br J Radiol 1960;33:520-522.&#xD;
	&#xD;
	&#xD;
	Arey LB. Developmental Anatomy. WB Saunders Company. 7th Edition, 1974; 357-360.&#xD;
	&#xD;
	&#xD;
	Savov JD, Wassilev WA. Bilateral persistent complete sciatic artery. Clin Anat 2000;13:456-460.&#xD;
	&#xD;
	&#xD;
	Bastarrika G, Redondo P, Sierra A, Cano D, Mart&#xED;nez-Cuesta A, L&#xF3;pez-Guti&#xE9;rrez JC, et al. New techniques for the evaluation and therapeutic planning of patients with Klippel-Tr&#xE9;naunay syndrome. J Am Acad Dermatol 2007;56:242-249.&#xD;
	&#xD;
	&#xD;
	Wright FW. Persistent axial or sciatic artery of the lower limb associated with hemihypertrophy. Clin Radiol 1964;15:291-292.&#xD;
	&#xD;
	&#xD;
	Latarjet M, Liard AR. Anatomiahumana. Paris. M&#xE9;dica Panamericana; 1983.&#xD;
	&#xD;
	&#xD;
	Youngson CG, Taylor B, Rankin R, Heimbecker RO. Persistent sciatic artery: a case report. Can J Surg 1980;23:466-467.&#xD;
	&#xD;
	&#xD;
	&#xA0;You CK, Rees J, Gillis DA, Steeves J. Klippel-Trenauney syndrome: a review. Can J Surg 1983;26:399-403.&#xD;
	&#xD;
	&#xD;
	Brantley SK, Rigdon EE, Raju S. Persistent sciatic artery: embryology, pathology and treatment. J Vasc Surg 1993;18:242-248.&#xD;
	&#xD;
	&#xD;
	Balli R, Bertelli D. Trattado di anatomia Umana. 2. ed. Mil&#xE3;o: Dottor Francisco Veliardi;1924. v. III.&#xD;
	&#xD;
	&#xD;
	Parry DJ, Aldoon MI, Hammond RJ, Jessil PO, Weston M, Scott DJA. Persistent sciatic vein, varicose veins and lower limb hypertrophy: an usual case or discrete clinical syndrome? J Vasc Surg 2002;36:396-400.&#xD;
	&#xD;
	&#xD;
	Cherry KJ, Gloviczki P, Stanson AW. Persistent sciatic vein: diagnosis and treatment of a rare condition. J Vasc Surg 1996;23:490-497.&#xD;
	&#xD;
	&#xD;
	Labropoulos N, Tassiopoulos AK, Gasparis AP, Phillips B, Pappas PJ. Veins along the course of the sciatic nerve. J Vasc Surg 2009;49(3):690-696.&#xD;
	&#xD;
	&#xD;
	Cardoso BB, Alvarenga CO, Miyahara MDS, Burihan MC, Lima MR, Kuwahara MC, et al. Persistent sciatic vein. J Vasc Bras 2010;9(3):137-140. &#xA0;&#xD;
	&#xD;
	&#xD;
	Golan JF, Garrett WV, Smith BL, Talkington CM, Thompson JE.Persistent sciatic artery and vein: an unusual case. J Vasc Surg 1986;3:162-165.&#xD;
	&#xD;
	&#xD;
	Anupama D, Nagaraj DN, Suresh BS, Lakshmi R, Subhash P. A study of variations in the short saphenous venous system with clinical correlation. Int J Curr Res Rev 2020;5(13):29-136.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>A GLCM based Feature Extraction in Mammogram Images using Machine Learning Algorithms&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>145</FirstPage><LastPage>149</LastPage><AuthorList><Author>BN Jagadesh</Author><AuthorLanguage>English</AuthorLanguage><Author> L Kanya Kumari</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Most Indian women are suffering from Breast Cancer. The simple and efficient screening used for Breast Cancer (BC) is Mammograms. Mammogram images are used to detect BC in the early stages. Objective: The main objective of our research is to detect the BC in early stages using Gray Level Co-occurrence Matrix (GLCM) with Machine Learning Algorithms. Methods: Our proposed system is a two-step process which includes feature extraction and classification. Features are extracted from the Mammographic Image Analysis Society (MIAS) database by using a texture-based descriptor called GLCM. These features are passed to classifiers called K-Nearest Neighbor (KNN), Random Forest (RF) and Gradient Boosting by considering 30% as testing data size. Results: The experiments are done as follows: GLCM+RF, GLCM+KNN and GLCM+ Gradient Boosting and the performance of these classifiers are calculated by finding accuracy metric. Conclusion: The conclusion is that GLCM features with KNN classifier give better results than other classifiers.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Breast cancer, Screening, Mammograms, Gray Level Co-occurrence Matrix, K-Nearest Neighbor</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Most of the women in India are dying due to breast cancer (BC), which can be detected by a method called screening. The symptoms for BC are 1. Nipple discharge 2. Change in the shape and size of the breast 3. Redness 4. Swelling. Not all lumps will lead to BC. Calcium deposits present in the breast are called microcalcifications which may lead to Breast Cancer.1 According to IARC (International Agency for Research on Cancer), breast cancer is present in 2,088,849 women.2 Diagnosing this cancer cell is difficult process.3 Breast Cancer screening can be done in many ways like X-ray (mammograms), PET (Positron Emission Tomography), ultrasound, MRI (Magnetic Resonance Imaging) and CT-Scan (computed tomography), Thermogram imaging. Among all these methods, mammogram imaging is an efficient and less cost technique. Different temperatures are required for different imaging techniques. But, the accurate prediction was not possible because of human fatigue and habituation.4,5&#xA0; This paper is organized as follows: literature survey is in section 2, image dataset is discussed in section 3, our proposed methodology is discussed in section 4, the experimental results are discussed in section 5 and the conclusion is given in section 6.&#xD;
&#xD;
The authors discussed that there are several feature extraction techniques are available in medical image processing.6 Among these techniques, the authors used one mostly used technique called shape-based feature extraction. The shape of an image includes two properties such as boundary-based and region-based and they concluded that the features are depending on the segmented images. The features has been extracted based on texture.7 There are many numbers of feature extraction techniques are present. In their paper, they have used Grey-Level Co-occurrence Matrix (GLCM). &#xD;
&#xD;
A private dataset taken from Bethezata General Hospital and a Mammographic Image Analysis Society (MIAS) database which is publicly available.8 Gray Level Co-occurrence Matrix (GLCM) and Gabor filters are used for feature extraction and also they have used Convolutional Neural Network (CNN). For classification, they have used different classification techniques such as K-Nearest Neighbors (KNN), Random Forest(RF), Support Vector Machine (SVM), Na&#xEF;ve Bayes and Multi-Layer Perceptron (MLP). Authors did the experiments with all the combinations and they concluded that Gabor and CNN feature with Multi-Layer Perceptron (MLP) is performed well for mammogram classification. The authors have used preprocessing techniques and Region Of Interest (ROI) is extracted by using Fuzzy C-Means clustering technique and active counter technique.9 From this resultant ROI, mostly used texture-based feature extraction technique called GLCM is used. A combined classifier called Support Vector Machine (SVM) and KNN is used to classify Digital&#xA0;Database&#xA0;for Screening Mammography (DDSM) images and MIAS image dataset. The accuracy for MIAS dataset is 94% and DDSM dataset the classification accuracy is 100%. &#xD;
&#xD;
To identify the mass as benign or malignant, shape and margin features has been used.10 Vector field convolution is applied as a segmentation technique. Texture based and statistical-based methods are used for feature extraction and these features are given as input to classifiers such as SVM and RF. SVM with Genetic algorithm and SVM with Particle Swarm Optimization results are compared with RF and concluded that RF gave better results. They have used 5-fold cross-validations accuracy measure. The authors concluded that not only shape features will give better results. These are combined with texture features may give better results. A Computer-Aided Diagnosis (CAD) system11 is to find masses in the mammograms. They have experimented in 4 steps. They are: 1) preprocessing median filtering, homomorphic filtering, logarithmic transformation, region growing and thresholding are used. 2) Feature extraction used is Fourier Transform(FT) and weighted FT transform are used. 3) the obtained features are reduced by using Principal Component Analysis. The classifiers used in their research are VM and KNN. As a performance measure, the authors have used is 10-fold stratified cross-validation. The authors concluded that SVM gave better results than compared other technique.&#xD;
&#xD;
In medical image processing, there is the number of imaging techniques are available for the detection of breast cancer. They are: 1) Mammogram X-ray, ultrasound,2) CT-Scan(computed tomography), 3) PET (Positron Emission Tomography) and 4)MRI (Magnetic Resonance Imaging). Among all these mammogram imaging is better for early detection of breast cancer. So, in our research MIAS mammogram dataset is used (Mammographic Image Analysis Society) to classify mammograms into Benign or Malignant. This dataset consists of 322 grey-scale images.12 We represented sample images from MIAS which is represented in Figure 1. &#xD;
&#xD;
&#xD;
&#xD;
Figure 1. Sample mammograms from MIAS dataset: mdb001, mdb015, mdb023, mdb081. Mammograms are the X-ray imaging modality used to detect breast cancer in early stages so that the patient survival rate can be increased.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
Our methodology is divided into 2 stages. They are feature extraction and classification. Diagrammatically it is represented in figure 2.&#xD;
&#xD;
&#xD;
&#xD;
Figure 2. Steps in the proposed methodology. This diagram represents mammogram images are given as input to our system. Then features are extracted from mammograms. These features are given as input to the classifier to classify the image into normal or abnormal&#xD;
&#xD;
Feature Extraction&#xD;
&#xD;
The Transformation of the input image into features is called feature extraction. Features are extracted by using feature extraction techniques. Features are extracted based on texture, boundary, spatial, edge, transform, colour and shape features.&#xA0; Shape-based features are divided into the boundary and region-based features. Boundary features are also called contour-based which uses boundary segments.13 Boundary based features are geometrical descriptors (diameter, major axis, minor axis, perimeter, eccentricity and curvature), Fourier descriptors and statistical descriptors (mean, variance, standard deviation, skew, energy and entropy).14 Region-based features are texture features as GLCM.15&#xD;
&#xD;
Gray Level Co-Occurrence Matrix&#xD;
&#xD;
Texture features are playing an important role in the prediction of breast cancer disease16. It is represented in the form of a matrix called GLCM. This Co-Occurrence Matrix gives different frequencies of pixel intensities in an image. These frequency values are likelihood occurrence of grey-level pixel intensity &#x2018;p&#x2019;(called reference pixel) in the neighbourhood of intensity &#x2018;q&#x2019; (neighbour pixel) grey level at a distance &#x2018;d&#x2019; in 4 directions &#x2018;?&#x2019;(00,450, 900 and 1350). In our research, the properties considered are energy, contrast, correlation and homogeneity. Total 16 GLCM features are considered (4 features in 4 directions). These features are extracted from MIAS mammogram images. The block diagram is represented in 3. The images considered for our experiment from MIAS dataset are represented in Figure 4 (Benign) and Figure 5 (Malignant) respectively. &#xD;
&#xD;
&#xD;
&#xD;
Figure 3:&#xA0; Block diagram of the GLCM Technique. This diagram takes mammogram image as input and calculates GLCM properties in 4 different angles (00,450, 900 and 1350) and statistical features such as energy, homogeneity, correlation and contrast calculated&#xD;
&#xD;
&#xD;
&#xD;
Figure 4: These images are considered from benchmark dataset called MIAS. This dataset consists of a total of 322 images which are taken from 161 patients. Sample images from MIAS database mdb018, mdb029, mdb009- Benign.&#xD;
&#xD;
&#xD;
&#xD;
Figure 5: These images are also considered from MIAS dataset. These are grey level images and each of size 1024 X 1024. Sample images from MIAS database mdb013, mdb021, mdb063-&#xA0;&#xA0;&#xA0;&#xA0; Malignant&#xD;
&#xD;
GLCM properties considered for our research are as follows: &#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
These features are fed to different classifiers to find the performance of the proposed GLCM technique. &#xD;
&#xD;
CLASSIFICATION&#xD;
&#xD;
A simple machine learning classifier KNN is used for classification of mammogram images into Benign and Malignant. This is not only used in medical image classification but also used to detect the diseases in plants to save the crops17. This technique finds the K-closest neighbours to the given image and forecasts the majority vote of classes of K-neighbors2. The steps applied are:&#xD;
&#xD;
&#xA0;1. The GLCM features are given as input to KNN classifier &#xD;
&#xD;
2. Initialize the value of K to 5.&#xD;
&#xD;
3. For each image in the data, calculate the distance between training data and test data. &#xD;
&#xD;
4. Sort the final distances from the smallest distance to the largest distance.&#xD;
&#xD;
5. Choose the first K-class labels from the sorted list &#xD;
&#xD;
6. Return the mode of K-labels.&#xD;
&#xD;
&#xA0;The benefits of using KNN classifier are 1. It is easy to use and also easy to implement 2. hyperparameters used in this technique are less than 3. It works fast when we use small dataset.&#xD;
&#xD;
RESULTS AND DISCUSSION&#xD;
&#xD;
In the proposed methodology we considered the images from MIAS. These images are given as input to texture-based feature extraction technique called GLCM. The 16 features are represented with class labels in Table 1. This table consists of image number (I) from the dataset(for example I21 means mdb021) and features are represented as columns (F)&#xA0; denoted by F0, F1&#x2026;..F15 and class labels are represented as follows.&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
These features are given as input to KNN18 classifier with K=5. To classify mammograms into Benign or Malignant, the dataset is divided into 2 parts for experimentation. They are training and testing data. We have considered training and testing sizes at 70% and 30% respectively. To know the performance of the classifier we have calculated the accuracy.&#xA0; Accuracy is the measure to find the efficiency of the classifier and is calculated as follows.19 &#xD;
&#xD;
&#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
In the equation (5), TPC is True Positives Count, TNC is True Negatives Count, FPC is False Positives Count and FNC is False Negatives Count. By using the above equation (5) we have calculated accuracy for GLCM with Random Forest, GLCM with KNN and GLCM with Gradient Boosting classifiers. The better classification accuracy is achieved for GLCM with KNN and it is 93%.&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
In our research, we have studied number of feature extraction techniques which used for mammogram classification. The techniques used in literature were region based, boundary based, texture based and shape based methods.&#xA0; Among all these methods most of the researchers concluded that texture based feature extraction technique called GLCM gives better features to classify mammograms. The obtained features are given as input to different machine learning classifiers like Random Forest, KNN and Gradient Boosting. We have done the experiments like GLCM with Random Forest, GLCM with KNN and GLCM with Gradient Boosting. By observing all the experimental results, we concluded that GLCM with KNN gives better results than compared other classifiers in classifying the mammogram image as benign or malignant.&#xD;
&#xD;
ACKNOWLEDGMENT &#xD;
&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references to this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals, and books from which the literature for this article has been reviewed and discussed. &#xD;
&#xD;
Conflict of Interest:&#xD;
&#xD;
&#xA0;The authors involved in the current study does not declare any competing conflict of interest&#xD;
&#xD;
Source of Funding&#xD;
&#xD;
&#xA0;No fund or sponsorship in any form was obtained from any organization for carrying out this research work.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3454</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3454</Fulltext></URLs><References>1. Abirami C, Harikumar R, Chakravarthy SRS. Performance analysis and detection of microcalcification in digital mammograms using wavelet features.&#xA0;International Conference on Wireless Communications, Signal Processing and Networking.2016; 2327-2331.&#xD;
&#xD;
2. Nagarajan V, Britto EC, Veeraputhiran SM. Feature extraction based on empirical mode decomposition for automatic mass classification of mammogram images. Med Novel Tech Devic 2019;1:100004.&#xD;
&#xD;
3. Rangayyan M, El-Faramawy NM, Desautels JEL Alim OA. Measures of acutance and shape for classification of breast tumours. IEEE Transactions Med Imaging.1997;16:799-810.&#xD;
&#xD;
4. Damiati S, Peacock M, Mhanna R, Sopstad S, Sleytr UB, Schuster B. Bioinspired detection sensor based on functional nanostructures of S-proteins to target the folate receptors in breast cancer cells. Sens Actuators B Chem. 2018;267:224-230.&#xD;
&#xD;
5. Margolies LR, Salvatore M, Yip R, Tam K, Bertolini A, Henschke C, et al. The chest radiologist&#x2019;s role in invasive breast cancer detection. Clin Imaging 2018;50:13&#x2013;19.&#xD;
&#xD;
6. Liu J, Shi Y. Image Feature Extraction Method Based on Shape Characteristics and Its Application in Medical Image Analysis. Appl Inform Commun Comp Inform Sci 2011; 224:172-178.&#xA0;&#xA0;&#xA0; &#xD;
&#xD;
7.&#xA0; Pradeep S, Malliga L. Content-based image retrieval and segmentation of medical image database with fuzzy values. International Conference on Information Communication and Embedded Systems. 2014;1-7. &#xD;
&#xD;
8. Debelee TG, Gebreselasie A, Schwenker F, Amirian M, Yohannes D. Classification of mammograms using texture and CNN based extracted features. J Biomim Biomater Biomed Eng 2019;42:79&#x2013;97.&#xD;
&#xD;
9. Sonar U. Bhosle F, Choudhury C. Mammography classification using modified hybrid SVM-KNN. In:&#xA0; International Conference on Signal Processing and Communication (ICSPC), Coimbatore, pp. 305-311(2017).&#xD;
&#xD;
10. Dong M, Lu X, Ma Y, Guo Y, Ma Y, Wang K. An Efficient Approach for Automated Mass Segmentation and Classification in Mammograms.&#xA0; Soc Imaging Inform Med 2015;28(5):613-625. &#xD;
&#xD;
11.Zhang Y-D, Wang S-H, Liu G, Yang J. Computer-aided diagnosis of abnormal breasts in mammogram images by weighted-type fractional Fourier transform. Adv Mech Eng 2016;8(2):1-11.&#xD;
&#xD;
12. Suckling J, Parker J, Dance D, Astley S, Hutt I, Boggis C, Ricketts I et al. The Mammographic Image Analysis Society Digital Mammogram Database. Excerpta Medica 2015; 375-378.&#xD;
&#xD;
13. Kumari LK, Jagadesh BN. A novel approach for the detection of tumours in mammographic images using Fourier descriptors and KNN. In: Lecture Notes in Electrical Engineering. Singapore: Springer Singapore; 2020. p. 1877&#x2013;84.&#xD;
&#xD;
14. Murty AVSN, Jagadesh BN, Bhagavan K, Satyanarayana S. A comparative study of various edge enhancement filters in the spatial domain. Res J Pharm Technol 2016;9(12):2403.&#xD;
&#xD;
15. Kumar G, Bhatia PK. A detailed review of feature extraction in image processing systems.In:2014 Fourth International Conference on Advanced Computing &amp; Communication Technologies. IEEE; 2014.&#xD;
&#xD;
16. Parekh R. Using Texture Analysis for Medical Diagnosis. IEEE Multi Media 2012;19(2):28-37.&#xD;
&#xD;
17. Sheikh S, Wani R, Niyaz I, Manzoor F, Wani L, Beg A. Study of Breast Lesions with Special Reference to Rare Malignant Epithelial Tumors in a Tertiary Care Hospital with Brief Review of Literature. Int J Curr Res Rev 2017;9(24):48-54.&#xD;
&#xD;
18. Bhattacharyya D, Doppala BP, Rao NT. Prediction and forecasting of persistent kidney problems using machine learning algorithms. Int J Curr Res Rev 2020;12(20):134&#x2013;139.&#xD;
&#xD;
19. Kaur A, Kaur I. An empirical evaluation of classification algorithms for fault prediction in open source projects. J King Saud Univ Comput Inform Sci 2018;30(1):2&#x2013;17.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Elicitation of Bioactive Molecule by Screening of Fungal Secondary Metabolites Against MDR Staphylococcus Aureus&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>150</FirstPage><LastPage>156</LastPage><AuthorList><Author>Renuka Bali N</Author><AuthorLanguage>English</AuthorLanguage><Author> Dandin CJ</Author><AuthorLanguage>English</AuthorLanguage><Author> Vedamurthy AB</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Fungal secondary metabolites are a diverse group of bioactive compounds; in which many have been reported as bio-therapeutics. Objective: The present study, relates to fungal secondary metabolites produced by filamentous fungi and screened against 21 clinical isolates of Staphylococcus aureus procured from Shri Dharmasthala Manjunatheshwara Medical College and Hospital Dharwad, Karnataka. Methods: Antibiogram assay was performed for these clinical isolates against Methicillin, Chloramphenicol, Vancomycin, Oxacillin and Clindamycin by Kirby Bauer&#x2019;s method. The zones were measured and compared to the Clinical and Laboratory Standard&#x2019;s Institute chart. Results: The resistance pattern observed for Methicillin-90.47%, Chloramphenicol-4.76%, Vancomycin-14.28%, Oxacillin-80.95% and Clindamycin-9.5%. We infer that, out of 21 interactions, 5 distance, 7 overgrowth, 4 contact and 5 zone-line inhibitions were observed. The zone of inhibition range observed was 10-17 mm against all 21 S. aureus strains after 18 hr incubation at 37 &#xB0;C on Mueller Hinton Agar plates. Bio-activity against S. aureus was noticed for F4 isolate between the 4-6th day of incubation and not on 7th day or later. The maximum inhibition zone observed for ethyl acetate:water fraction. Conclusion: The isolated compound from P. polonicum showed potent activity against the Methicillin-resistant Staphylococcus aureus (MRSA) clinical isolates has not been used against any MRSA or Methicillin-resistant Staphylococcus aureus (VRSA) clinical isolates.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Antibiogram, Co-Culture assay, Biphasic separation, Ethyl acetate, Penicilium polonicum</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
The organism which shows resistance to one or more class/es of antibiotics referred as Multidrug resistance (MDR) (predominantly bacteria) is a grave threat that can lead to deaths of 10 million people per year by 2050.1 Pathogens like Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumanii, Pseudomonas aeruginosa, and Enterobacter species (ESKAPE) were reported to emphasize that they currently cause the majority of infections and effectively &#x201C;escape&#x201D; the effects of antibacterial mechanisms. More people now die of Methicillin-resistant Staphylococcus aureus (MRSA) infection in the United State (US) hospitals than of HIV/AIDS and tuberculosis combined.2,3 Furthermore, pan-antibiotic-resistant infections now occur with increasing frequency over the past several decades.4 Out of different dangerous Gram-positive and Gram-negative bacteria MDR strains of Staphylococcus aureus also reported as MRSA and VRSA which belongs to firmicutes family and Gram positive coccoid bacteria are realized as a major threat.4 MDR Staphylococcus aureus is a community associated infectious agent found globally. The continuous trials being carried out to resolve this multidrug resistance and in the context fungal secondary metabolites are promising as bio therapeutics to tackle these MDR S. aureus. The fungal secondary metabolites are defensive compounds that have emerged as better options due to pharmacological evidence of them being more efficient and versatile molecules. Co-culture method is one of the methods to induce the formation of new secondary metabolites which are highly relevant for novel drug research against MDR bacteria.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
Isolation of fungi&#xD;
&#xD;
Soil samples were collected in and around Karnataka University campus in sterile polythene bags. 1gram of finely sieved soil sample was serially diluted in sterile water. 1ml of sample uniformly inoculated by spreader in SDA and PDA plates and incubated for 3-5days at room temperature. Lush growth was observed in mother plates.&#xA0; 40 pure isolates were maintained as pure cultures, 20 isolates were distinct and unique. Out of 20 fungi, five fungi were randomly picked by their unique morphological features for further process.&#xD;
&#xD;
Antibiotic assay&#xA0; &#xD;
&#xD;
The antibiotic assay was performed according to Kirby-Bauer&#x2019;s antibiotic susceptibility test developed in 1950 and standardized by World Health Organization (WHO) in 1961.2 It is used to determine the resistance or sensitivity pattern of pathogenic bacteria isolates for prescribed antibiotics and further evaluated by using Clinical and Laboratory Standards Institute (CLSI). The presence or absence of an inhibitory area around the antibiotic disc identifies the bacterial sensitivity to the drug. The bacterium (S. aureus isolate) was swab inoculated on the Muller-Hinton agar plates and the antibiotic discs (Methicillin, Chloramphenicol, Vancomycin, Oxacillin and Clindamycin,) were placed on top of swab-inoculated MHA media. The antibiotics diffuse from the disc into the inoculated agar media in decreasing concentration outwards in a circular pattern from the antibiotic disc. If the organism is killed or growth inhibited by the concentration of the antibiotic that diffuses from the filter disc, there will be a clear zone around the disc (Figure 2). This measure of the zone (in mm) of inhibition leads to understanding the minimum inhibitory concentration (MIC) values of antibiotics with suitable concentration against S. aureus. The zone sizes were measured (in mm) and compared to the standard CLSI5 (Table 2) that evaluates the results of the organism showing sensitive, intermediate and resistant activity against that particular antibiotic concentration. &#xD;
&#xD;
Co-culture assay&#xD;
&#xD;
Co-culture assay is a method of inoculating 2 different micro-organisms with proximity (side by side, few mm apart) to observe their association interactions. The fungus was inoculated with all 21 Staphylococcus aureus to observe the types of association and interactions. The zones of inhibitions were recorded as the zone of contact inhibition, overgrowth inhibition, zone line inhibition and distance inhibition. Previously the classical work of Alexander Fleming&#x2019;s unintended result shows the antagonistic property of fungus over Staphylococcus sps.6 In this association inducing/ triggering secondary metabolites of fungi which are proved to be many bio-therapeutics. The co-existence of several Micro-organisms that share the same niche can affect the organism growth, adaptation patterns, morphology and developmental patterns.5,7 Co-culture assay used to check the natural compounds released from the association interactions.2,3 &#xA0;&#xA0;&#xD;
&#xD;
Fermentation&#xD;
&#xD;
Fermentation method provides rich culturing of fungi (quantitatively) and serves for qualitative analysis like the enzymes and metabolites secreted in the broth can be assessed by different methods. The fungi were inoculated in PDB broth of 200 ml in 1000 ml conical flask to provide the proper base and it is protein supplemented with 1% peptone. Microscopic observation was done to check the fungal contamination with bacteria. The fungal growth could be observed from 3rd day. The rich growth was observed in both static and rotary method. The fungal yield could be noticed as high in static fermentation. The induction of secondary metabolites was observed from 3 rd day to 10th day by well diffusion method. The fungal broth was decanted under sterilized conditions to eppendorf tubes. The crude broth was subjected to well diffusion method. The result was observed for crude broth from 4th day to 10th day the fungal broth was filtered by 0.2 &#x3BC; bacterial filter under sterile conditions. And this clear fungal broth was subjected to well diffusion method. After 6th day the filtered fungal broth did not show any activity by well diffusion method. The old culture was inoculated to fresh PDB media and repeated the activity. Out of 5 fungi (F1, F2, F3, and F5), F4 isolate showed the best activity by this method. &#xD;
&#xD;
Well, the diffusion method&#xD;
&#xD;
Well, the diffusion method is one of the well established bio-assay activity methods where the sample was diffused to form inhibition zones. Here 21 S. aureus samples were cotton swab cultured on MHA plates in clock and anti-clock strokes for uniform spreading. Different cotton swabs (sterile) were used for all 21 S. aureus samples. The wells were prepared using cork borer and these were equidistant from each other. The filtered fungal broth was loaded to 4 different wells marked as 1, 2, 3 and 4 with fungal broth volume loaded to these were 5, 10, 25 and 50&#x3BC;ls respectively.&#xA0; The fungal broth was properly loaded within the good space so to take care of the overflow on the agar surface. The samples thus loaded on S. aureus inoculate MHA plates were allowed to diffuse for some time in LAF only. These were aseptically stretch wrapped and kept for incubation at 37 &#xB0;C for 18 to 24 hrs. The results were recorded for 12th and 18th hour. These MHA plates were arrested in refrigerator after recording the zone measurement and documenting the results.&#xD;
&#xD;
Biphasic separation&#xD;
&#xD;
The crude broth activity showing positive results from well diffusion method was subjected to biphasic separation to understand the active molecule&#x2019;s polarity continued by bio-activity assessment. Biphasic separation is one of the methods used to separate and solubilise the desired compound in a polar and non-polar combination ratio. Separating funnel was used for this method it was thoroughly washed and ethanol rinsed. The 5 different solvents used were Chloroform, Ethyl acetate, Benzene and Toluene. 5 ml of fungal broth and 5 ml solvent poured into the separating funnel, swirled for 5 to10 minutes. Arrest for 30 minutes and again continued this process till the aqueous and solvent phase separates distinctly. The aqueous and solvent phase was decanted slowly in separate vials. These vials kept for drying and it is solubilised with &#xBD; ml of Dimethyl sulphoxide (DMSO). The aqueous phase and solvent phase have been separately taken in a petri dish and dried. These reconstituted solvent extracts were subjected to a good diffusion method. 75&#x3BC;l of all the sample aliquots were dispensed to the respective wells and DMSO as control. Extract samples in well no. 1 and 4 are aqueous phases and chloroform, 2 and 6 are aqueous phase and ethyl acetate, 3rd and 5th are aqueous phase and Benzene and the 7th one was Toluene and 8th as an aqueous phase of Toluene did not dry. So this was not considered for well diffusion method.&#xA0; &#xD;
&#xD;
RESULTS&#xD;
&#xD;
Isolation of fungi &#xD;
&#xD;
The fungal isolates (F1, F2, F3, F4 and F5) were observed for their colony characterization. These were stained with Lactophenol cotton blue and microscopic observation was done up to genus level. These isolates were picked for its unique and distinct morphological features to perform co-culture assay against S. aureus after confirming the  resistance pattern by Antibiogram Assay (Figure 1)&#xD;
&#xD;
&#xD;
&#xD;
Antibiogram assay for Staphylococcus aureus &#xD;
&#xD;
Antibiogram assay was conducted for 21 Staphylococcus aureus procured from SDM Medical College, Dharwad, Karnataka. These were revived in Muller-Hinton broth and incubated for 12-24 hours at 37 &#xB0;C and used as the source for S. aureus pure culture isolates in further studies. The fresh cultures on attaining an optical density of 1.0-1.5 checked through turbidometric/ spectroscopic method and were used to conduct antibiogram assay by Kirby Bauer&#x2019;s method using reference antibiotics, MHA plates (21 nos.) were cotton swabbed with 21 S. aureus isolates individually and the antibiotic discs were gently placed on the media equidistantly without disturbing the media and incubated 18-24 hours at 37 &#xB0;C. The 5 antibiotics used for antibiogram assay were observed Methicillin, Vancomycin, Clindamycin, Oxacillin and Chloramphenicol (Meth, Va, Cd, Ox and C respectively). The 24 hour incubated plates were observed for the inhibition zones, which were measured by the scale (Hi-media) designed to measure the zone of inhibition diameter. The concentration and measurement zones for different antibiotics for S. aureus samples were assessed as susceptible, intermediate and resistant by referring CLSI chart. These clinical S. aureus isolates were further subjected to Co-culture assay against the fungal isolates (Figure 2).&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xD;
&#xD;
Figure 2: Antibiotic assay conducted for Methicillin, Vancomycin, Clindamycin, Oxacillin and Chloramphenicol against S. aureus clinical isolates (21 plates).&#xD;
&#xD;
The antimicrobial assay was conducted for 21 clinical isolates obtained from SDM Medical College, Dharwad, Karnataka for Methicillin, Vancomycin, Clindamycin, Oxacillin and Chloramphenicol&#xD;
&#xD;
Outcome&#xD;
&#xD;
The resistance pattern of Antibiotic assay against each antibiotic in % of total S. aureus screened (Table 1). Methicillin (90.47%), Chloramphenicol (4.76%), Vancomycin (14.28%),&#xA0; Oxacillin (80.95%) and Clindamycin (9.5%) found among the 21 isolates against the microorganism S. aureus.&#xD;
&#xD;
&#xD;
&#xD;
Co-culture assay&#xD;
&#xD;
The clinical isolates were subjected to co-culture assay. The 21 S. aureus were co-cultured with fungal pure culture. Both the isolates were inoculated in PDA enriched with 1% peptone and incubated at 32 oC. The 3rd-day observation was recorded and the zones of interactions were categorized into the zone of contact, Distance inhibition, Overgrowth inhibition, zone line inhibition (Figure 3). In which the overgrowth is considered as antagonistic property, concerning the Alexander Fleming discovery of Penicillin pattern, this overgrowth inhibition was counted. Interpretation of the co-culture as denoted by the following method.&#xD;
&#xD;
D=F4-A7, F4-A9, F4-A12, F4-A15, F3-A15 (5)&#xD;
&#xD;
O=F4-A1, F4-A2, F4-A6, F4-A5, F4-A10, F4-A13, F3-A1 (7)&#xD;
&#xD;
C=F4-A4, F4-A8, F4-A14, F3-A14 (4)&#xD;
&#xD;
Z=F4-A3, F4-A7, F4-A11, F4-A16, F3-A16 (5)&#xD;
&#xD;
&#xD;
&#xD;
Static fermentation of fungi &#xD;
&#xD;
Five fungi were subjected to static and rotary fermentation to check the yield. The PDB media used with 1% addition of peptone for a protein supplement. Static fermentation was observed for a good yield. The fungi were inoculated in 500 ml conical flask for 200 ml volume to allow the fungal growth width wise. Duplicates were maintained for backup. The rich growth was observed 4th day without contamination of bacteria. Lacto phenol cotton blue staining was performed to observe the pure fungal spores. The Microscopic observation confirmed the pure fungal hyphae structure. The broth was decanted to Eppendorf vial in sterile condition to perform well diffusion method (Figure 4). &#xD;
&#xD;
&#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0; &#xA0;&#xD;
&#xD;
Well, the diffusion method &#xD;
&#xD;
Uniform cotton swabbing of S.aureus was done for Mueller Hinton Agar media plates. The fungal broth of 5,25,40 and 50 &#x3BC;ls loaded by micropipettes to 1,2,3 and 4 labelled wells respectively. It is filtered through a 0.2mm sterile filter disk. These plates were incubated at 35-37&#xB0;. 12th and 24th observation were done and the good size in mm was reported as in the following figure and table (Figure 5 and Table 2 &amp; 3).&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Bi-phasic separation &#xD;
&#xD;
This is bioactivity guided separation performed by using polar and non-polar solvent system combinations. The polar and non-polar solvent extracts with fungal broth subjected to well diffusion method. 75&#x3BC;l of all the sample aliquots were dispensed to the respective wells and DMSO as control. Extract samples in well no. 1 and 4 are aqueous phase and chloroform, 2 and 6 are aqueous phase and ethyl acetate, 3rd and 5th are aqueous phase and Benzene and 7th one was Toluene as aqueous phase was not available. Ethyl acetate extract showed the best activity (Figure 5 &amp; 6 and Table 4).&#xA0; &#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; The work here is being conducted to obtain the understanding of the association between the co-culture assays and the metabolite induction against the MDR bacteria. Co-culture assay being an old concept has not been much attempted to obtain metabolite of biochemical importance and very few reports have been published with regards to metabolite induction4 and in particular for antibiotic induction.8 The simple method of isolation and screening to obtain active association between bacteria and fungi is seen in the present study showing a visible interaction in the form of different activities respectively as a zone of contact, distance inhibition, overgrowth inhibition and zone line inhibition and the same has been reported.9 Further, the broth culture of the active fungal isolate F4 that was later identified as P. polonicum showed the inhibiting activity of growth against the MRSA clinical isolates (S. aureus) and there are no reports of any bioactivity of P. polonicum producing a metabolite effective in growth inhibition of MRSA isolates. The recent study of identification and detail functional characterization of the metabolites produced by P. polonicum has been reported by Yanzhang Wen and co-workers.10 The authors have reported two new compounds apart from already reported seven compounds that have been known to show moderate anti-HCC activity, when tested against HepG2 hepatocellular carcinoma (HCC) cell lines, compounds 4-8. Further, compound 1-3 have effects on increasing GLUT4 translocation and glucose uptake in vitro.10 The metabolite supposed to be part of the bio-active fraction obtained by bi-phasic separation using ethyl acetate: water has been dried and predicted as non-polar compound. This has been sent for molecular identification. The compound reported in this work, isolated from P. polonicum was showing efficient activity against the MRSA clinical isolates has not been used against any MRSA or VRSA clinical isolates and thus we claim this is the first report of a bioactive molecule isolated from P. polonium against clinical MRSA isolates.&#xD;
&#xD;
&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Thereby we derive by our experimental evidence that using a powerful tool like antibiogram assay, co-culture assay, fermentation, well diffusion method, the bi-phasic separation that can enhance, diverse fungal metabolite production ability of the isolated fungi against the multi-drug resistant S. aureus. It will be the best future solution to the medical issues to act as a pharmacological potential drug by such organisms and which is safer and cost-effective natural source for microbial infection.&#xD;
&#xD;
&#xD;
&#xD;
Acknowledgement: The authors are thankful to the PG Department of Microbiology and Biotechnology, Karnatak University, Dharwad, Karnataka for providing all the necessary facilities and University Grants Commission, for the award of NFHE fellowship from April 2016-17- March 2021.&#xD;
&#xD;
Conflict of interest: None&#xD;
&#xD;
Source of funding: Under NFHE Fellowship&#xD;
&#xD;
1st Author: carried out all the experiments of the planned work&#xD;
&#xD;
2nd Author: designed the experiments and methodology of the work&#xD;
&#xD;
3rd Author: Guided and manuscript prepared for the work which was carried out by the students &#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3455</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3455</Fulltext></URLs><References>1. Exner M, Bhattacharya S, Christiansen B, Gebel J, Goroncy-Bermes P, Hartemann P, et al. Antibiotic resistance: What is so special about multidrug-resistant Gram-negative bacteria?&#xD;
&#xD;
&#xD;
	&#xD;
	Antibiotic resistance: What is so special about multidrug-resistant Gram-negative bacteria?&#xD;
	&#xD;
	&#xD;
	Antibiotic resistance: What is so special about multidrug-resistant Gram-negative bacteria? GMS Hyg Infect Control 2017;12:5. &#xD;
	&#xD;
&#xD;
&#xD;
9. Chang HH, Cohen T, Grad YH, Hanage WP, O&#x2019;Brien TF, Lipsitch M. Origin and proliferation of MDR in bacterial pathogens. Microbiol Mol Biol Rev 2015;79(1):101-116. &#xD;
&#xD;
2. Bauer AW, Kirby WMM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966;45(4):493-496.&#xD;
&#xD;
3. Bertrand S, Bohni N, Schnee S, Schumpp O, Gindro K, Wolfender JL. Metabolite induction via microorganism co-culture: a potential way to enhance chemical diversity for drug discovery. Biotechnol Adv 2014;32(6):1180-1204. &#xD;
&#xD;
7. Tan ZQ, Leow HY, Lee DCW, Karisnan K, Song AAL, Mai CW, et al. Co-culture systems for the production of secondary metabolites: current and prospects. Biotechnol J 2018;13:18-26. &#xD;
&#xD;
5. Azzollini A, Boggia L, Boccard J, Sgorbini B, Lecoultre N, Allard PM, et al. Dynamics of metabolite induction in fungal co-cultures by metabolomics at both volatile and non-volatile levels.&#xA0;Frontiers in Microbiol&#xA0;2018. 9: 72.&#xD;
&#xD;
6. Rico-Gray V. Interspecific interaction. In: encyclopedia of life sciences. John Wiley &amp; Sons, Ltd. Nature 2001, 1-6. &#xD;
&#xD;
&#xD;
	&#xD;
	Sunderland D, Graczyk TK, Tamang L, Breysse PN. Impact of bathers on levels of Cryptosporidium parvum oocysts and Giardia lamblia cysts in recreational beach waters. Water Res 2007, 41(15): 3483-3489. &#xD;
	&#xD;
&#xD;
&#xD;
4. Fleming A. On the Antibacterial action of cultures of a Penicillium, with special reference to their use in the isolation of B. influenz&#xE6;.&#xA0;Br J Exp Pathol 1929, 10(3):226-236. &#xD;
&#xD;
&#xD;
	&#xD;
	Boucher HW, Talbot GH, Bradley JS, Edwards JE, Gilbert D, Rice LB, et al. Bad bugs, no drugs: No ESKAPE! an update from the infectious diseases society of America. Clin Infect Dis 2009, 1;48(1):1-12. doi: 10.1086/595011.&#xD;
	&#xD;
	&#xD;
	Fair RJ, Tor Y. Antibiotics and bacterial resistance in the 21st century. Perspectives in Med Chem 2014, 6: 25&#x2013;64. &#xD;
	&#xD;
	&#xD;
	Grundmann H, Klugman K, Walsh T, Ramon-Pardo P, Sigauque B, Khan W, et al.A framework for global surviellance of antibiotic res&#xED;stanse. Drug Resist Updat 2011, 14(2):79-87. doi: 10.1016/j.drup.2011.02.007. &#xD;
	&#xD;
&#xD;
&#xD;
8. Barlam TF, Cosgrove SE, Abbo LM, MacDougall C, Schuetz AN, Septimus EJ, et al. Implementing an antibiotic stewardship program: guidelines by the infectious diseases society of America and the society for healthcare epidemiology of America. Clin Infect Dis 2016, 62(10):e51&#x2013;77.&#xD;
&#xD;
&#xD;
	&#xD;
	Vandana K, Gargi Dangre, Abhay M. Healthcare setting and methicillin-resistant Staphylococcus aureus. Int J Cur Res Rev. Modern Therapeutics Applications, July, 2020, 123-128, http://dx.doi.org/10.31782/IJCRR.2020.123128&#xD;
	&#xD;
	&#xD;
	Sonnenbichler J, Dietrich J, Peipp H. Secondary fungal metabolites and their biological activities, V. investigations concerning the induction of the biosynthesis of toxic secondary metabolites in Basidiomycetes. Biolog Chem Hoppe Seyler 1994, 375(1):71&#x2013;80.&#xD;
	&#xD;
&#xD;
&#xD;
10. Mehta AP, Rodrigues C, Sheth K, Jani S, Hakimiyan A, Fazalbhoy N. Control of methicillin-resistant Staphylococcus aureus in a tertiary care centre&#x2013;a five-year study. J Med Microbiol 1998, 16(1): 31&#x2013;34. &#xD;
&#xD;
19. Nielsen JC, Nielsen J. Development of fungal cell factories for the production of secondary metabolites: linking genomics and metabolism. Synth Systems Biotechnol 2017, 2(1): 5-12. &#xD;
&#xD;
20. Wen Y, Lv L, Hao Ji, Chen H, Huang Y, Liu C, et al. Two new compounds of Penicillium polonicum, an endophytic fungus from Camptotheca acuminate Decne. Nat Prod Res 2018, 34(13): 1879-1883. doi.org/10.1080/14786419.2019.1569003&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Radiation-Induced Dysphagia and Life-Threatening Stridor in Head and Neck Cancer: A Review&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>157</FirstPage><LastPage>162</LastPage><AuthorList><Author>Santosh Kumar Swain</Author><AuthorLanguage>English</AuthorLanguage><Author> Satyabrata Acharya</Author><AuthorLanguage>English</AuthorLanguage><Author> Smarita Lenka</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Radiotherapy plays an important role in the treatment of head and neck cancer. Radiation therapy to the head and neck cancer can cause an uncommon long term swallowing and breathing difficulties by causing stenosis at the pharynx, larynx and oesophagus. The dysphagia or breathing difficulties by radiation therapy may occur be mechanical, structural and neurological deficits. It hurts the quality of life among cancer survivors. This acquired pharyngeal stenosis after radiotherapy may threaten to live by compromising the airway. Radiation-induced pharyngeal stenosis may occur in cases with head and neck cancer which cause significant morbidity and mortality. This article reviews details of radiation-induced pharyngeal or upper aerodigestive stenosis with manifestations of dysphagia and compromised airway including its epidemiology, pathophysiology, clinical presentations, investigations and possible treatment options. The pathogenesis for dysphagia and stridor due to pharyngeal and oesophagal stenosis following radiotherapy is unclear. Severe mucositis in the pharynx might be the predisposing factor for causing fibrosis and leads to stenosis. The upper aerodigestive tract stenosis following radiotherapy is an unusual complication which can be treated with dilation or excision with scar tissue. Although there is no specific or gold standard treatment option found for this stenosis, many supportive, restorative and palliative treatments are available under various clinical conditions.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Pharyngeal stenosis, Radiotherapy, Dysphagia, Stridor</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Radiotherapy is an important treatment option in head and neck squamous cell carcinoma. Along with surgery or chemotherapy, radiotherapy plays an important role in the treatment of the malignancy in the head and neck region.1 Many surgeons prefer preoperative radiotherapy while some choose planned postoperative radiation. In some patients, full therapeutic doses of radiotherapy are used, although in a reduced dose. The pharyngeal or oesophagal stenosis may be found as a complication of radiation exposure of the head and neck cancer. These manifestations can cause morbidity and life-threatening situation among the cancer-free survivors. Nasopharyngeal carcinoma is an important head and neck cancer where the treatment of choice is radiotherapy.2 There are several associated complications following radiotherapy to the head and neck region such as endocrine dysfunction and temporal lobe injury other than synechia the pharynx and oesophagus.3 The uncommon and dreaded complications of radiotherapy such as dysphagia and stridor are due to fibrosis and narrowing at the pharynx and oesophagus following radiotherapy. These clinical entities are less reported in the medical literature. The delayed effects of the radiation on the pharynx, oesophagus and larynx have not been studied adequately but these parts are often exposed to the radiation during the time of treatment of the head and neck cancer like nasopharyngeal carcinoma. The stenosis at the hypopharynx or upper oesophagus affects the swallowing at the initial period. However, in severe stenosis, it can lead to stridor along with dysphagia to the solid foods. This review article summarizes the epidemiology, pathophysiology, clinical manifestations, investigations and current treatment of the radiation-induced dysphagia and stridor.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
For searching the published research articles, we conducted an electronic survey of the SCOPUS, Medline, Google Scholar and Pubmed database (Figure 1). A search strategy using PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analysis) guidelines was developed (Fig. 1). Randomized controlled studies, observational studies, comparative studies, case series and case reports were evaluated for the eligibility. This review paper focuses only on the radiation-induced dysphagia and stridor. The search articles with no primary data related to the radiation-induced upper aerodigestive stenosis causing dysphagia and stridor were excluded. Non-English articles were also excluded. The search terms in the database included dysphagia, stridor, pharyngeal stenosis and oesophagal stenosis and radiation complication on the head and neck. The abstracts of the published articles were identified by this search method and other articles were identified manually from citations. This manuscript reviews the epidemiology, pathophysiology, clinical outcome, investigations and treatment of the radiation-induced dysphagia and stridor. This review article will surely act as a baseline for further prospective studies of radiation-induced dysphagia and stridor by pharyngeal or upper aerodigestive stenosis could be designed and helps as a spur for further research in this dreaded clinical entity.&#xD;
&#xD;
&#xD;
&#xD;
EPIDEMIOLOGY&#xD;
&#xD;
Head and neck cancer survivors are living longer because of the epidemiological changes in cancer and advancement in the treatment. However, clinicians encounter a growing number of patients with late effects of radiotherapy. Radiation associated dysphagia which progresses throughout the years after head and neck cancer treatment is often challenging in the era of organ preservation.4 The epidemiological studies of radiation-induced dysphagia and stridor are less documented in the medical literature. Dysphagia and stridor are extremely rare and morbid complaint by the patients following radiation therapy in nasopharyngeal carcinoma or any head and neck squamous cell carcinoma.5 Despite the hazardous effect of dysphagia and stridor on quality of life, the prevalence of this pharyngeal or oesophagal stenosis in patients who had radiated as part of their treatment for head and neck malignancy remains unclear. Nasopharyngeal carcinoma is commonly found in southern China and Hong Kong. 6 The incidence of the nasopharyngeal carcinoma is 20/100,000 population in a year at a high-risk region.7 Although uncommon, the late side effects like dysphagia and stridor are morbid complaint by radiotherapy in nasopharyngeal carcinoma or any head and neck squamous cell carcinoma. Radiotherapy is the treatment of choice in patients with nasopharyngeal carcinoma without distant metastasis. There were different late complications of radiation therapy documented in that region such as endocrine dysfunction and injury to the temporal lobe.8 The nasopharyngeal carcinoma is mainly treated by radiotherapy and it needs to follow up based on clinical, endoscopic radiological monitoring. The curative doses of radiotherapy in nasopharyngeal carcinoma can lead to complications like choanal stenosis and pharyngeal stenosis. The pharyngeal stenosis can cause dysphagia and severe variety of manifests stridor. Only a few such cases are reported in the medical literature and this may be a lack of follow up of these patients.&#xD;
&#xD;
PATHOPHYSIOLOGY&#xD;
&#xD;
The exact pathophysiology for radiation-induced pharyngeal stenosis is not well understood. The pathophysiology for dysphagia and stridor following radiotherapy to the head and neck area is complex. Radiotherapy induced xerostomia may induce the damage of the salivary glands, esophagitis and tracheobronchial aspiration which lead to stenosis of the pharynx and oesophagus.9 It is believed that radiation exposure to the neck causes fibrosis, gradual reduction of the vascularity and denervation atrophy of the pharyngeal muscles and mucosa leads to the pharyngeal stenosis and the severity is associated with the dose of radiation and field of radiation. In the affected area of the radiation-induced fibrosis, there is an increased proliferation of the fibroblasts, infiltration of the inflammatory cells and increased amount of the extracellular matrix.10 Radiotherapy alone or combined with chemotherapy in head and neck cancer may induce pharyngeal or oesophagal stenosis despite the preservation of the organ.11 The muscles of the pharynx, oesophagus and larynx are found deep to the submucosal and overlaid by stratified squamous epithelium and the lamina propria of the mucosal layer. The seromucous glands and lymphoid aggregates are seen throughout the mucosal layer and so radiation injury to these areas lead to noticeable soft tissue deformities like stenosis or stricture by altering the contour of the pharynx, larynx and oesophagus. Despite advancement in radiotherapy technique, there are still associated complications of radiation and these include mucositis, dermatological changes, swallowing defects due to changes in pharynx and oesophagus. These manifestations are found at the time of acute clinical period, the first 6 months after radiotherapy.12 &#xD;
&#xD;
Head and neck squamous cell carcinomas are common types of malignancies found in the population. The treatment options for squamous cell carcinoma of the head and neck region are usually surgery and chemoradiation. The radiotherapy and concomitant chemotherapy are widely accepted treatment options for organ preservation.13 There are considerable shuffling of the treatment options by the clinicians for treating the head and neck cancer. Some surgeon chooses preoperative radiotherapy, while some prefer postoperative radiation therapy. In a few cases, full therapeutic doses of radiation are given, although in the reduced dose. However, clinicians should know about the benefits of combinations of these two treatment modalities. The upper aerodigestive tract of the head and neck region is highly susceptible to radiation-induced damage and cause stenosis of the pharynx with impairment of the swallowing.14 The chemotherapy for malignancy of the head and neck region may increase the chance of stenosis of the upper aerodigestive part in cancer patients as adjuvant chemotherapy has been found to increase the chance of stricture formation in patients of oesophagal cancer.15 The benign hypopharyngeal or oesophagal fibrosis is usually secondary to the fibrosis at the lamina propria and sub-mucosa although inflammation, oedema and spasm of the muscles play important role in the etiopathogenesis of stricture formation. One study reported that absorbed dose of the radiation to the cricopharyngeal muscle and cervical part of the oesophagus plays a vital role in causing dysphagia.16&#xA0; The resultant structure cause temporary or permanent dysmotility. Ulceration at the hypopharynx or oesophagus may also increase the chance of stricture formation. It has been documented that oesophagal stricture can occur up to 5 years after completion of the radiotherapy.17 &#xD;
&#xD;
The introduction of intensity-modulated radiation therapy (IMRT) in the treatment of the head and neck cancer greatly minimized the damage to the adjacent part and adjust maximum to the target tissue. However, the loco-regional control of the malignancy of the head and neck region needs aggressive radiation treatment for reducing the tumour cells.18 These increased radiation schedules and high doses of the radiation (60 to 70 Gray), leading to rapid dose accumulation which is less tolerable. 19 &#xD;
&#xD;
CLINICAL PRESENTATIONS &#xD;
&#xD;
Stenosis at the hypopharynx or upper aerodigestive tract is an uncommon late complication of the radiotherapy for head and neck cancer. Severe radiation exposure to the patients is often prone to such complication, which may be found months to years after radiotherapy. Although the technique of radiotherapy in head and neck cancer is offering a promising treatment outcome, the complications during or after irradiation are inevitable and the quality of life after radiotherapy is usually compromised. The strictures of the hypopharynx, larynx and cervical part of the oesophagus are often complications of the radiotherapy. The cervical part of the oesophagus is usually included in the lower margin of the radiotherapy portal for head and neck cancer. The severity of the clinical presentations is closely related to the degree of the stenosis. The symptoms occurred due to the obstruction of the pharynx. The obstruction of the pharynx leads to dysphagia and breathing difficulty. Severe stenosis of the pharynx may lead to compromised airway and lead to stridor.20 Patients may also present with symptoms due to radiation effects on the other area of the head and neck such as dry mouth and impairment of hearing because of the eustachian dysfunction.21 The diagnosis of the pharyngeal stenosis is often late as patients are usually asymptomatic in the initial period after radiotherapy. So, follow up endoscopic examinations should be done at regular interval. Patients with post-radiotherapy hypopharyngeal and oesophagal stenosis or strictures initially show dysphagia to the solid foods and then progresses to the liquid foods over time. The degree or severity of the dysphagia is associated with the size of the lumen of the pharynx and oesophagus. In the case of oesophagal stricture, the diameter less than 12mm causes dysphagia to the normal diet. Patients may also present with chest or abdominal pain, regurgitation of food, aspiration of food and weight loss if the stenosis is found at the upper oesophagus.&#xD;
&#xD;
INVESTIGATIONS&#xD;
&#xD;
The diagnosis of the pharyngeal stenosis should be properly evaluated with help of the fiberoptic nasopharyngolaryngoscopy and computed tomography (CT) scan of the neck. Fiberoptic nasopharyngolaryngoscopy or rigid nasal endoscopy is helpful to assess the site and severity of the stenosis (Figure 2). &#xD;
&#xD;
&#xD;
&#xD;
Endoscopic examination reveals the anatomical location of the obstruction and confirms whether the lumen is obstructed completely or not. CT scan allows the confirmation and quantifying the degree of the stenosis (Figure 3).&#xD;
&#xD;
&#xD;
&#xD;
Direct laryngoscopy and biopsy should be mandatory from the stenosis site for excluding any residual or recurrent neoplasm and to assess the characteristics of the stricture. If the stenotic site is narrow and irregular the pediatric endoscope can be used for proper evaluation and biopsy.22 Stenosis at the hypopharynx is frequently found following total laryngectomy. Radiological examination often shows the narrowing at the superior surgical closure sites. Anastomotic strictures are seen after hypopharyngeal reconstruction in resection of the hypopharyngeal malignancy.23 &#xD;
&#xD;
TREATMENT&#xD;
&#xD;
The treatment of the pharyngeal or oesophagal stenosis following radiotherapy to malignancy of the head and neck area is often challenging because of the high incidence of recurrence. Stenosis at the upper aerodigestive tract may require dilatation or nasogastric tube feeding depending based on the severity of the obstruction. Surgical intervention is the treatment of choice for pharyngeal or oesophagal stenosis. There are many techniques available for correction of the pharyngeal stenosis. The techniques include simple dilatation, excision of the scar tissue, resection of the scar tissue with the use of rotational mucosal flaps, use of stent and coblation excision of the scar tissue and topical injection of the mitomycin-C injection. Patients often referred to the gastroenterologist for therapeutic oesophagal of pharyngeal dilatations if the stenosis is confirmed. If patients again complain of dysphagia after dilatation, repeat dilatation is advised. The endoscopic dilatation is the first line of treatment for the pharyngeal and oesophagal strictures. The dilatation should not be forceful as there is the risk of perforation. The first dilatation of the stenosis was reported in the seventh century with help of carved whalebone. 24 and the several dilators have been developed. Mercury-filled Maloney dilators are flexible bougies without guide wires are useful to dilate the benign strictures. 24 Balloon dilators are a useful technique for a successful outcome but more costly and may not be used more than once. The microdebrider is also a good option for excision of the scar tissue from the pharyngeal stenosis. The major challenge of this procedure is re-stenosis. The timing of the repair is important in case of pharyngeal stenosis. Early intervention can cause re-stenosis as scar bands which continue to contract and obstruct the pharynx. The surgeons those do not keep postoperative stenting often perform serial dilatations or revision endoscopic excision or removal of the crusting.25 &#xD;
&#xD;
After dilation of the stenotic segment, the pharyngeal wall at the site of the widening can be applied with mitomycin-C. Mitomycin-C is an antineoplastic antibiotic which acts as an alkylating agent and inhibits protein, DNA synthesis and fibroblast proliferation. Mitomycin-C is an antibiotic produced from Sterptomyces caespitosus.26,27 Mitomycin-C gives its effect by cross-linking to the DNA at the cellular level. It does not act randomly, rather it acts preferentially bind to the genes that are being induced. The Mitomycin-C is safe and used topically at various surgical locations for preventing re-stenosis without any major side effects.28 It also prevents the chance of synechia formation at the upper aerodigestive tract after dilatation or surgery with coblation. Although Mitomycin-C is a toxic drug, there has been no report regarding systemic toxicity.29 The safety dose of Mitomycin is topically 0.4 mg/ml in the treatment of the pharyngeal stenosis.29 &#xD;
&#xD;
Currently use of the radiofrequency or coblation for excision of the scar tissue with application of mitomycin is providing effective result with less chance of re-stenosis. 30 Coblation technology uses bipolar radiofrequency energy which generates a field of ionized sodium molecules that ablates and coagulates soft tissues without any thermal injury. Conductive saline solution is kept in the gap between the soft tissue and device tip and converts the saline into the ionized plasma layer. One this plasma layer touches the tissue, there is enough break the molecular bonds, causing molecular dissociation. This effect of the tissue dissociation occurs at the temperature of about 400C to 700C, so reduce the thermal damage to the tissue.31,32 &#xA0;&#xD;
&#xD;
The complications of the above procedures are minimal. After procedures of dilatations, slight bleeding and erosions of the mucosal linings are commonly found and these manifestations spontaneously resolve without any specific treatment. However, there are two important life-threatening complications may be found such as perforation of the pharynx or oesophagus and hematemesis. Post-dilatation check-up should be done by endoscope to rule out such complications. In the case of severing hypopharyngeal stenosis, the airway is also compromised which leads to stridor and this life-threatening situation need emergency tracheostomy for securing the airway. After successful dilation of hypopharyngeal stenosis, the tracheostomy tube can be decannulated.&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Radiotherapy is the treatment of choice in nasopharyngeal carcinoma without distant metastasis and also play an important role in the treatment of other head and neck squamous cell carcinoma. Radiation-induced biological alteration after radiation therapy to the head and neck area can be undetected for years but eventually lead to functional deficits by causing pharyngeal or oesophagal stenosis. In the early stage of the complications, patients may be asymptomatic but once the stenosis develops in the upper aerodigestive tract, leads to dysphagia and stridor. It minimizes the quality of life and increases the incidence of mortality even in the cancer-free survivor. Although there is no effective treatment available, dilatation of the pharynx or oesophagus with help of the different technique like bougies, microdebrider and coblation are treatment options. Clinicians should be aware of the radiation-induced complications leading to pharyngeal stenosis and its severity along with its treatment options.&#xD;
&#xD;
Conflict of interest: Nil&#xD;
&#xD;
Funding: No Funding sources were granted or used specifically for this work.&#xD;
&#xD;
Author Contribution: &#xD;
&#xD;
SKS: Concept, data collection and data analysis; &#xD;
&#xD;
SA: Data collection, data analysis, and drafting the manuscript; &#xD;
&#xD;
SL: Data collection and drafting. &#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3456</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3456</Fulltext></URLs><References>1. Morgan HE, Sher DJ.Adaptive radiotherapy for head and neck cancer. Head Neck Cance 2020;5:1-6.&#xD;
&#xD;
2. Swain SK, Samal S, Mohanty JN, Choudhury J. Nasopharyngeal carcinoma among the pediatric patients in a non-endemic region: our experience at a tertiary care teaching hospital in eastern India. Egy Pediatr Assoc Gazz 2020;68:23.&#xD;
&#xD;
3. Lam KS, Tse VK, Wang C, Yeung RT, Ho JH. Effects of cranial irradiation on hypothalamic-pituitary function- a 5-year longitudinal study in patients with nasopharyngeal carcinoma. Q J Med 1991;78:165-176.&#xD;
&#xD;
4. De Felice F, de Vincentiis M, Luzzi V, Magliulo G, Tombolini M, Ruoppolo G, et al. Late radiation-associated dysphagia in head and neck cancer patients: evidence, research and management. Oral Oncol 2018;77:125-130.&#xD;
&#xD;
5. Swain SK, Samal S, Anand N, Mohanty JN. Pediatric nasopharyngeal carcinoma. Int J Health Allied Sci 2019; 9:1-6.&#xD;
&#xD;
6. Swain SK, Samal S, Sahu MC.Nasopharyngeal carcinoma in a six-year-old female child: a case report. Pediatria Polska-Polish J Paediatr 2019; 94(2):132-135.&#xD;
&#xD;
7. Sun LM, Li CI, Huang EY, Vaughan TL. Survival difference by race in nasopharyngeal carcinoma. Am J Epidemiol 2007;165:271-278.&#xD;
&#xD;
8. Lam KS, Tse VK, Wang C, Yeung RT, Ho JH. Effects of cranial irradiation on hypothalamic-pituitary function&#x2014;a 5-year longitudinal study in patients with nasopharyngeal carcinoma. Q J Med 1991;78:165-176.&#xD;
&#xD;
9. Pauloski BR, Rademaker AW, Logemann JA, et al. Swallow function and perception of dysphagia in patients with head and neck cancer. Head Neck 2002;24:555-565.&#xD;
&#xD;
10. Sciubba JJ, Goldenberg D. Oral complications of radiotherapy. Lancet Oncol 2006;7:175-183.&#xD;
&#xD;
11. Sullivan CA, Jaklisch MT, Haddad R, et al. Endoscopic management of hypopharyngeal stenosis after organ sparing therapy for head and neck cancer. Laryngoscope 2004;114:1924-1931.&#xD;
&#xD;
12. Strauss M. Long term complication of radiotherapy confronting the head and neck surgeon. Laryngoscope 1983;93:310-313.&#xD;
&#xD;
13. Kuo P, Chen MM, Decker RH, Yarbrough WG, Judson BL. Hypopharyngeal cancer incidence, treatment, and survival: temporal trends in the United States. Laryngoscope 2014; 124(9):2064-2069.&#xD;
&#xD;
14. Batth SS, Caudell JJ, Chen AM. Practical considerations in reducing swallowing dysfunction following concurrent chemoradiotherapy with intensity-modulated radiotherapy for head and neck cancer. Head Neck 2014;36(2):291-298.&#xD;
&#xD;
&#xA0;15. Seeman H, Gates J, Morris T. Esophageal dysfunction years after radiation therapy. Dig Dis Sci 1992;37:303-306.&#xD;
&#xD;
16. Alterio D, Gerardi MA, Cella L, Spoto R, Zurlo V, Fodor C. Radiation-induced acute dysphagia. Strahlentherapie Oncol 2017;193(11):971-981.&#xD;
&#xD;
17. Moody GA, Probert CSJ. Mercury bougie self-dilation of the oesophagus in the 1990s. J Clin Gastoenterol1992;15:264-273.&#xD;
&#xD;
18. Fenwick JD, Pardo-Montero J, Nahum AE, Malik ZI. Impact of schedule duration on the head and neck radiotherapy: accelerated tumour repopulation versus compensatory mucosal proliferation. Int J Radiat Oncol Biol Phys 2012;82(2):1021-1030. &#xD;
&#xD;
19. Peters LJ, Ang KK, Thames HD Jr. Accelerated fractionation in the radiation treatment of head and neck cancer. A critical comparison of different strategies. Acta Oncol 1988;27(2):185-194.&#xD;
&#xD;
20. Swain SK, Mohanty S, Singh N, Samal R. An unusually Giant Hematoma threatening to the laryngeal airway. Int J Otorhinolaryngol Clin 2014;6(3):92-94.&#xD;
&#xD;
21. Swain SK, Janardan S, Mohanty JN. Endoscopy guided eustachian tube balloon dilation: Our experiences. Iran J Otorhinolaryngol 2020 Sep;32(112):287-294.&#xD;
&#xD;
22. Ferguson DD. Evaluation and management of benign oesophagal strictures. Dis Esophagus 2005;18:359-364.&#xD;
&#xD;
23. Annino DJ, Goguen LA. Mitomycin C for the treatment of pharyngoesophageal structures after total laryngopharyngectomy and microvascular free tissue reconstruction. Laryngoscope 2003;113:1499-1502.&#xD;
&#xD;
24. Spiess AE, Kahrilas PJ. Treating achalasia: from whalebone to laparoscope. JAMA 1998 280:638&#x2013;642&#xD;
&#xD;
25. Van Den Abbeele T, Francois M, Narcy P. Transnasal endoscopic treatment of choanal atresia without prolonged stenting. Arch Otolaryngol Head Neck Surg 2002;128:936&#x2013;940.&#xD;
&#xD;
26. Prasad M, Ward RF, April MM, Bent JP, Froehlich P. Topical mitomycin as an adjunct to choanal atresia repair. Arch Otolaryngol Head Neck Surg 2002;128:398-400.&#xD;
&#xD;
27. Lenka S, Swain SK, Bhuyan R, Sahu MC.Fungal infection in the oral cavity: A Review. Int J Cur Res Rev.2020;12(18):149-153.&#xD;
&#xD;
28. Kim KR, Song HY, Shin JH, Kim JH, Choi EK, Yang ZQ, et al. Efficacy of mitomycin-C irrigation after balloon dacryocystoplasty. J Vasc Interv Radiol 2007; 18(6):757-762.&#xD;
&#xD;
29. Rosseneu S, Afzal N, Yerushalmi B, Ibarguen-Secchia E, Lewindon P, Cameron D, et al. Topical application of mitomycin-C in oesophageal strictures. J Pediatr Gastroenterol Nutr 2007; 44:336-341.&#xD;
&#xD;
30. Hussein J, Tan TS, Chong AW, Narayanan P, Omar R. Velopharyngeal and choanal stenosis after radiotherapy for nasopharyngeal carcinoma. Auris Nasus Larynx 2013;40(40):323-326.&#xD;
&#xD;
31. Swain SK, Ghosh TK, Munjal S, Mohanty JN. Microscope assisted coblation tonsillectomy among paediatric patients-our experiences at an Indian teaching hospital. Pediatr Pol 2019; 94(3):170-174.&#xD;
&#xD;
32. Samal S, Debta P, Swain SK.Role of chromium enriched tobacco in the occurrence of oral carcinogenesis. Int J Cur Res Rev 2020;12(18):20-24.&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Comparing the Effect of Fast Tempo Music and Slow Tempo Music During Aerobic Exercise on Cardiovascular Endurance in Overweight Adolescents&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>163</FirstPage><LastPage>167</LastPage><AuthorList><Author>Sharayu Agre</Author><AuthorLanguage>English</AuthorLanguage><Author> Ronika Agrawal</Author><AuthorLanguage>English</AuthorLanguage><Author> Memon F</Author><AuthorLanguage>English</AuthorLanguage><Author> Ammarah Ravi</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: High prevalence of overweight has been found among adolescents in an urban population in developing countries. Physical activity habits track from youth to adulthood, therefore, adolescence may be a critical period for establishing a physically active lifestyle to enhance health and prevent chronic diseases in adulthood. Objective: To compare the effect of fast tempo and slow tempo music during aerobic exercise on cardiovascular endurance (CVE) in overweight adolescents. Methods: This was an interventional study with pre-test- post-test study design. Subjects were assessed using the 20mt Shuttle run test and VO2 max was calculated. The intervention was carried out for four weeks and aerobic exercise in the form of circuit training was administered to 90 overweight adolescents who were divided into 3 groups of 30 subjects each. The same exercise protocol was given with Group A exercising too fast tempo music, Group B to slow tempo music &amp; Group C, the control group, with no music. Results: Intragroup comparison in Group A, B and C showed a highly significant increase in VO2max Intergroup analysis using Anova showed, that the average increase of VO2max in Groups A and C is similar. The results also show that the VO2 max in group B was significantly higher than in Groups A and C. Conclusion: Our findings conclude that exercising with music shows more improvement in VO2 max and slow tempo music shows better results than fast tempo music or no music.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Music-Tempo, Aerobic exercise, Cardiovascular endurance, Circuit training</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Music is known to capture attention, trigger a range of emotions, alter or regulate mood, increase work output, induce states of higher functioning, reduce inhibitions and encourage rhythmic movement. Music also has an evident ergogenic effect as it improves exercise performance by either delaying fatigue or increasing work capacity.1 Music is comprised of several facets like rhythm, mode, genre, tempo, etc. The tempo is one of our study&#x2019;s main focuses, is defined by the oxford dictionary as the speed at which passage of music is played, which is often described in terms of beats per minute (bpm). &#xD;
&#xD;
In 2007, Carpentier and Potter studied how tempo affects arousal from a physiological perspective. They showed that fast-paced music (high bpm) induced a greater activation of the sympathetic nervous system than slow-paced music.2 Fast tempo music increased the plasma epinephrine level whereas slow tempo music decreased the plasma epinephrine level compared with baseline while listening to music 20 minutes before exercise.3 Hence, the tempo is found to be positively correlated with psychological and physiological functions.&#xD;
&#xD;
High prevalence of overweight has been found among adolescents in an urban population in developing countries. It points towards greater morbidity from diseases such as diabetes, Cardiovascular disease (CVS) and hypertension in years to come.4 Physical activity habits track from youth to adulthood, therefore, adolescence may be a critical period for establishing a physically active lifestyle to enhance health and prevent chronic diseases in adulthood.5 Most adolescents lack the motivation, time, interest or companionship to perform physical activity.6,7 &#xD;
&#xD;
Thus, to address the limitations of traditional exercise protocols and to provide an enjoyable, effective and efficient program, Circuit Training was used which can be performed by a large group of people together without the need for specialized equipment. Thus, a combination of different tempos of music along with circuit training may help in improving the cardiovascular endurance (CVE), reduction of fatigue, adherence to exercise program and promotion of a healthy lifestyle for overweight and obese adolescents.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
After the approval of the institutional ethical committee, 90 subjects having BMI between 85th to 95th percentile (WHO guidelines), aged 10-19 years were included in this interventional study.8 Subjects with hearing disabilities, cardiovascular/ pulmonary disease, any musculoskeletal injury within 6 months, those involved in weight reduction programmes or having continuous medications for 1 month or more for systematic illness were excluded from the study.&#xD;
&#xD;
Written consent was taken from all the parents/guardians as well as subjects before their participation. Pre and post-treatment assessment was done using the 20 M Shuttle Run Test and VO2max was calculated.&#xD;
&#xD;
The shuttle run test was performed using a standardized procedure.9&#xD;
&#xD;
VO2Max was calculated using the following formula: &#xD;
&#xD;
VO2max=41.76799+(0.49261&#xD7;PACER)-(0.00290&#xD7;PACER&#xB2;)-(0.61613&#xD7;BMI)+(0.34787&#xD7;gender&#xD7;age)&#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; (where PACER is the number of laps completed; &#xD;
&#xD;
&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; For gender, boy=1 and girl=0; and age is in years)&#xD;
&#xD;
[r=0.75, r2 = 0.56, SEE =6.17 ml &#x2044; kg &#x2044;min]9&#xD;
&#xD;
Familiarization session was held before beginning the protocol in which the exercises and the method for monitoring intensity were demonstrated and practically explained to the participants.&#xD;
&#xD;
Modification of Borg&#x2019;s scale (0 &#x2013; 10) was used to determine the intensity of the exercise sessions. &#xD;
&#xD;
The tempo of each track was found on the website https://getsongbpm.com.&#xA0; It was then converted into percentage values of 60-80 bpm (slow tempo music) and 140-160 bpm (fast tempo music). The tempo of the tracks was changed using the Music speed changer app and the tracks were merged using the Music Editor app.&#xD;
&#xD;
Interventions &#xD;
&#xD;
&#xD;
	&#xD;
	5 minutes of the warm up was given before the exercises which included jogging on the place for 5min at RPE 2-3.&#xD;
	&#xD;
	&#xD;
	The exercise session was conducted for 4 weeks, 3 times/week with progression as the weeks progressed. The intensity of exercise was moderate for 1st two weeks and high for week 3-4. &#xD;
	&#xD;
&#xD;
&#xD;
Exercises in Circuit training included (Figure 1) skipping without the rope, push up, abdominal crunch, mountain climber, two count jumping jog &amp; high knee running on the place. all exercises should be done with intensity according to Borg&#x2019;s scale with perceived exertion to somewhat hard i.e. 4.11&#xD;
&#xD;
&#xD;
	&#xD;
	5 minutes of cool down was given after the exercises which included 1 set of self-stretching of Biceps, Triceps, Long flexors of forearm, pectoralis major, Rectus femoris, Hamstring and Gastronomies muscles for 30sec with 2 repetitions.&#xD;
	&#xD;
	&#xD;
	The total duration of intervention was 40 min.&#xD;
	&#xD;
	&#xD;
	The rest period between each circuit was 30 sec.&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
RESULTS&#xD;
&#xD;
Statistical software R-studio version 3.6.2.was used for data analysis. It was observed by Shapiro-Francia normality tests that data were normally distributed; hence parametric tests were performed. Student t-tests (one-tailed, paired) was used for Intragroup analysis, ANOVAs &amp; multiple pair wise-comparison using Turkey HSD (honestly significant difference) test was used for intergroup analysis. Any p-value less than 0.01 was considered to be statistically significant. Of the 90 subjects enrolled in the study, 3 subjects dropped out.&#xD;
&#xD;
The homogeneity of variance was checked using the&#xA0;residuals versus fits plot where no evident relationship between residuals and fitted values was seen. Thus, the homogeneity of variances can be assumed. Table 1 shows the comparison of VO2max pre and post-intervention in the fast tempo music group. It shows statistical significance with p</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3457</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3457</Fulltext></URLs><References>&#xD;
	&#xD;
	Thakare AE, Mehrotra R, Singh A. Effect of music tempo on exercise performance and heart rate among young adults. Int J Physiol Pathoph Pharmacol 2017;9(2):35.&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Carpentier FR, Potter RF. Effects of music on physiological arousal: Explorations into tempo and genre. Media Psych 2007;10(3):339-363.&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Yamamoto T, Ohkuwa T, Itoh H, Kitoh M, Terasawa J, Tsuda T, et al. Effects of pre-exercise listening to slow and fast rhythm music on supramaximal cycle performance and selected metabolic variables. Arch Phys Biochem 2003;111(3):211-214.&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Schjerve IE, Tyldum GA, Tj&#xF8;nna AE, St&#xF8;len T, Loennechen JP, Hansen HE, et al. Both aerobic endurance and strength training programmes improve cardiovascular health in obese adults. Clin Sci 2008;115(9):283-293.&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Ramachandran A, Snehalatha C, Vinitha R, Thayyil M, Kumar CS, Sheeba L, et al. Prevalence of overweight in urban Indian adolescent school children. Diab Res Clin Pract 2002;57(3):185-190.&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Robbins LB, Pender NJ, Kazanis AS. Barriers to physical activity perceived by adolescent girls.&#xA0; J Midw Women&#x2019;s Health 2003;48(3):206-212. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Adamo KB, Rutherford JA, Goldfield GS. Effects of interactive video game cycling on overweight and obese adolescent health. App Physiol Nutr Metab 2010;35(6):805-815. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Kumar PP. The Effect of Circuit Training on Cardiovascular Endurance of High School Boys. Glob J Hum Soc Sci Res 2013;13(7):213. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Mahar MT, GuerieriAM, Hanna MS, Kemble CD. Estimation of aerobic fitness from 20-m multistage shuttle run test performance. Am J Prev Med 2011;41(4): S117-123. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Docherty DA, Wenger HA, Collis ML. The effects of resistance training on aerobic and anaerobic power of young boys. Med Sci Sport Exer 1987;19(4):389-392. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Herman L, Foster C, Maher MA, Mikat RP, Porcari JP. Validity and reliability of the session RPE method for monitoring exercise training intensity. Med Sci Sport Exer 2006;18(1):14-17. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Miller MB, Pearcey GE, Cahill F, McCarthy H, Stratton SB, Noftall JC, et al. The effect of a short-term high-intensity circuit training program on work capacity, body composition, and blood profiles in sedentary obese men: a pilot study. BioMed Res Int. 2014;20(1):114-117. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Paoli A, Pacelli QF, Moro T, Marcolin G, Neri M, Battaglia G, Sergi G, Bolzetta F, Bianco A. Effects of high-intensity circuit training, low-intensity circuit training and endurance training on blood pressure and lipoproteins in middle-aged overweight men. Lipids Health Dis 2013;12(1):131. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Daly I, Hallowell J, Hwang F, Kirke A, Malik A, et al. Changes in music tempo entrain movement related brain activity. In 2014 36th Annual International Conference of the IEEE Engineering in Medicine and Biology Society 2014:4595-4598. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Waterhouse J, Hudson P, Edwards B. Effects of music tempo upon submaximal cycling performance. Scand J Med Sci Sports 2010;20(4):662-669. &#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Seath L, Thow M. The effect of music on the perception of effort and mood during aerobic type exercise. Physiotherapy 1995;10(81):592-596.&#xD;
	&#xD;
	&#xD;
	Karageorghis CI, Priest DL. Music in the exercise domain: a review and synthesis (Part I). Int Rev Sport&#xA0; Exerc Psych 2012;5(1):44-66.&#xD;
	&#xD;
	&#xD;
	&#xA0;Maddigan ME, Sullivan KM, Halperin I, Basset FA, Behm DG. High tempo music prolongs high intensity exercise. Med J Tech 2019;6:e6164.&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	&#xA0;Thakare AE, Mehrotra R, Singh A. Effect of music tempo on exercise performance and heart rate among young adults. Int J Physiolo Pathophysiol Pharmacol 2017;9(2):35.&#xD;
	&#xD;
	&#xD;
	&#xA0;Patania VM, Padulo J, Iuliano E, Ardig&#xF2; LP, ?ular D, Mileti? A, De Giorgio A. The psychophysiological effects of different tempo music on endurance versus high-intensity performances. Front Psychol 2020;11:74.&#xD;
	&#xD;
	&#xD;
	&#xA0;Szabo A, Small A, Leigh M. The effects of slow-and fast-rhythm classical music on progressive cycling to voluntary physical exhaustion. J Spo Med Phys Fit 1999;39(3):220.&#xD;
	&#xD;
	&#xD;
	American College of Sports Medicine. ACSM&amp;#39;s exercise testing and prescription. Lippincott Williams &amp; Wilkins; 2017 Dec 26.&#xD;
	&#xD;
	&#xD;
	&#xA0;Kisner C, Colby LA: Therapeutic Exercise. Foundations and Techniques, 4th ed. Philadelphia: 2002; 151&#x2013;152.&#xD;
	&#xD;
	&#xD;
	&#xA0;Husain G, Thompson WF, Schellenberg EG. Effects of musical tempo and mode on arousal, mood, and spatial abilities. J Mus Perc 2002;20(2):151-171.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Need for the Implementation of Antibiotic Policy in India: An Overview&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>168</FirstPage><LastPage>178</LastPage><AuthorList><Author>Rihana Begum Patnool</Author><AuthorLanguage>English</AuthorLanguage><Author> Ashish Wadhwani</Author><AuthorLanguage>English</AuthorLanguage><Author> Balasubramaniam V</Author><AuthorLanguage>English</AuthorLanguage><Author> Sivasankaran Ponnusankar</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>World health organization accepted that antimicrobial resistance is a natural phenomenon, there is an urgent need for comprehensive national plans, based on a multi-sectorial approach and with sustainable financing to fight antimicrobial resistance globally. AMR continues to pose a significant public health problem in terms of mortality and economic loss. Studies related to antimicrobial drugs usage, determining factors and development of antimicrobial drug resistance, provincial discrepancy and interventional strategies is a big challenge for any developing country. This review article aims to highlight the importance of Antibiotic policy and its implementation in every health care system to make physicians, general practitioners, and other stakeholders aware of the issue of AMR and its factors and what can be done. Scoping review was done using ScienceDirect, Web of Science, EconLit, and PubMed. To discuss some of the challenges in the implementation of policies in India such as varied discernments about antibiotic use and AMR among key stakeholders, inappropriate antibiotic use and to achieve the aim of this review was performed by collecting around 80 published articles from 1999 to 2020. Initial suitable antibiotic treatment has been shown to reduce mortality, the span of stay in ICU and hospital. Early correct antibiotic choosen have also served to the reduction in antimicrobial costs. The hospitals which are having antibiotic policy shown decreased morbidity and mortality due to antibioticresistant infections. In developing countries, antimicrobial stewardship programs are emerging up, which will help to develop antibiotic policies for management of infections in various settings. This article focuses on the current status and implementation of antibiotic policy in Indian healthcare settings like the primary, secondary and tertiary hospital to combat antimicrobial resistance.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Antimicrobial resistance, Antibiotic policy, Antibiotics, Antimicrobial Stewardship Program, Developing Country, Indian Healthcare</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
Antimicrobial resistance is a unique community health problem especially in developing countries where comparatively easy availability and higher consumption of medicines have led to the disproportionately higher prevalence of inappropriate use of antibiotics and greater levels of resistance compared to developed countries.1-3 Supervision of frequent and lethal bacterial infections has been significantly compromised by the appearance and quick increase of antibiotic-resistant bacteria. The Global Antibiotic Resistance Partnership (GARP) was started to begin the practice of developing actionable policy recommendations relevant to low- and middle-income countries.4,5 Auta et al.,6 recently demonstrated that obtaining antibiotics without restrictions is possible in many countries through prescriptions at community pharmacies. In their meta-analysis on the effects of the unregulated sale of antibiotics conducted during 2000-2017, the authors represented data suggesting that the largely pooled proportion of antibiotics sold with no a prescription had reached 72%. Proportions are high even in partially developed countries such as Mexico, where a ban on the sale of antibiotics without a prescription was instituted only nine years ago.7 Every time an antibiotic is used - whether appropriately or not, in human beings or animals- the probability of the development and spread of antibiotic-resistant bacteria is increased.8,9 In the evolution of drug resistance in bacteria &#x2018;Drug selection pressure&#x2019; becomes the single most important factor. The reasons for selection of drug are multifactorial and involve both human and animal use. While antibiotic resistance is first and foremost a medical problem, the factors that control the spread of resistance are epidemiological, social, cultural, ecological and economic. Physicians, veterinarians, patients, retailers and healthcare facilities - from huge pharmacies to limited drug sellers - have little enthusiasm (economic or otherwise) to recognize the consequences of their use of antibiotics on others, especially on future generations.5 The microbial infection burden in India is among the highest in the world.10 Accordingly, antibiotics will perform a perilous role in limiting morbidity and mortality in the nation. As an indicator of disease burden, pneumonia causes an estimated 410,000 deaths in India each year.11 It is the number-one destroyer of children health.12Many of these leads to deaths which occur as patients do not have access to life-saving antibiotics when and where these are needed. At the other extreme, antimicrobial drugs are used in circumstances where these drugs cannot be expected to recover the patient&amp;#39;s condition, mainly as a treatment for the frequent cold and unsophisticated cases of diarrhoea (which are appropriately treated with oral rehydration therapy).5 The crude infectious disease mortality rate in India today is 5169.5 per 100,000 persons (according to Global Burden of Disease (GBD) study, carried out by Institute for Health Metrics and Evaluation, the USA from 1990 to 2017) and is twice the rate prevailing in the United States when antibiotics were introduced (roughly 200 per 100,000 persons).13&#xD;
&#xD;
&#xD;
&#xD;
According to the centre for disease dynamics, economics &amp; policy (CDDEP), one million Indian children die in the first 4 weeks of life each year, of these deaths 1,90,000 are caused by a bacterial infection, sepsis that surpass the bloodstream. Out of these deaths 58,319 (over 30%), deaths are due to antibiotic resistance. India already reported having resistance towards Colistin, an antimicrobial drug used when all other antibiotics fail.&#xD;
&#xD;
Indian Council of Medical Research (ICMR) in recent times identified antimicrobial-resistant organisms in the digestive tracts of two out of every three healthy persons (67%) that it tested, pointing to a quick broaden of antimicrobial resistance in the Indian population. A mix of underprivileged community health systems and hospital infection, high rates of infectious disease, and irrational use of antibiotics is impending together to increase the prevalence of resistant pathogens and is increasing the burden of untreatable neonatal sepsis and health-care-associated infections.14 The answer to the current approach to antibiotic resistance is to protect the efficiency of the drugs currently available by antibiotic stewardship and to capitalize on hospital infection-control practices, to limit the spread of resistance. Hence there is an urgent need to implement the antibiotic policy at all levels of Indian health care system. The principal aim of the hospital antibiotic policy is to diminish the morbidity and mortality due to antimicrobial-resistant infection, and to preserve the effectiveness of antimicrobial agents in the treatment and prevention of communicable diseases. Such policies are supposed to assist in reducing the spread of antimicrobial resistance, get better public health directly, benefit the population and lessen stress on the healthcare system. Lastly, ever-increasing the types and reporting of childhood vaccines presented by the government would decrease the disease burden extremely and spare antibiotics.&#xD;
&#xD;
THE RISE OF ANTIBIOTIC RESISTANCE&#xD;
&#xD;
The resistance to penicillin was noticed even earlier the widespread use of penicillin started. Abraham and Chain showed that E. coli cell extract could destroy the antimicrobial activity of penicillin by enzymatic action.15Sir Alexander Fleming, also, had cautioned about the development of antibiotic resistance due to the overuse of antibiotic, as early as 1945, stating:&#xD;
&#xD;
&#x201C;I would like to sound one note of warning. It is not difficult to make microbes resistant to penicillin in the laboratory, and the same thing has occasionally happened in the body. The time may come when penicillin can be bought by anyone in the shops. Then there is the danger that the ignorant man may easily underdose himself and by exposing his microbes to non-lethal quantities of the drug make them resistant.&#x201D;&#xD;
&#xD;
Sir Alexander Fleming: Nobel Lecture, December 11, 1945.&#xD;
&#xD;
His cautioning has, unfortunately, turned out to be right. With the wide use of antibiotics, pathogens, which were previously sensitive to antibiotics, now started emerging resistance to many classes of antibiotics. The timeline for the development of antibiotics and antibiotic resistance is represented in Figure 2,16 it indicates the increase in the antimicrobial drug resistance as the development of antimicrobial drug progressed and which may result in "Post antibiotic era" in 7-10 years from now. &#xD;
&#xD;
&#xD;
&#xD;
MECHANISMS OF RESISTANCE&#xD;
&#xD;
Pathogenic microorganisms are becoming resistant by the mutations of pre-existing Deoxyribonucleic acid (DNA) or by the procurement of DNA comprehending antibiotic resistance genes. These resistance genes converse ranges of different antibiotic resistance mechanisms to the pathogens. Table 1 represents the diverse classes of antimicrobial agents along with their mode of action and the mechanism of resistance by microorganisms clearly shows the resistance to antibiotics can be caused by four general mechanisms (inactivation, alteration of the target, circumvention of the target pathway or efflux of the antibiotic) and an organism can develop resistance by mutating existing genes, or by acquiring new genes from other strains or species.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Modification of the antibiotic: The resistance can be achieved by shifting the drug molecule so that it is no more effective. This kind of resistance is observed in the case of &#x3B2;-lactams, macrolides and chloramphenicol. The &#x3B2;-lactam antibiotics are antibiotics that contain a beta-lactam ring in their molecular structure. This includes penicillin derivatives, carbapenems, cephalosporins, carbacephems, and monobactams are one of the most commonly prescribed drug classes with numerous clinical indications. The intact &#x3B2;-lactam ring is necessary for the action of penicillins. Bacteria produce a heterogeneous group of enzymes called &#x3B2;-lactamases, which cleave the &#x3B2;-lactam ring and inactivate the drug, thus, conferring resistance.15 Chloramphenicol resistance is usually due to inactivation of the antibiotic by chloramphenicol acetyl-transferase,18 while resistance to aminoglycosides is widespread, with more than 50 aminoglycoside-modifying enzymes being discovered.19&#xD;
	&#xD;
	&#xD;
	Resistance by influx&#x2013;efflux systems: Microorganisms have dissimilar arrangements for transport of small molecules crosswise the cell membrane. If the antibiotic does not stay in the cell, then it would not have any adverse effect. The antibiotics are flushed out of the cells by efflux pumps thus, conferring resistance. Resistance to fluoroquinolones and tetracyclines is commonly observed by efflux mechanism.17, 20&#xD;
	&#xD;
	&#xD;
	Modification of the target site: If the target site is altered, it means that antibiotic cannot affect. The alterations in the antibiotic target sites can be carried out by mutation e.g., the mutation in DNA gyrase for resistance against quinolones, or enzyme modification of the target site e.g., methylation of an adenine residue in 23S rRNA making it insensitive to macrolides or by replacing targets e.g., ribosomal protection proteins conferring resistance to tetracyclines.17,20,21&#xD;
	&#xD;
&#xD;
&#xD;
There are other mechanisms of resistance such as overproduction of the target gene (dihydrofolate reductase overproduction for sulfonamide resistance), target protection (qnr genes for quinolone resistance), or production of other proteins which bind to the drug and prevents the original target (penicillin-binding proteins), but the above-discussed mechanisms are the major basic mechanisms of resistance widely encountered in pathogens.17, 20, 21&#xD;
&#xD;
ANTIMICROBIAL RESISTANCE IN INDIA&#xD;
&#xD;
Development of penicillin-resistant Streptococcus pneumoniae (PRSP), methicillin-resistant Staphylococcus aureus (MRSA), multidrug-resistant Pseudomonas aeruginosa, vancomycin-resistant Enterococcus (VRE) and multidrug-resistant Mycobacterium tuberculosis has led to difficulties in the treatment of infections caused by this pathogens.22 According to &amp;#39;scoping report on antimicrobial resistance in India (2017),23 under the tutelage of Government of India, among the Gram-negative bacteria, above 70% isolates of Escherichia coli, Acinetobacter baumanniiand Klebsiella pneumoniae and approximately 50% of Pseudomonas aeruginosa were resistant to fluoroquinolones and 3rdgeneration cephalosporins. While the resistance to the drug combination of piperacillin-tazobactam was still below 35% for E. coli and P. aeruginosa, the existence of multiple resistance genes including carbapenemases leads to 65%K. pneumoniae resistant.23,24 Increasing rates of carbapenem resistance, 71% for A. baumannii led to the frequent use of colistin as the last resort antimicrobial.23 The percentage of resistance among Salmonella Typhi was 28% and Shigella specieswas 82%, respectively, for ciprofloxacin, 0.6% and 12% for ceftriaxone and 2.3% and 80% for co-trimoxazole. For Vibrio cholerae, resistance rates to tetracycline varied from 17 to 75% in different parts of the country.23,24 Recently, high mortality rates are detected due to multidrug-resistant bacterial infections. Each year, around 410,000 people die in India from infection with multidrug-resistant. 11&#xD;
&#xD;
The drug susceptibility study results of various laboratories in India disclose an increasing trend of development of resistance to commonly used antibiotics in pathogens like Salmonella, Shigella, Vibrio cholerae, Staphylococcus aureus, Neisseria gonorrhoeae, N. meningitidis, Klebsiella, Mycobacterium tuberculosis, HIV(human immunodeficiency virus), plasmodium and others.25 New resistance mechanisms, such as the Metallo beta-lactamase NDM-1 (New Delhi Metallo beta-lactamase 1), have developed among several gram-negative bacilli. This can render powerful antibiotics ineffective, which are often used as the last line of defence against multi-resistant strains of bacteria.3 Table 2 shows the various studies on antimicrobial resistance in India. Due to the Extended-spectrum beta-lactamases (ESBL), multidrug-resistant entero bacteriaceae, have become very frequent in India. Besides, different studies in South India highlighted the resistance pattern like Ciprofloxacin resistant Salmonella enteric serovar Typhi, multidrug-resistant Extended-Spectrum &#x3B2;-Lactamase Producing Klebsiella pneumoniae, fluoroquinolone resistance among Salmonella enteric serovar Paratyphi A, the emergence of vancomycin-intermediate staphylococci, Pseudomonas aeruginosa and Acinetobacter baumannii resistant to ceftazidime, cefepime and ciprofloxacin. The resistance to colistin has also developed in India. Although the percentage of colistin resistance was below one, high mortality of 70% was associated with colistin-resistant K. pneumoniae. Amongst the Gram-positive organisms, 42.6% of Staphylococcus aureus were methicillin-resistant and 10.5% of Enterococcus faecium were vancomycin-resistant.26,27&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
CHALLENGES OF AMR IN INDIA&#xD;
&#xD;
India has been raised as &#x2018;the AMR capital of the world&#x2019;.54 Whereas, development of newer multi-drug resistant (MDR) organisms posture newer diagnostic and therapeutic challenges, while India is still striving to combat old enemies such as tuberculosis, malaria and cholera pathogens, which became more and more drug-resistant. Factors such as poverty, illiteracy, overcrowding and malnutrition additional compound the situation.55 Lack of awareness about infectious diseases in the common people and inaccessibility to healthcare frequently prevent them from seeking medical guidance. This, often, leads to self-prescription of antibiotics without any expert knowledge about the dose and duration of treatment.56 Patients who seek medical guidance, many end up consuming broad-spectrum high-end antibiotics due to lack of appropriate diagnostic modalities for identifying the pathogen and its drug susceptibility. Low doctor to patient and nurse to patient ratios along with lack of infection prevention and control (IPC) guidelines favour the spread of MDR organisms in the hospital settings.13,55 Easy accessibility of over the counter (OTC) drugs.57 additional contributes to antimicrobial resistance. Also, the increase in the pharmaceutical segment has triggered a corresponding increase in the amount of waste generated by these firms. With the absence of firm controlling and legal actions, this waste reaches the water bodies and serves as a continuous source of AMR in the environment.13,58 Another important challenge is the use of antimicrobial agents as pesticides and insecticides in the agriculture industry, while the evidence for the same is inadequate currently.59&#xD;
&#xD;
CONSEQUENCES OF RESISTANCE&#xD;
&#xD;
Antibiotic resistance had a great impact on health and wealth consequences. Increase in the resistance results in a decrease in the patient outcome and increase in the cost of pharmacy. According to most recent study resistance developed patients had an increase in intensive care admission and long duration of stay in hospitals. There is also an increase in the mortality rate of the patients admitted with antibiotic resistance. Bacterial resistance makes the therapeutic dilemma to clinicians.15 However, the rules for controlling the sale of antibiotics worldwide, but particularly in developing countries, are weak, thus making it necessary to establish more rigorous preventive actions to control the side effects of infections that are resistant to antibiotics (usually unnecessarily prescribed) or even multi-drug-resistance (MDR).60 MDR, defined as antimicrobial resistance to at least one agent across three or more antimicrobial categories, results from one of two mechanisms.61 multiple genes accumulated by bacteria, each coding for resistance to a single drug within a single cell,62and increased expression of genes that code for multidrug efflux points.63,64 The prevalence of MDR has been reported as ranging from 4% to 20%, with higher prevalence in nosocomial infections. MDR affects both Gram-positive and Gram-negative bacteria, but therapeutic options are more limited for the latter. MDR is a major global public health concern, magnified by antibiotic overuse and unwarranted prescribing antibiotics. The use of inappropriate empiric antimicrobials increases the risk of MDR and mortality.7&#xD;
&#xD;
Antibacterial drugs have been misused in humans for several decades, thereby creating ways for selection and spread of drug-resistant bacteria. Consequently, antibacterial drugs have become less effective or even ineffective, resulting in an accelerating global health security emergency that is rapidly outpacing the availability treatment options. WHO reports identify Staphylococcus aureus resistance to beta-lactam antibacterial drug methicillin as an international concern.65 Excess usage of antibiotics has expedited the development of methicillin resistance in S. aureus (MRSA). Risk of death in patients infected with MRSA is as high as 26.3%. Antibacterial resistance by MRSA also causes additional medical costs for antibacterial therapy, medical care and additional cost variable.66 MRSA strains identified four decades ago have become more problematic due to the evolutionary mechanisms adapted by the bacteria to evade antibiotics which are supported by environmental changes which aid the bacterial spread beyond the restrictions of health care facilities. Virulence conferred by these factors rendered the bacterium dominant resulting in making significant changes in the choice of antibiotics for the management of community-acquired infections.67&#xD;
&#xD;
Compared with the abrupt contests of HIV/AIDS, tuberculosis, malaria, pneumonia, and many other communicable diseases, the loss of antibiotics at some future time does not capture the same consideration. Resistance in contradiction of certain antibiotics is already at high levels in certain places in India (and around the world), but the problem has persisted largely unidentified because comparatively few studies were available and countrywide observation was not being carried out. But the issue came to the fore in India when New Delhi Metallo-?-lactamase-1 (NDM-1), first reported in 2009, made front-page news in 20105. Briefly, NDM-1 is an enzyme produced by the gene blaNDM-1; it is named for New Delhi because the Swedish patient in whom it was first identified had undergone surgery in a New Delhi hospital.68 NDM-1 may be the most widely known form of antibiotic resistance in India, but several studies in recent years have documented significant rates of resistance to a wide range of antibiotics. Many are of hospital-acquired Gram-negative infections with Acinetobacter, Pseudomonas, Klebsiella, E. coli and gonorrhoeae.69,70&#xD;
&#xD;
Comparable studies on the rise of antimicrobial resistance in gram-positive and gram-negative bacteria are reported also from India. The resistance array varies widely reliant on the type of the geographical location and health care setting, availability of antibiotics in hospitals and over the counter, prescribing habits of treating clinicians coming from different streams of medicine like allopathy, ayurvedic, homoeopathy or quacks. The drug resistance has been reported to develop in a population to an antibiotic molecule following its improper and irrational use. Irrespective of whether NDM-1 turns out to impend patients&amp;#39; health in India, the attention focused on this pathogen has encouraged the Government to act on antibiotic resistance. As an outcome, a Ministry of Health and Family Welfare task force declared a new national anti-microbial policy.71&#xD;
&#xD;
ANTIBIOTIC POLICY&#xD;
&#xD;
The terms antibiotic guidelines and policy are frequently used interchangeably and may be unclear to many healthcare professionals. An antibiotic policy is a set of ideologies to guide the execution of prudent and rational antimicrobial prescribing in the healthcare system. Antibiotic guidelines are detailed endorsements for antibiotic treatment or prophylaxis for particular infections, diseases or syndromes.72The antibiotic policy is the set of approaches and events commenced to establish the antimicrobial treatment in the hospital and reach health outcomes for patients. The straightforward ideologies are to be direct evidence-based medicine, local epidemiology and liberty for prescribing physicians. An antibiotic policy is now more mandatory than ever for clinical, epidemiological and economic reasons. The Infection Committee is responsible for the antibiotics policy in hospitals.73 The primary aim of the hospital antimicrobial policy is to diminish the morbidity and mortality due to antimicrobial-resistant infection, and to preserve the efficiency of antimicrobial agents in the treatment and deterrence of communicable diseases. The antibiotic policy is fundamentally for prophylaxis, definitive and empirical therapy. The policy shall include detailed endorsements for the treatment of diverse high-risk/special groups such as immunocompromised hosts; community-associated infections and hospital-associated infections. It ought to similarly set the stages for recommending antibiotics; for instance, first-choice antibiotics can be prescribed by all doctors while restricted choice antibiotics can only be prescribed after consulting the antimicrobial team (AMT) representative or the head of the department. Reserve antibiotics, conversely, are prescribed only by designated experts.74&#xD;
&#xD;
ATTRIBUTES OF ANTIBIOTIC POLICY&#xD;
&#xD;
The policy should be simple, clear, clinically appropriate, flexible and pertinent to day-to-day practice and accessible in user-friendly presentation such as a pocket guide, web-based form, etc. The recommended antibiotic should be effective against pathogens often seen in that locality.72 Guidelines should be provided for optimal selection, dosage, route of administration, duration, and alternatives for allergy to first-line agents; and for adjusted dosage for patients with impaired liver or renal function. Recommendation for prophylactic use should specify procedures for which antibiotic are needed, optimal agents, dosage, timing, route and duration of administration so that adequate antibiotic concentrations are available at the time of bacterial contamination. Prophylaxis recommendation should mainly focus on clean as well as contaminated procedures. The prophylactic dose is recommended for a short duration, free of side-effects, and should be relatively cheap. Also, the antibiotics selected for prophylaxis should not be used therapeutically; as this may lead to the emergence of antimicrobial resistance.74&#xD;
&#xD;
It will take substantial effort, time and resources to formulate antibiotic policies and guidelines from the scratch in this situation. It is worthwhile to go through the other guidelines that are pertinent to the local condition in the hospital setting or country and adapt accordingly. A multidisciplinary antibiotic administration team can be set up to engrave the antibiotic policy and guideline in hospital and the team includes surgeons, physicians, paediatricians, clinical microbiologists and pharmacists.43 And the policy should recommend the principles of antimicrobial stewardship, antibiotics for general use, reserved and restricted antibiotics; replacements for antibiotic use in case of allergy, guidance for the route of administration like intravenous to oral switch etc. Further, the guideline should also provide information on the diseased/syndrome e.g. pneumonia; type of clinical setting &#x2013; inpatient units, outpatient clinics, ICU setting; when to switch from IV to oral and measures for the finding of infection/syndrome. The policy and guideline should be clear, simple, appropriate to day to day practice, relevant to local clinical conditions and available in suitable formats. The antibiotic guidelines and policy are alive documents and consequently should be revised at regular intervals. They should be modernized conferring to current medical information, medical practice and local circumstances.75&#xD;
&#xD;
HOSPITAL VERSUS NATIONAL ANTIBIOTIC POLICY&#xD;
&#xD;
Generally, the hospital antibiotic policy should concur or align with the national antibiotic policy except for a few changes as warranted by the local antimicrobial resistance profiles. If there is a wide variation from national to hospital, and hospital to hospital then the desired purpose is defeated i.e., to minimize the morbidity and mortality due to antimicrobial-resistant infections; to preserve the effectiveness of antimicrobial agents in the treatment and to prevent microbial infections.74 A national antibiotic policy should address all relevant issues for antibiotic use, both in the community and the hospital, including veterinary and agricultural use.&#xD;
&#xD;
The National Policy for Containment of Antimicrobial Resistance - India covers a range of topics, including curbing antibiotic use in animals, particularly those raised for human consumption; conducting infection surveillance in hospitals; improving hospital surveillance for monitoring antibiotic resistance; promoting rational drug use through education, monitoring, and supervision; researching new drugs; and developing and implementing a standard and more restrictive antibiotic policy. Under the new Schedule H1 (now called HX), which will regulate antibiotic use, selling antibiotics over the counter will be banned. Certain antibiotics, including carbapenems, will be available at only tertiary hospitals.71&#xD;
&#xD;
IMPLEMENTATION OF ANTIBIOTIC POLICIES&#xD;
&#xD;
Antibiotic policy contributes to the optimization of antimicrobial therapy, ensuring the proper use (indication, dose and duration) and minimizing side effects.76 An adoption of these kinds of policies leads to a reduction in the prevalence of antimicrobial resistance, costs and save lives.77 In 2015 Canter for Disease Control and Prevention (CDC) published a report about core elements of hospital antibiotic stewardship programs.78 According to CDC &#x201C;there is no single template to optimize antibiotic usage&#x201D;. The medical decision is complex and the antibiotic implementation policies should be flexible. Therefore, there is a need for defined leadership and coordinated multidisciplinary approach.78 For ideal decision making in prescribing antibiotics, doctors essentially have adequate information about infectious diseases, infecting microbes, and antimicrobials. So, the leader of the program should be infectious disease expert or infectious disease professional should co-direct the program with a clinical pharmacist. Thus, the key members of an antimicrobial stewardship team are constituted.79 For antimicrobial resistance investigation a clinical microbiologist, and the computer support an information system specialist is also needed.80 The infectious diseases physician or a clinical pharmacist with infectious diseases training has to have interactions with the prescriber physicians. They should perform a prospective audit and a feedback system, serving to reduce the inappropriate use of antimicrobials.79,80&#xD;
&#xD;
In India, National Centre For Disease Control, under Directorate General of Health Services, Ministry of Health &amp; Family Welfare, has formulated National Treatment Guidelines for Antimicrobial Use in Infectious Diseases in the year 2016 to combat emerging Antimicrobial resistance in India71, and the implementation in the hospital level is lagging. As per data available from NABH assessor&#x2019;s conclave most accredited hospitals, though having a well written antibiotic policy on paper, are not compliant in practice. And so far, no hospital is maintaining a separate register for the use of antibiotics up to the mark. In a recent study antibiotics usage in an intensive care ICU are more expensive that has to be concerned and there is a need to follow the guidelines to be followed in using them which clearly states that the policies and guidelines for antibiotics used in the country are not efficient practice. India, with more than20,000 hospitals, more than a billion population, wide cultural diversity, socio-economic disparity, and a large medical community of more than three-fourths of a million doctors, will find the resistance problem an issue very difficult to tackle. Hence the government, policymakers and stakeholders should initiate the strategies to reduce the economic burden on the patient by developing and implementing the antibiotic policies in Indian healthcare settings like the primary, secondary and tertiary hospital to combat Antimicrobial resistance. To implement antibiotic usage as per the developed policies in India the national Action plan of the government should develop information, educate the physicians and the patients and training should be given on the usage of policies. &#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
In summary, the choice of suitable antimicrobial depends on an understanding of the prospective pathogens and local vulnerability patterns. In selecting the right antibiotics, the properties of the antimicrobials; such as Pharmacokinetics and Pharmacodynamic (PK and PD) profiles, mechanism of action and strength, permissibility and safety, are all important factors.81 Initial suitable antibiotic treatment has been shown to reduce mortality, the span of stay in ICU and hospital. Early correct antibiotic chooses have also served to the reduction in antimicrobial costs.82In this reverence, it is emphasized that infectious disease specialist service being a professional in the arena, plays a significant part in improving antimicrobial usage, by advising on the judicious use of antimicrobial agents and by developing evidence-based guidelines under the light of antibiotic implementation policies.83,84 Therefore it is essential to develop Antibiotic policy in every Indian health care system and implement it properly by educating and training the infectious disease specialist. All hospitals must have an infection control committee (ICC) and an antibiotic policy and should initiate or augment efforts towards implementation. Those hospitals with an existing ICC and an antibiotic policy should augment efforts to increase compliance with the policy. Hospitals without a policy must initiate efforts to formulate an ICC and an antibiotic policy. The Government of India and respective state governments should take initiative to develop the antibiotic policy at every public care hospital to decrease the morbidity and mortality due to antimicrobial-resistant infection, and to preserve the efficiency of antimicrobial agents in the treatment and prevention of communicable diseases.&#xD;
&#xD;
Acknowledgement&#xD;
&#xD;
Authors wish to thank JSS College of Pharmacy, Ooty and JSS Academy of Higher Education &amp; Research, Mysuru for providing all the necessary facilities and support to write this article. We also thank physicians/consultants of Govt. Medical College Hospital, Ooty for providing the necessary inputs and corrections of this manuscript.&#xD;
&#xD;
Conflict of Interest&#xD;
&#xD;
None&#xD;
&#xD;
Source of Funding &#xD;
&#xD;
None &#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3458</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3458</Fulltext></URLs><References>&#xD;
	&#xD;
	Verma S, Prakash V, Prasad KN, Dhol TN. High rates of antibiotic drug resistance among gram-negative bacilli in lower respiratory tract infections in north India. Int J Curr Res Rev 2016;8(14):9.&#xD;
	&#xD;
	&#xD;
	Deotale VS, Attal R, Narang P. Increase in antibiotic resistance: are bacteria growing with pan resistance? Int J Curr Res Rev 2015 Feb;7(3):43.&#xD;
	&#xD;
	&#xD;
	Kumar SG, Adithan C, Harish BN, Sujatha S, Roy G, Malini A. Antimicrobial resistance in India: A review. J Nat Sci Biol Med 2013 Jul;4(2):286-291. &#xD;
	&#xD;
	&#xD;
	World Health Organization Staff, World Health Organization. Cancer pain relief: with a guide to opioid availability. World Health Organization; 1996.&#xD;
	&#xD;
	&#xD;
	Ganguly NK, Arora NK, Chandy SJ, Fairoze MN, Gill JP, Gupta U, et al. Rationalizing antibiotic use to limit antibiotic resistance in India. Indian J Med Res 2011 Sep;134(3):281-94. &#xD;
	&#xD;
	&#xD;
	Auta A, Hadi MA, Oga E, Adewuyi EO, Abdu-Aguye SN, Adeloye D; Global access to antibiotics without prescription in community pharmacies: A systematic review and meta-analysis. J Infect 2019; 78(1):8-18.&#xD;
	&#xD;
	&#xD;
	Ju&#xE1;rez-Hern&#xE1;ndez E, Uribe M. The lack of guidelines and government policies for regulating nonprescription sale of antibiotics and its medical consequences; Ann &#xA0;Hepatol 2019;18(6);783-785.&#xD;
	&#xD;
	&#xD;
	Austin DJ, Kristinsson KG, Anderson RM. The relationship between the volume of antimicrobial consumption in human communities and the frequency of resistance. PNAS 1999;96:1152&#x2013;1156.&#xD;
	&#xD;
	&#xD;
	Laxminarayan R, Malani A. Extending the cure: policy responses to the growing threat of antibiotic resistance. Earthscan; 2007.&#xD;
	&#xD;
	&#xD;
	World Health Organization. World health statistics 2015. World Health Organization; 2015 May 14.&#xD;
	&#xD;
	&#xD;
	Mathew JL. Pneumococcal vaccination in developing countries: Where do science end and commerce begin? Vaccine 2009 Jul 9;27(32):4247-4251. &#xD;
	&#xD;
	&#xD;
	Levine OS, Cherian T. Pneumococcal vaccination for Indian children. Indian Paediatr 2007;44(7):491.&#xD;
	&#xD;
	&#xD;
	Laxminarayan R, Chaudhury RR. Antibiotic Resistance in India: Drivers and Opportunities for Action. PLoS Med 2016;13(3):e1001974. &#xD;
	&#xD;
	&#xD;
	Laxminarayan R, Matsoso P, Pant S, Brower C, R&#xF8;ttingen JA, Klugman K, et al. Access to effective antimicrobials: a worldwide challenge. Lancet 2016;387(10014), 168&#x2013;175.&#xD;
	&#xD;
	&#xD;
	Abraham EP, Chain E. An enzyme from bacteria able to destroy penicillin. Nature 1940 Dec;146(3713):837-845.&#xD;
	&#xD;
	&#xD;
	Saga T, Yamaguchi K. History of antimicrobial agents and resistant bacteria. JMAJ 2009 Mar;52(2):103-108.&#xD;
	&#xD;
	&#xD;
	Jayaraman, R; Antibiotic resistance: an overview of mechanisms and a paradigm shift. Curr Sci 2009;96(11):1475-1484.&#xD;
	&#xD;
	&#xD;
	Trieu-Cuot P, De Cespedes G, Bentorcha F, Delbos F, Gaspar E, Horaud T. Study of heterogeneity of chloramphenicol acetyltransferase (CAT) genes in streptococci and enterococci by polymerase chain reaction: characterization of a new CAT determinant. Antimicrobial agents and chemotherapy. 1993;37(12):2593-2598.&#xD;
	&#xD;
	&#xD;
	Schmitz,&#xA0;FJ&#xA0;and&#xA0;Fluit.&#xA0;AC&#xA0;1999.&#xA0;Mechanisms&#xA0;of resistance. In Infectious Diseases ed D.&#xA0;Armstrong, and&#xA0;S.&#xA0;Cohen,&#xA0;pp.&#xA0;7.2.1-7.2.14&#xD;
	&#xD;
	&#xD;
	Byarugaba DK. Mechanisms of antimicrobial resistance. InAntimicrobial Resistance in Developing Countries 2010 (pp. 15-26). Springer, New York, NY.&#xD;
	&#xD;
	&#xD;
	Aminov RI. A brief history of the antibiotic era: lessons learned and challenges for the future. Front Microbiol 2010;1:134.&#xD;
	&#xD;
	&#xD;
	Dulon M, Haamann F, Peters C, Schablon A, Nienhaus A. MRSA prevalence in European healthcare settings: a review. BMC Infect Dis 2011;11(1):138.&#xD;
	&#xD;
	&#xD;
	Gandra S, Joshi J, Trett A, Lamkang A, Laxminarayan R. Washington, DC: Center for Disease Dynamics, Economics &amp; Policy; 2017. Scoping Report on Antimicrobial Resistance in India.&#xD;
	&#xD;
	&#xD;
	Taneja N, Sharma M. Antimicrobial resistance in the environment: The Indian scenario. Indian J Med Res 2019;149(2):119-128.&#xD;
	&#xD;
	&#xD;
	World Health Organization. Prevention and containment of antimicrobial resistance. Report of a regional meeting Chiang Mai, Thailand, 8th to 11th of June 2010.&#xD;
	&#xD;
	&#xD;
	Sodhi K, Mittal V, Arya M, Kumar M, Phillips A, Kajla B. Pattern of colistin resistance in Klebsiella isolates in an Intensive Care Unit of a tertiary care hospital in India. J Infect Public Health 2020 Jul;13(7):1018-1021.&#xD;
	&#xD;
	&#xD;
	Mitra S, Basu S, Rath S, Sahu SK. Colistin resistance in Gram-negative ocular infections: prevalence, clinical outcome and antibiotic susceptibility patterns. Int Ophthalmol 2020;23:1-13.&#xD;
	&#xD;
	&#xD;
	Misra RN, Debata NK, Chander Y, Ohri VC. Changes in urinary isolates and their antibiotic resistance pattern. Med J Armed Forces India 1999;55(2):115-118.&#xD;
	&#xD;
	&#xD;
	Harris Jr KA, Mukundan U, Musser JM, Kreiswirth BN, Lalitha MK. Genetic diversity and evidence for acquired antimicrobial resistance in Mycobacterium tuberculosis at a large hospital in South India. Int J Infect Dis 2000;4(3):140-147.&#xD;
	&#xD;
	&#xD;
	Lalitha MK, Pai R, Manoharan A. Multidrug-resistant Streptococcus pneumoniae from India. Lancet 2002;359(9304):445.&#xD;
	&#xD;
	&#xD;
	Shahid M, Malik A. Multidrug-resistant Pseudomonas aeruginosa strains harbouring R-plasmids and AmpC &#x3B2;-lactamases isolated from hospitalised burn patients in a tertiary care hospital of North India. FEMS Microbiol Lett 2003;228(2):181-186.&#xD;
	&#xD;
	&#xD;
	Lahiri KK, Mani NS, Purai SS. Acinetobacter spp as a nosocomial pathogen: Clinical significance and antimicrobial sensitivity. Med J Armed Forces India 2004;60(1):7-10.&#xD;
	&#xD;
	&#xD;
	Sinha S, Chattopadhyay S, Bhattacharya SK, Nair GB, Ramamurthy T. An unusually high level of quinolone resistance associated with type II topoisomerase mutations in quinolone resistance-determining regions of Aeromonas caviae isolated from diarrhoeal patients. Res Microbiol 2004;155(10):827-829.&#xD;
	&#xD;
	&#xD;
	Wattal C, Joshi S, Sharma A, Oberoi JK, Prasad KJ. Prescription auditing and antimicrobial resistance at a tertiary care hospital in New Delhi, India. J Hospital Infect 2005;59(2):156-158.&#xD;
	&#xD;
	&#xD;
	Arya SC, Agarwal N, Agarwal S. Comparison of two amoxicillin/clavulanic acid-resistant profiles employing two types of assay disks: A pilot study in 50 isolates from a tertiary care hospital in India. Curr Therap Res 2006;67(2):151-156.&#xD;
	&#xD;
	&#xD;
	Krishna BV, Patil AB, Chandrasekhar MR. Fluoroquinolone-resistant Vibrio cholerae isolated during a cholera outbreak in India. Transact Royal Soc Trop Med Hygiene 2006;100(3):224-226.&#xD;
	&#xD;
	&#xD;
	Sharma NC, Mandal PK, Dhillon R, Jain M. Changing profile of Vibrio cholerae 01, 0139 in Delhi &amp; its periphery (2003-2005). Indian J Med Res 2007 May 1;125(5):633.&#xD;
	&#xD;
	&#xD;
	Arora S, Saha S, Bal M. Imipenem-resistance among multi-drug resistant clinical strains in urinary infections from Kolkata. Indian J Med Res 2007 May;125(5):689-692.&#xD;
	&#xD;
	&#xD;
	Jain A, Mondal R; Prevalence &amp;amp; antimicrobial resistance pattern of extended-spectrum beta-lactamase-producing Klebsiella spp isolated from cases of neonatal septicaemia, Indian J Med Res 2007;125(1):89-94.&#xD;
	&#xD;
	&#xD;
	Menezes GA, Harish BN, Sujatha S, Vinothini K, Parija SC; Emergence of vancomycin-intermediate Staphylococcus species in southern India, J Med Microbiol 2008 Jul; 57(Pt 7):911-912.&#xD;
	&#xD;
	&#xD;
	Chande CA, Shrikhande SN, Jain DL, Kapale S, Chaudhary H, Powar RM; Prevalence of methicillin-resistant Staphylococcus aureus nasopharyngeal carriage in children from the urban community at Nagpur. Indian J Public Health 2009; 53(3):196-198.&#xD;
	&#xD;
	&#xD;
	Manoharan A, Chatterjee S, Mathai D, SARI Study Group; Detection and characterization of Metallo beta lactamases producing Pseudomonas aeruginosa, Indian J Med Microbiol 2010;28(3):241-244.&#xD;
	&#xD;
	&#xD;
	Shenoy MS, Bhat GK, Kishore A, Hassan MK; Significance of MRSA strains in community associated skin and soft tissue infections, Indian J Med Microbiol 2010; 28(2):152-154.&#xD;
	&#xD;
	&#xD;
	Adhikari L. High-level aminoglycoside resistance and reduced susceptibility to vancomycin in nosocomial enterococci. J Global Infect Dis 2010 Sep;2(3):231.&#xD;
	&#xD;
	&#xD;
	Behera B, Mathur P. High levels of antimicrobial resistance at a tertiary trauma care centre of India. Indian J Med Res 2011 Mar;133(3):343.&#xD;
	&#xD;
	&#xD;
	Menezes GA, Harish BN, Khan MA, Goessens WH, Hays JP. Antimicrobial resistance trends in blood culture positive Salmonella Typhi isolates from Pondicherry, India, 2005&#x2013;2009. Clin Microbiol Infect 2012;18(3):239-245.&#xD;
	&#xD;
	&#xD;
	Bagla J, Ghosh V, Ramji S, Gothi D. Antimicrobial susceptibility patterns following the change in antibiotic policy in NICU. Pediatr Infect Dis 2013;5(2):59-63.&#xD;
	&#xD;
	&#xD;
	Wattal C, Raveendran R, Goel N, Oberoi JK, Rao BK. Ecology of bloodstream infection and antibiotic resistance in the intensive care unit at a tertiary care hospital in North India. Braz J Infect Dis 2014;18(3):245-251.&#xD;
	&#xD;
	&#xD;
	Bouchiat C, El-Zeenni N, Chakrakodi B, Nagaraj S, Arakere G, Etienne J. Epidemiology of Staphylococcus aureus in Bangalore, India: the emergence of the ST217 clone and high rate of resistance to erythromycin and ciprofloxacin in the community. Microbes new infecti 2015;7:15-20.&#xD;
	&#xD;
	&#xD;
	Agarwal R, Sankar J. Characterisation and antimicrobial resistance of sepsis pathogens in neonates born in tertiary care centres in Delhi, India: a cohort study. Lancet Global Health 2016;4(10):e752-760.&#xD;
	&#xD;
	&#xD;
	Gandra S, Mojica N, Klein EY, Ashok A, Nerurkar V, Kumari M, et al. Trends in antibiotic resistance among major bacterial pathogens isolated from blood cultures tested at a large private laboratory network in India, 2008&#x2013;2014. Int J Infect Dis 2016;50:75-82.&#xD;
	&#xD;
	&#xD;
	Gupta R, Malik A, Rizvi M, Ahmed M, Singh A. Epidemiology of multidrug-resistant Gram-negative pathogens isolated from ventilator-associated pneumonia in ICU patients. J Global Antimicrob Resis 2017;9:47-50.&#xD;
	&#xD;
	&#xD;
	Mohapatra DP, Debata NK, Singh SK. Extensively drug-resistant and pan drug-resistant Gram-negative bacteria in a tertiary-care hospital in Eastern India: A 4-year retrospective study. J Global Antimicrob Resis 2018 Dec;15:246-249.&#xD;
	&#xD;
	&#xD;
	Chaudhry D, Tomar P. Antimicrobial resistance: The next big pandemic. Int J Community Med Public Health 2017;4:2632&#x2013;2636.&#xD;
	&#xD;
	&#xD;
	Swaminathan S, Prasad J, Dhariwal AC, Guleria R, Misra MC, Malhotra R, et al. Strengthening infection prevention and control and systematic surveillance of healthcare-associated infections in India. BMJ 2017;358:j3768.&#xD;
	&#xD;
	&#xD;
	Morgan DJ, Okeke IN, Laxminarayan R, Perencevich EN, Weisenberg S. Non-prescription antimicrobial use worldwide: A systematic review. Lancet Infect Dis 2011;11:692&#x2013;701.&#xD;
	&#xD;
	&#xD;
	Bate R, Tren R, Mooney L, Hess K, Mitra B, Debroy B, Attaran A. Pilot study of essential drug quality in two major cities in India. PLoS One. 2009 Jun;4(6):e6003.&#xD;
	&#xD;
	&#xD;
	Lundborg CS, Tamhankar AJ. Antibiotic residues in the environment of South East Asia. BMJ 2017;358:j2440.&#xD;
	&#xD;
	&#xD;
	Forsberg KJ, Patel S, Gibson MK, Lauber CL, Knight R, Fierer N, et al. Bacterial phylogeny structures soil resistors across habitats. Nature 2014;509(7502):612-616.&#xD;
	&#xD;
	&#xD;
	Chandy SJ, Naik GS, Balaji V, Jeyaseelan V, Thomas K, Lundborg CS. High-cost burden and health consequences of antibiotic resistance: the price to pay. J Infect Devel Countries 2014 Sep;8(09):1096-102.&#xD;
	&#xD;
	&#xD;
	Bhattacharya C, Das-Mondal M, Gupta D, Sarkar AK, Kar-Purkayastha S, Konar A. Infection in cirrhosis: A prospective study. Ann Hepatol 2019;18(6):862-868.&#xD;
	&#xD;
	&#xD;
	Strauss E. The impact of bacterial infections on the survival of patients with decompensated cirrhosis. Ann Hepatol 2014 Jan;13(1):7-19.&#xD;
	&#xD;
	&#xD;
	Fern&#xE1;ndez J, Bert F, Nicolas-Chanoine MH. The challenges of multi-drug-resistance in hepatology. Ann Hepatol 2016 Nov;65(5):1043-1054.&#xD;
	&#xD;
	&#xD;
	Nikaido H. Multidrug resistance in bacteria. Annu Rev Biochem 2009 Jul 7;78:119-146.&#xD;
	&#xD;
	&#xD;
	World Health Organization. Antimicrobial resistance: global report on surveillance. Geneva, Switzerland: WHO; 2014&#xD;
	&#xD;
	&#xD;
	Holcomb HG, Durbin KJ, Cho M, Choi KJ, Darling ND, Angerio AD. Methicillin-resistant Staphylococcus aureus as a threat to public health: a cellular approach. GU J Health Sci 2013;7:1&#x2013;8.&#xD;
	&#xD;
	&#xD;
	Gebo KA, Burkey MD, Lucas GM, Moore RD, Wilson LE. Incidence of, risk factors for, clinical presentation, and 1-year outcomes of infective endocarditis in an urban HIV cohort. J Acquir Immune Defic Syndr 2006;43:426-432.&#xD;
	&#xD;
	&#xD;
	Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a new Metallo-&#x3B2;-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother 2009;53(12):5046-5054.&#xD;
	&#xD;
	&#xD;
	Sinha M, Srinivasa H, Macaden R. Antibiotic resistance profile &amp; extended-spectrum beta-lactamase (ESBL) production in Acinetobacter species. Indian J Med Res 2007; 126: 63-67.&#xA0; &#xD;
	&#xD;
	&#xD;
	Gaur A, Garg A, Prakash P, Anupurba S, Mohapatra TM. Observations on carbapenem resistance by minimum inhibitory concentration in nosocomial isolates of Acinetobacter species: an experience at a tertiary care hospital in North India. J Health Popul Nutr 2008; 26:183-188.&#xA0; &#xD;
	&#xD;
	&#xD;
	Srivastava RK, Chaudhury RR, Bramhachari SK, Singh S, Guleria R, Sinha A, et al. National policy for containment of antimicrobial resistance India. Directorate General of Health Services, Ministry of Health and Family Welfare, Nirman Bhawan, New Delhi; 2011.&#xD;
	&#xD;
	&#xD;
	&#xD6;zgen&#xE7; O. Methodology in improving antibiotic implementation policies. J Hepatol 2016 Jun;6(2):143.&#xD;
	&#xD;
	&#xD;
	Cisneros JM, P&#xE9;rez-Moreno MA, Gil-Navarro MV. Pol&#xED;tica de antibi&#xF3;ticos. Comisi&#xF3;n de infecciones y uso de antimicrobianos. Enfermedades Infecciosas y Microbiolog&#xED;a Cl&#xED;nica. 2014 Oct 1;32(8):533-6.&#xD;
	&#xD;
	&#xD;
	World Health Organization. A step-by-step approach for development and implementation of hospital and antibiotic policy and standard treatment guidelines. WHO Regional Office for South-East Asia; 2011.&#xD;
	&#xD;
	&#xD;
	Sim&#xF5;es AS, Greg&#xF3;rio J, P&#xF3;voa P, Lap&#xE3;o LV. Practical guide for the implementation of Antibiotic Stewardship Programs. Lisboa: Instituto de Higiene e Medicina Tropical. 2015 Sep&#xD;
	&#xD;
	&#xD;
	Davey P, Brown E, Charani E, Fenelon L, Gould IM, Holmes A, Ramsay CR, Wiffen PJ, Wilcox M. Interventions to improve antibiotic prescribing practices for hospital inpatients. Cochrane Database of Systematic Reviews. 2013(4). &#xD;
	&#xD;
	&#xD;
	Malani AN, Richards PG, Kapila S, Otto MH, Czerwinski J, Singal B. Clinical and economic outcomes from a community hospital&amp;#39;s antimicrobial stewardship program. Am J Infect Control 2013;41(2):145-148.&#xD;
	&#xD;
	&#xD;
	Pollack LA, Srinivasan A. Core elements of hospital antibiotic stewardship programs from the Centers for Disease Control and Prevention. Clin Infect Dis 2014;59(suppl 3):S97-100.&#xD;
	&#xD;
	&#xD;
	Dellit TH, Owens RC, McGowan JE, Gerding DN, Weinstein RA, Burke JP, et al. Infectious Diseases Society of America and the Society for Healthcare Epidemiology of America guidelines for developing an institutional program to enhance antimicrobial stewardship. Clin Infect Dis 2007 Jan 15;44(2):159-177.&#xD;
	&#xD;
	&#xD;
	Shlaes DM, Gerding DN, John Jr JF, Craig WA, Bornstein DL, Duncan RA, et al. Society for Healthcare Epidemiology of America and Infectious Diseases Society of America Joint Committee on the Prevention of Antimicrobial Resistance: guidelines for the prevention of antimicrobial resistance in hospitals. Clin Infect Dis 1997;25(3):584-99.&#xD;
	&#xD;
	&#xD;
	Masterton R, Drusano G, Paterson DL, Park G. Appropriate antimicrobial treatment in nosocomial infections&#x2014;the clinical challenges. J Hospital Infect 2003;55:1-2.&#xD;
	&#xD;
	&#xD;
	Leekha S, Terrell CL, Edson RS. General principles of antimicrobial therapy. In Mayo Clinic Proceedings 2011 Feb 1 (Vol. 86, No. 2, pp. 156-167). Elsevier.&#xD;
	&#xD;
	&#xD;
	Masterton R. The importance and future of antimicrobial surveillance studies. Clin Infect Dis 2008;47(Supplement_1):S21-31.&#xD;
	&#xD;
	&#xD;
	Al-Tawfiq JA. The pattern and impact of infectious diseases consultation on antimicrobial prescription. J Global Infect Dis 2013 Apr;5(2):45.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Efficacy of BISAP &amp; APACHAE2 Scoring System in Early Prediction of Severity in Acute Pancreatitis: A Prospective Study&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>179</FirstPage><LastPage>182</LastPage><AuthorList><Author>Rahul Ranjan</Author><AuthorLanguage>English</AuthorLanguage><Author> Tushar Parmeshwar</Author><AuthorLanguage>English</AuthorLanguage><Author> Sharaddendu Bali</Author><AuthorLanguage>English</AuthorLanguage><Author> Akhilesh Yadav</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Different methods, including the Ranson criteria, Acute Physiology &amp; Chronic Health Assessment (APACHE) II, Computed Tomography (CT) Severity Index (CTSI), Glasgow &amp; Imrie scoring systems, have been used over the years to predict the severity and outcome of acute pancreatitis. Each has benefits &amp; drawbacks &amp; none of them is currently accepted as a standard criterion. An early, easy, clear, reliable &amp; reproducible definition of disease severity could promise an ideal scoring system. Objective: To evaluate the efficacy of BISAP &amp; APACHAE2 Scoring System in early prediction of severity in Acute Pancreatitis. Methods: A total of 50 consecutive cases fulfilling the eligibility criteria were taken for study after informed consent. Results: The BISAP score&#x2019;s sensitivity &amp; specificity was 75% &amp; 76.2%, with a positive &amp; negative predictive value of 37.5% &amp; 94.1%. The overall accuracy of the BISAP score for extreme acute pancreatitis prediction was 76%. The APACHE II score&#x2019;s sensitivity &amp; specificity was 62.5% &amp; 85.7%, with a positive &amp; negative predictive value of 45.5% &amp; 92.3%. In predicting extreme acute pancreatitis, the overall accuracy of the BISAP score is 82%. Conclusion: Current research shows that the scoring systems, i.e., all In the prediction of serious acute pancreatitis, APACHE II &amp; BISAP were comparable &amp; fine (SAP). The BISAP score was outperformed in precision, but with a good sensitivity &amp; negative predictive value compared to the APACHE II score.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Acute pancreatitis, BISAP score, APACHE II score, SAP and abdominal catastrophes.</Keywords><Fulltext>Introduction&#xD;
&#xD;
In the diagnosis of acute pancreatitis, the clinical &amp; biochemical parameters form the main factor. However the history and clinical presentation may be deceptive and the biochemical parameters (serum amylase values in particular) may be normal, particularly if the test is performed a few days after the initial attack.1 Conventional radiograph have been used to exclude other abdominal catastrophes and help the clinical presumption of acute pancreatitis. In patients suspected of having acute pancreatitis, radiographic studies are of minimal use in both promoting and excluding their diagnosis.2,3 The abdomen&amp;#39;s supine, lateral decubitus and erect films help to exclude other diagnoses, such as a perforated viscus. Nonspecific findings in patients with acute pancreatitis, including adynamic ileus or sentinel loop, are found on radiographs.4 Moreover in patients with chronic pancreatitis, pancreatic calcifications may be observed and peripancreatic gas is seen uncommonly in patients with pancreatic abscess. Such exams are very insensitive &amp; unspecific. In serious pancreatitis, mortality can range from 1% to up to 26% in acute pancreatitis. A significant step in improving the outcome is to classify patients at risk for mortality early in the course of acute pancreatitis. Acute pancreatitis treatment is also a problem that the clinician faces.5,6 Yet some guiding principles have evolved over the years, which have also been borne out by the present research. In mild cases, conservative steps such as fasting &amp; vigorous intravenous fluid rehydration are often successfully treated, and extreme cases may require admission to the intensive care unit or even surgery to cope with complications of the disease process.7A very important technique is to be able to predict the prognosis of a patient with acute pancreatitis at admission, given that this would enable them to practice patient management standardization guidelines, such as the use of antibiotics, computed tomography scan timings, the use of Endoscopic retrograde cholangiopancreatography (ERCP) and operative intervention. This will translate into enhanced performance in turn.8&#xD;
&#xD;
Materials and Methods&#xD;
&#xD;
At the Department of Surgery of a tertiary healthcare facility, the latest research was performed on diagnosed cases of Acute Pancreatitis coming to our hospital. This was a prospective, retrospective clinical study conducted over a two-year duration after informed consent on a total of 50 consecutive cases meeting the eligibility requirements for the study.&#xD;
&#xD;
Inclusion/Exclusion Criteria&#xD;
&#xD;
All adults of both sexes (&gt;18 years). Acute pancreatitis cases with elevated serum lipase/amylase levels &amp; confirmed by USG/CT scan. Gut-perforated pancreatitis and pregnancy pancreatitis patients were excluded.&#xD;
&#xD;
Procedure&#xD;
&#xD;
Valid informed consent for inclusion in the study was obtained from patients or associated patients. Medical, laboratory and radiological data were obtained within 24 hours of presentation from each patient diagnosed with acute pancreatitis. Using the data collected, BISAP &amp; APACHE II SCORE was determined for each patient. During their hospital admission, these patients were then followed and reviewed for the development of complications, organ failure, death or before the patient was released. The BISAP &amp; APACHE II score of all patients was then compared with their outcome and statistically evaluated as prognostic indicators of acute pancreatitis for the assessment of these scores.&#xD;
&#xD;
Results&#xD;
&#xD;
Sensitivity &amp; specificity of BISAP score was 75% &amp; 76.2% with positive &amp; negative predictive value being 37.5% &amp; 94.1% respectively. The overall accuracy of the BISAP score in the prediction of severe acute pancreatitis was 76% (Table 1). &#xD;
&#xD;
&#xD;
&#xD;
Sensitivity &amp; specificity of APACHE II score was 62.5% &amp; 85.7% with positive &amp; negative predictive value being 45.5% &amp; 92.3% respectively. The overall accuracy of the BISAP score in prediction of severe acute pancreatitis is 82% (Table 2).&#xD;
&#xD;
&#xD;
&#xD;
Screening efficacy of BISAP &amp; APACHE II scores in predicting severe acute pancreatitis cases was computed by Receivers operating characteristic curve (Table 3). Screening efficacy as measured by area under the curve was slightly more for APACHE II than BISAP (AUC &#x2013; 0.84 &amp; 0.79; p</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3459</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3459</Fulltext></URLs><References>&#xD;
	&#xD;
	Wang R, Wu H, Tang CW, Chen XZ. Etiology, clinical features and management of acute recurrent pancreatitis. J Dig Dis 2014;15(10):570-577.&#xD;
	&#xD;
	&#xD;
	Ranson J,Rifkind KM, Roses DF, Fink SD, Eng K, Spencer FC.Prognostic signs and the role of operative management in acute pancreatitis. Surg GynecolObstet 1974;139(1):69-81.&#xD;
	&#xD;
	&#xD;
	Knaus W, Draper EA, Wagner DP, Zimmerman JE.APACHE II: a severity of disease classification system. Crit Care Med 1985 Oct; 13(10):818-29.&#xD;
	&#xD;
	&#xD;
	Balthazar E, Robinson DL, Megibow AJ, Ranson JH. Acute pancreatitis: the value of CT in establishing prognosis. Radiology 1990 Feb; 174(2):331-6.&#xD;
	&#xD;
	&#xD;
	&#xA0;Bota S, Sporea I, Sirli R, Popescu A, Strain M, Focsa M, et al. Predictive factors for severe evolution in acute pancreatitis and a new score for predicting a severe outcome. Ann Gastroenterol 2013;26(2):156-162.&#xD;
	&#xD;
	&#xD;
	Khanna AK, Meher S, Prakash S, Tiwary SK, Singh U, Srivastava A, et al. Comparison of Ranson, Glasgow, MOSS, SIRS, BISAP, APACHE-II, CTSI Scores, IL-6, CRP, and procalcitonin in predicting severity, organ failure, pancreatic necrosis, and mortality in acute pancreatitis. HPB Surg 2013;2013:367581.&#xD;
	&#xD;
	&#xD;
	Wu B, Johannes RS, Sun X, Tabak Y, Conwell DL, Banks PA. The early prediction of mortality in acute pancreatitis: a large population-based study. Gut 2008;57(12):1698&#x2013;1703.&#xD;
	&#xD;
	&#xD;
	Fitz R. Acute pancreatitis: a consideration of pancreatic haemorrhage, hemorrhagic, suppurative, and gangrenous pancreatitis, and of disseminated fat-necrosis. Boston MedSurg J 1889;120(8):181-187.&#xD;
	&#xD;
	&#xD;
	Papachristou G, Papachristou DJ, Avula H, Slivka A, Whitcomb DC. Obesity increases the severity of acute pancreatitis: performance of APACHE-O score and correlation with the inflammatory response. Pancreatology 2006; 6:279-285.&#xD;
	&#xD;
	&#xD;
	Papachristou GI, Muddana V, Yadav D, O&amp;#39;Connell M, Sanders MK, Slivka A, et al. Comparison of BISAP, Ranson&amp;#39;s, APACHE-II, and CTSI scores in predicting organ failure, complications, and mortality in acute pancreatitis. Am J Gastroenterol 2010;105(2):435-441.&#xD;
	&#xD;
	&#xD;
	Cho JH, Kim TN, Chung HH, Kim KH. Comparison of scoring systems in predicting the severity of acute pancreatitis. World J Gastroenterol2015;21(8):2387.&#xD;
	&#xD;
	&#xD;
	Park J, Jeon TJ, Ha TH, Hwang JT, Sinn DH, Oh TH, et al. Bedside index for severity in acute pancreatitis: comparison with other scoring systems in predicting severity and organ failure. Hepatobiliary Pancreat Dis Int 2013;12(6):645-650.&#xD;
	&#xD;
	&#xD;
	Senapati D, Debata PK, Jenasamant SS, Nayak AK, Gowda M, Swain NN. A prospective study of the Bedside Index for Severity in Acute Pancreatitis (BISAP) score in acute pancreatitis: an Indian perspective. Pancreatology 2014;14(5):335-339.&#xD;
	&#xD;
	&#xD;
	Yadav J, Yadav SK, Kumar S, Baxla RG, Sinha DK, Bodra P. Predicting morbidity and mortality in acute pancreatitis in an Indian population: a comparative study of the BISAP score, Ranson&#x2019;s score and CT severity index. Gastroenterol Rep2015;4(3):216-220.&#xD;
	&#xD;
	&#xD;
	Cho JH, Kim TN, Chung HH, Kim KH. Comparison of scoring systems in predicting the severity of acute pancreatitis. World J Gastroenterol 2015; 21(8):2387-2394.&#xD;
	&#xD;
	&#xD;
	Zhang J, Shahbaz M, Fang R, Liang B, Gao C, Gao H, et al. Comparison of the BISAP scores for predicting the severity of acute pancreatitis in Chinese patients according to the latest Atlanta classification. J Hepatobiliary Pancreat Sci 2014;21(9):689-694.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Milk Spoilage Detection by Impedance Measurement&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>183</FirstPage><LastPage>187</LastPage><AuthorList><Author>Kannampilly NJ</Author><AuthorLanguage>English</AuthorLanguage><Author> Thangavel K</Author><AuthorLanguage>English</AuthorLanguage><Author> Peter D</Author><AuthorLanguage>English</AuthorLanguage><Author> Rose L</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: Monitoring milk quality is very crucial to maintain food safety and human health. The identification or detection of milk spoilage holds a prominent role in the improvement of milk preservation methods. Objective: The focus of this work lies on rapid, reliable and cost-effective method of milk spoilage detection for milk quality determination. Methods: Various physio-chemical properties of milk including fat, acidity, pH, ultrasonic velocity, thermal conductivity were performed to identify the major changes associated with spoilage parameter responsible for spoilage. This method emphasized milk spoilage detection using impedance measurement by using chip AD5933. These spoilage parameters were correlated with microbial spoilage of milk. Results: The pH and acidity value of fresh raw milk was 6.68 and 0.17% respectively. These two key parameters to evaluate milk freshness. There was significant difference in ultrasonic velocity from 1504.41 + 0.12m/sec to 1692.24 + 0.16m/sec at 72 hours. An impedance measurement apparatus was set up using chip AD5933 that shows a higher impedance reading when the microbial count was high. There is a prominent correlation between impedance and microbial growth. Therefore, electrical impedance could be considered as an indicator for the determination of milk quality. Conclusion: This study demonstrated a rapid, cost-effective measurement technique to determine spoilage of milk using an apparatus set up for Impedance measurement.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Milk spoilage, Rapid, Impedance measurement, Physio-chemical properties, Quality determination, Cost-effective</Keywords><Fulltext>&#xD;
INTRODUCTION&#xD;
&#xD;
Food freshness indicators or spoilage detectors should meet criteria such as specificity, analysis time and cost. The instrument specification may vary according to end-use such as checking the quality of raw material and their changes occurring during storage and transportation. Milk spoilage is an undefined term and challenging to determine with precision. This ambiguity causes difficulty in dairy industries. Most often the uncertainty in expiry dates on milk packets, deceive the customers and hence dispose of the unspoiled milk. These dates are mostly imprecise due to variations in storage conditions, shipment and processing factors of milk.1 Researcher has been focusing on the improvement of existing tools for milk spoilage detection. There are various milk spoilage detection techniques, which are accurate and efficiently such as gas-sensor arrays,&#xA0;Infrared/Near-Infrared&#xA0;(IR/NIR) Spectroscopy, Optical sensors, pH sensors, and amperometric sensor. However, the main drawback of these is its time consuming and expensive. Recently there has been a great demand and interest in novel developments in environment-friendly intelligent packaging.2 Therefore, a novel technique to measure milk quality is in a great need in the market today.&#xD;
&#xD;
Electrical parameters of milk change linearly concerning the mass of the substance. This change was observed due to the different amount of charge carried by it and is dependent on the period of storage.3 The opposition of a material to the flow of electric charges can be termed as the impedance of a material. It is chiefly the frequency domain ration of the voltage to current. The terms resistance and reactance are also associated with impedance. Every substance disperse and store energy. Resistance (R) and Reactance (Xc) are an indicator of energy dissipation and storage.4 Therefore, high-frequency resistance reduces than at low frequency. Here, the research focused on variation in electrical impedance as the milk spoils. The increase in impedance value was observed in spoiled milk than fresh milk. Thus, by studying the change in impedance of milk, it was possible to determine the spoilage of milk.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
The current investigation was performed for cow&#x2019;s milk. The fresh milk sample was obtained from a farm in Coimbatore, Tamil Nadu. The physiochemical properties of milk samples were taken at certain intervals namely 0, 6, 12, 18, 24, 30, 36, 48 and 72hours interval. Acidity, pH, fat, ultrasonic velocity, thermal conductivity and impedance value were the few measurements observed for fresh milk at a specified period.&#xD;
&#xD;
The methods adopted for determining the physio-chemical parameters of milk were pH meter for determination of pH, Gerber&#x2019;s method for fat determination, titratable acidity method for determination of acidity in milk, velocity meter for determination ultrasonic velocity and thermal conductivity measurement by thermal conductivity apparatus. The electrical impedance was measured by a prototype set up for Impedance apparatus. Microbial Analysis of milk was performed by spread plate method using standard plate count. The methodology and apparatus used for the determination of Physico-chemical properties of milk are: &#xD;
&#xD;
pH: The pH of fresh milk was measured at regular intervals using a pH meter. It comprises a measuring probe made up of a glass electrode. This electrode was attached to an automatic display meter that shows the pH of the substance measured.5&#xD;
&#xD;
Titratable Acidity: To measure the acidity, fresh milk of 10ml was taken in a conical flask. The milk sample was titrated with 0.1N NaOH using 2-3 drops of phenolphthalein as an indicator. The acidity of the sample was determined by the formula:&#xD;
&#xD;
V1=Volume of NaOH, N=Normality of NaOH, V2=Volume of the sample. 5&#xD;
&#xD;
Determination of fat content: The Gerber fat tests are done to check the butterfat percentage in milk. Lipid/Fat content is determined by the Gerber method, where 10ml sulfuric acid (specific gravity 1.823) at 15-21&#xB0;C was taken in Butyrometer. 1ml of amyl alcohol was added to it and inserted with a lock stopper. This was shaken until the milk was completely digested and finally placed in a centrifuge.&#xD;
&#xD;
Measurement of Thermal conductivity: The property of a substance to conduct heat can be termed thermal conductivity. The thermal conductivity of a material may depend on temperature. During milk processing, this property is very important to estimate the processing time required and to determine energy involved in thermal process.6, 7 Milk sample was measured for conductivity by thermal property analyzer (KD2 Pro model). This was fixed to a knob implanted in a beaker. The rate of heat transfer lowers with materials of less thermal conductivity.&#xD;
&#xD;
Measurement of Electrical Impedance: An impedance analyzer was set up to measure the electrical impedance of milk. In this setup, the Ag/AgCl electrodes were kept in contact with the milk sample. An impedance converter AD5933 was used to obtain high precision and accurate results. The AD5933 chip is generally used for assimilation of majority components essential for impedance analyzers such as signal generator and analogue-to-digital convertor. One major advantage of this chip is its lower power consumption. The impedance value of milk was taken at certain intervals concerning milk stored for a period. The fresh milk sample was placed between the electrodes and the electrodes are connected to the AD5933 signal generator and processing unit which in turn connected to the micro-controller. Figure 1 shows the block diagram representation of a system for Impedance measurement. The impedance reading was displayed on the LCD that is connected to the microcontroller. Both the values of impedance both real and imaginary values were noted.&#xD;
&#xD;
&#xD;
&#xD;
Measurement of Ultrasonic velocity:&#xA0; An ultrasonic velocity meter was used to determine the velocity of milk. An ultrasonic transducer, an electronic circuit and a display meter that measures flow rate are the main parts of this velocity meter apparatus. The transducer in the ultrasonic velocity meter works in the principle of converting electrical signals to ultrasonic energy.&#xA0; These ultrasonic signals are received are amplified and displayed in the digital meter, thus provides supply flow rate.&#xD;
&#xD;
Microbial analysis of Milk: The microbial analysis was carried out to determine the bacterial load present in the milk sample. Grams staining method was performed to distinguish whether the gram-positive or gram-negative bacteria were present in the milk sample. The peptone water needed for determination of standard plate count (SPC) was sterilized using autoclave at 121&#xB0;C for 15-20 minutes.&#xD;
&#xD;
&#xD;
	&#xD;
	Standard Plate Count (SPC): The total bacterial count was performed at various dilutions at a specific time interval and the total viable count was determined. To sterile plates, 9ml of sterile peptone water and 1ml of the milk sample was added. Serial dilution up to 10-6 was performed. Using the pour plate method, the 15-20ml sample was poured into Petri plates. Duplicates of the analysis were performed. All the Petri-plates were incubated for 48hours at 37&#xB0;C. The standard plate count (SPC) was calculated by taking the average of the plates and represented in cfu/mL. The microbial count (cfu/mL) was correlated to other Physico-chemical parameters of milk.8&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
	&#xD;
	Gram-Staining method: The characterization of the microorganism present in the milk was done by gram staining method as prescribed. The glass slide was dried using blotting paper and examined under the microscope.&#xD;
	&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
RESULTS AND DISCUSSION&#xD;
&#xD;
Fresh cow milk was used for the analysis of physio-chemical parameters such as pH, acidity fat, as presented in Table 1. The analysis was conducted at a time of 6, 12, 18, 24, 30, 36, 48 and 72hours interval. Table 2 presents the thermal conductivity, ultrasonic velocity and impedance values of milk.&#xD;
&#xD;
Physico-chemical properties of fresh milk&#xD;
&#xD;
pH and acidity: The acidity is generally articulated as pH. As milk is a complex buffer system, change in temperature is dependent on pH change. Variations in pH causes change in the structure of phenolic components present in pigments such as anthocyanin. Thus, pH parameter plays a vital role in many compounds. 9 It was observed that the pH of fresh milk was 6.73 +0.02 and the acidity level was 0.17%. From Table 1, it can be observed that there has been a drastic decrease in the pH once the milk is stored for a period at room temperature. After the first 6hours of milk storage, no much change in pH and acidity is visible. However, after a storage period of 18hours, a drastic decrease in pH to 5.57 +0.82 and increase in acidity to 1.2 +0.09 was observed. This was due to the spoilage started in milk due to the higher level of lactic acid produced by microbial metabolism.10, 11 As the milk is stored at room temperature, it is observed that the milk become sour and the acidity level increases to 2.5% at 72hours of storage of milk. This acidity level shows that the milk is spoiled and correspondingly the pH value of milk decreased to 3.54. The pH value can be considered as milk spoilage indicator. The pH change was due to the acidity developed in milk due to the increase in bacterial growth.8 The pH and acidity values were correlated with the microbial analysis of the milk.&#xD;
&#xD;
The fat content of milk: There was no prominent change observed in the fat content of milk. The fat content determined is presented in Table1. The fat content in fresh milk was determined as 3.6% and slight variation in value was seen after 24hours of storage period. The values were in concordant to [12], [13] and [14].&#xD;
&#xD;
Thermal conductivity: One of the significant property, which affects the pasteurization of milk, is thermal conductivity. The conductivity of milk also depends on its rheology, composition of milk and process temperature.15 Data on thermal conductivity helps in determining heating or refrigeration process and physical and chemical changes occurring in milk.16 The milk sample to be measured was poured into a beaker. The thermal property analyzer (KD2 Pro model) was kept in contact with the milk sample to be measured. Table 2 shows the values of thermal conductivity of milk. The thermal conductivity of fresh milk was found to be 0.530 +0.09 W/m K at ambient temperature and increased to 0.64 +0.35 W/m K once stored for 72hours. The values were found to be following [12]. This shows there was less effect on the thermal property of milk when the milk was subjected to spoilage. A prominent distinguishing variation could not be seen in thermal conductivity as the acidity of the milk increased. Therefore, thermal conductivity cannot be considered as an important spoilage parameter to indicate milk spoilage.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Electrical Impedance: To measure the electrical impedance of milk, an apparatus was set up using chip AD5933 circuit, as shown in Figure 1. This chip excites signals as it uses as a voltage-control oscillator. It consists of a direct digital synthesizer. The impedance measurement is performed by sensing the current flowing through it. This is converted to voltage and thereby to digital form using Analog-to-digital converter (ADC). The impedance of fresh milk was found to be 888.173 +0.02 &#x3A9;. There was a prominent difference in the impedance value (957.63 +0.43 &#x3A9;) of milk when the milk was stored for a period especially after 18hours. The impedance reading was corresponding to the microbial level of milk when the milk spoils. Thus, electrical impedance could be considered as an effective indicator for spoilage of milk. Similar findings were reported by [4] for the vitality detection of apple. Reference [3] also reported that the impedance measurement could distinguish statistically partially decayed apples and the fresh apple.&#xD;
&#xD;
&#xD;
&#xD;
Ultrasonic velocity: The ultrasonic velocity of fresh milk was found to be 1504.41 + 0.12 m/sec. This is dependent on the moisture content and the temperature of the milk. There was a drastic change in ultrasonic velocity (1600.54 + 0.38m/sec) observed after 18hous of storage of milk at ambient condition. This proves that the ultrasonic velocity could be used as a parameter to check the quality of milk. The results proved that as the milk spoils, the ultrasonic velocity also increases.17 This change in velocity can be a correlation to milk spoilage characteristics.&#xA0; The feasibility of using ultrasonic techniques to evaluate the quality parameters for milk was investigated.&#xD;
&#xD;
Microbial Analysis of Fresh Milk: The microbial analysis was performed for the determination and characterization of microorganism present in the milk by serial dilution and grams staining techniques respectively. The microbial count of milk at 0, 12, 24, 48hours were found to be 5x101, 20 x10&#xB9;, 3.2x104 and 10 x104cfu /mL respectively. After 48hours of analysis, the microbial growth was rapid and could not determine the bacterial count. It can be understood that as the milk storage time increases, the microbial count also increases. The average count of fresh raw milk was negligible compared to 10x104cfu/mL after 48hours of storage. A similar study showed a signi?cant increase in the microbial count and a relatively distinct decrease in pH during the storage at 21&#xB0;C and 37&#xB0;C&#xA0; for 8 to 30 hours, which is caused by the growth of bacterial cells. 18&#xD;
&#xD;
Gram-staining technique was performed to characterize microorganism present in the fresh raw milk. A rod-shaped purple coloured, the non-sporulating organism was identified. Lacto bacillus spp. was found to have similar characteristic properties. &#xD;
&#xD;
&#xA0;CONCLUSION&#xD;
&#xD;
Milk is exceptionally nutritious and is considered a balanced diet by the majority of people. The Physico-chemical properties of fresh cow&#x2019;s milk were analyzed for a specific time interval to identify the milk spoilage parameter. The pH and acidity value of fresh raw milk was found to be 6.68 and 0.17% respectively. These two parameters can be considered as the key parameters to evaluate milk freshness. There was significant difference in ultrasonic velocity from 1504.41 +0.12m/sec to 1692.24 +0.16m/sec at 72 hours. Electrical impedance was taken as an indicator for the determination of milk quality. An impedance analyzer apparatus was set up using chip AD5933. The impedance value of milk was measured and a drastic difference was seen which correlated to milk spoilage. Thus, the device for impedance measurement was found to be an effective tool for determining the milk spoilage. This system measures impedance by Ag/AgCl electrodes with high accuracy, less power consumption and is a microcontroller-based device. Thus, a cost-effective reliable solution for impedance measurement is performed by AD5933 chip. The impedance value of milk was found to increase with milk spoilage, thereby proving that as the impedance value increase, the milk quality decreases and leads to spoilage. Further studies can be focused on improving the stability of voltage using two AD5933 chip, as the electrical impedance of milk showed few fluctuations in the reading.&#xD;
&#xD;
&#xD;
ACKNOWLEDGEMENT &#xD;
&#xD;
Authors would like to express their gratitude towards the Department of Food Processing and Engineering and Department of Electronics and Instrumentation, Karunya Institute of Technology and Sciences for their constant support for the successful completion of the study and the facilities provided. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed. Authors also grateful to IJCRR editorial team and reviewers to bring the quality of this manuscript.&#xD;
&#xD;
Conflict of Interest: Nil&#xD;
&#xD;
Source of Funding: Nil&#xD;
&#xD;
Contribution of Authors: &#xD;
&#xD;
1. Nikki John Kannampilly : Conceptualisation, Data collection, Data analysis, Writing &#xD;
&#xD;
2. K. Thangavel : Conceptualisation, Data analysis, Writing&#xD;
&#xD;
3. Dayanand Peter : Conceptualisation, Writing&#xD;
&#xD;
4. Lina Rose: Data collection, Data analysis&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3460</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3460</Fulltext></URLs><References>&#xD;
	&#xD;
	Kim J, Twede D, Lichty J. Consumer attitudes about open dating techniques for packaged foods and over-the-counter drugs. J Food Produ Marke 1997;4(1):17-30.&#xD;
	&#xD;
	&#xD;
	Restuccia D, Spizzirri UG, Parisi OI, Cirillo G, Curcio M, Iemma F, et al. New EU regulation aspects and global market of active and intelligent packaging for food industry applications. Food Control 2010;21(11):1425-1435.&#xD;
	&#xD;
	&#xD;
	Euring F, Russ W, Wilke W. Development of an impedance measurement system for the detection of decay of apples. Procedia Food Sci 2011;1:1188-1194.&#xD;
	&#xD;
	&#xD;
	Rose EJ, Pamela D, Rajasekaran K. Apple vitality detection by impedance measurement. Int J Adv Res Comp Sci Soft Engg 2013;9:144-148.&#xD;
	&#xD;
	&#xD;
	AOAC (Association of Official Analytical Chemists), Official Methods of Analysis International, 17th Ed.&#xA0; AOAC, Washington, DC. 2000&#xD;
	&#xD;
	&#xD;
	Carson JK. Review of effective thermal conductivity models for foods. Int J Refrig 2006;29(6):958-967.&#xD;
	&#xD;
	&#xD;
	Muramatsu Y, Tagawa A, Kasai T. Thermal conductivity of several liquid foods. Food Sci Technol Res 2005;11(3):288-294.&#xD;
	&#xD;
	&#xD;
	Robertson AH, Black LA, Breed RS, Brito AG, Cowley RF, Gibbard J. Standard methods for the examination of dairy products. Am J Public Health Nations Health 1949;39(5 Pt 2):80&#x2013;82.&#xD;
	&#xD;
	&#xD;
	Kannampilly NJ, Devadas CT. Kinetic Modelling of Anthocyanin Extraction from Grape (Vitis vinifera) using Response Surface Methodology. Int J Innov Technol Explor Engg 2019;8(11),3015-3019. &#xD;
	&#xD;
	&#xD;
	Pereira Jr VA, de Arruda IN, Stefani R. Active chitosan/PVA films with anthocyanins from Brassica oleraceae (Red Cabbage) as Time&#x2013;Temperature Indicators for application in intelligent food packaging. Food Hydrocolloids 2015;43:180-188.&#xD;
	&#xD;
	&#xD;
	Liang T, Wang L. A pH-sensing film from tamarind seed polysaccharide with litmus lichen extract as an indicator. Polymers 2018;10(1):13.&#xD;
	&#xD;
	&#xD;
	Prasad N, Shukla.S. and Ramteke, P.W. Physico-chemical Properties of Milk and Dairy Products Collected from Allahabad City, India. Int J Curr Microbiol App Sci 2018;7(07):1662-1666.&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0;&#xA0; &#xD;
	&#xD;
	&#xD;
	Sodhi SS, Mehra ML, Jain AK, Trehan PK. Effect of non-genetic factors on the composition of milk of Murrah buffaloes. Indian Vet J 2008;85(9):46-48.&#xD;
	&#xD;
	&#xD;
	Dubey PC, Suman CL, Sanyal MK, Pandey HS, Saxena MM, Yadav PL. Factors affecting composition of milk of buffaloes. Indian J Animal Sci 1997;67(9).&#xD;
	&#xD;
	&#xD;
	Pradeep S, Lakshminarayana P, Varsha R, Kota SK. Screening of adulterants in milk. Int J Cur Res Rev 2016;8(12):25-29.&#xD;
	&#xD;
	&#xD;
	Sweat VE. Thermal properties of foods. Engg Propert Foods 1986;49.&#xD;
	&#xD;
	&#xD;
	Ali MH, Ahmad A. Ultrasonic Velocity and Allied Parameters of Milk Powder Reconstituted with Water. Int J Innov Res Sci Engg Technol 2017; 6(5). &#xD;
	&#xD;
	&#xD;
	Al-Qadiri HM, Lin M, Al-Holy MA, Cavinato AG, Rasco BA. Monitoring quality loss of pasteurized skim milk using visible and short wavelength near-infrared spectroscopy and multivariate analysis. J Dairy Sci 2008;91(3):95.&#xD;
	&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>Morphologic Pattern of Upper Gastrointestinal Tract Lesions - Endoscopic Biopsy Analysis&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>188</FirstPage><LastPage>190</LastPage><AuthorList><Author>Rajesh Kothari</Author><AuthorLanguage>English</AuthorLanguage><Author> Sanjay Agrawal</Author><AuthorLanguage>English</AuthorLanguage><Author> Vineeta Kothari</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: A diagnostic technique that visualizes the upper portion of the gastrointestinal tract up to the duodenum is the upper gastrointestinal endoscopy. It is a proven model of investigation and plays a crucial role in the precise detection and treatment of a wide variety of upper gastro-intestinal conditions in conjunction with biopsy. Objectives: To study the Morphological pattern of lesions of the upper gastrointestinal tract from the endoscopic biopsies. Methods: The present research was performed with endoscopic biopsies of the upper gastrointestinal tract over two years in the pathology department of a tertiary care hospital. Results: In 828 patients, biopsy materials were collected from various levels of the upper gastrointestinal tract. This included 288 biopsies from the oesophagus (35%), 84 from the gastric junction of the oesophagus (10%), 444 from the stomach (54%) and 12 from the small intestine (2%). There were 280 (34%) cases that were non-neoplastic, while 548 (66%) were neoplastic. Histopathology revealed gastritis of varying grades (27%) as the inflammatory lesion most frequently diagnosed, while the most frequently diagnosed malignant lesion was squamous cell carcinoma (37 %). Conclusion: A strong correlation between endoscopic and histological diagnosis was shown in this research. It further indicates that the predominant site of upper gastro-intestinal malignancy is the oesophagus.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords> Upper gastro-intestinal malignancy, Biopsy, Endoscopy, Histopathology</Keywords><Fulltext>INTRODUCTION&#xD;
&#xD;
The oesophagus, stomach and duodenum from the upper gastrointestinal tract. Symptoms of trouble swallowing, stomach discomfort, vomiting and hematemesis are usually present in patients with upper gastrointestinal system diseases.1,2 One of the most common sites for neoplasms, particularly malignant tumours, is the upper gastrointestinal tract. A diagnostic technique that visualizes the upper portion of the gastrointestinal tract up to the duodenum is the upper gastrointestinal endoscopy.3 It is a proven method of researching and treating a wide variety of upper gastrointestinal conditions. As the main form of diagnosing upper gastrointestinal disease, it has replaced upper gastro-intestinal radiography.4,5 First used in 1968, the upper gastro-intestinal flexible fibre-optic endoscope proved to be a significant advance in gastro-intestinal tract lesion diagnosis. A convenient technique and current gold standard for reliable objective evaluation of patients with upper gastrointestinal tract symptoms is endoscopic biopsy accompanied by histopathological review.6 It is used not only to diagnose malignant &amp; inflammatory lesions, but also to track the path, nature of the disease, therapy response, and early complication detection. This is reflected by a growing trend in the upper gastrointestinal tract to receive mucosal biopsies.7,8 Endoscopic screening can detect gastric mucosal lesions at an early stage particularly atrophy, intestinal metaplasia and dysplasia to prevent the progress of lesions to invasive cancer.9,10 Oesophageal &amp; gastric cancers are the most prevalent cancers found in men, according to the National Cancer Registry, while oesophageal cancer ranks third among women after breast and cervix carcinoma.11&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
&#xD;
The present research was performed for two years in the Department of Pathology. We obtained a total of 828 biopsy materials from different levels of the upper gastrointestinal tract during this two year study period. A flexible fibre-optic upper gastrointestinal endoscope was used to obtain the biopsy materials. Endoscopic tests and biopsies were carried out in patients of both sexes over 12 years of age with upper gastrointestinal symptoms. All patients involved in this study received informed consent. Using standardized proforma, relevant history and clinical information were documented. Both biopsy samples were counted for tissue fragments and immediately placed in 10% neutral formalin, accompanied by traditional processing &amp; embedding of tissue. There were five micron thick parts cut &amp; slides prepared. Each segment was stained and studied with Haematoxylin and Eosin stain. To observe H.Pylori, additional segments were stained with Giemsa. Wherever possible, Alcian blue stain to observe intestinal metaplasia and Periodic Acid Schiff (PAS) stain were performed. According to the WHO classification of the gastrointestinal tumour and tumour like symptoms, lesions were diagnosed.&#xD;
&#xD;
RESULTS&#xD;
&#xD;
Of the 828 cases ( Table 1), 540 (65 %) were men and 288 (35 %) were women with a 1.9:1 ratio of male to female. The age group of patients ranged from 15 years to 85 years in the current study and the highest number of cases were identified in the 40-60 year age group, representing a total of 40 % of the study population, followed by 60-80 years (34 %), 20-40 years (19 %) and the lowest incidences (4 %) in 10-20 years. Of the 828 endoscopic biopsies, 444 were gastric biopsies (54 %), 288 were oesophageal biopsies (35 %), 84 were oesophagus-gastric junction biopsies (10 %) and about 12 were duodenal biopsies (1 % ). There were 280 (34%) cases that were non-neoplastic, while 548 (66%) were neoplastic. 272 (50 %) of the 548 neoplastic cases were from the oesophagus, 192 (35 %) were from the stomach, and 84 (15 %) were from the oesophagus-gastric junction. Gastritis was found to be the most frequently diagnosed inflammatory lesion by histopathology (27 %), while squamous cell carcinoma (37 %) was the most frequently diagnosed malignant lesion. 272 cases of the 288 oesophageal lesions were malignant. Squamous cell carcinoma has been noted in 272 oesophagus biopsies and 34 oesophagus-gastric junction biopsies. Of these cases, 33% were well-differentiated squamous cell carcinoma, 63% were moderately differentiated squamous cell carcinoma, and 5% were poorly differentiated squamous cell carcinoma. In the stomach, two cases showed hyperplastic polyp, two cases of foreign body granuloma, &amp; 220 specimens with varying grades of gastritis were noted. Adenocarcinoma has been noted in 190 stomach biopsies and 50 oesophagogastric junction biopsies. Nonspecific duodenitis was demonstrated in 2 cases by endoscopic biopsies involving the upper two sections of the duodenum, villous atrophy in 2 cases and duodenal ulcer in 6 cases.&#xD;
&#xD;
&#xD;
&#xD;
DISCUSSION&#xD;
&#xD;
The typical site is the stomach, preceded by the oesophagus, for upper gastrointestinal endoscopic biopsy. The most frequent presenting symptom was dysphagia among patients with oesophageal malignancy. The most prominent signs of gastric malignancy have been dyspepsia and weight loss.12Oesophageal and gastric cancers are the most common cancers found in men, according to the National Cancer Registry, while oesophageal cancer is ranked 3rd among women after breast &amp; cervix carcinoma. Most of the patients identified were male (66 %) and 40 % were in the 4th to 6th decade of life. A similar finding was also observed by Shennak et al5 which they attributed to the greater degree of exposure of male subjects to different risk factors and greater attendance of male patients to the outpatient department of the hospital as compared to the female patients. Between the 40-60 age groups, a predominance of upper gastrointestinal tract diseases was observed, which showed a similar pattern to other studies published. The majority of oesophageal lesions have been described as malignant.13 These findings are comparable to research performed by Memon F et al.8 The bulk (54 %) of the cases involved gastric biopsies. Of the 444 cases, in line with other research, 180 cases of gastric malignancies were histopathologically diagnosed as gastric adenocarcinoma. While there is a comparatively lower incidence of gastric carcinoma in India than in other countries, there has been a high incidence in Southern India. As with other research, Antrum was the most common location for gastric carcinoma, followed by the body of the stomach. Chronic gastritis was the most common lesion among the non-neoplastic lesions (14 %), which is comparable to the study conducted by Khandige.14 Just 12 patients were diagnosed with a histopathological endoscopic biopsy involving the first two sections of the duodenum. Of these, six patients were diagnosed with duodenal ulcer, two with celiac disease, followed by two with non-specific duodenitis.14-17&#xD;
&#xD;
CONCLUSION&#xD;
&#xD;
Useful information is provided by biopsy sampling of the upper gastrointestinal mucosa during diagnostic endoscopy. In the present research, several non-neoplastic and neoplastic lesions have been identified across a wide spectrum of age &amp; size distribution. The most common location for upper endoscopic biopsy in our sample was from the stomach, and it further indicates that the primary site of upper gastrointestinal malignancy is the oesophagus and the common histological form is squamous cell carcinoma. Owing to limited biopsy specimens, handling and processing items, weaknesses in diagnostic interpretation are sometimes encountered. However, to establish a definitive diagnosis, several bits of endoscopic biopsies from irregular looking mucosa are recommended. In addition to detecting upper gastrointestinal mucosal lesions at an early stage, endoscopic biopsies can detect changing trends in the spectrum of lesions, in particular atrophy, intestinal metaplasia and dysplasia, to avoid the progression of these lesions to invasive cancer. We, therefore, conclude that without biopsy, endoscopy is incomplete and hence the combination of both the techniques offers a strong diagnostic method for improved treatment of patients.&#xD;
&#xD;
Acknowledgement&#xD;
&#xD;
The author acknowledges the immense help received from the scholars whose articles are cited and included in references to this manuscript. The author is also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed. &#xD;
&#xD;
Conflict of Interest: Nil&#xD;
&#xD;
Source of Funding: Nil&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=3461</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=3461</Fulltext></URLs><References>1. Black M. Endoscopic interpretation normal and pathologic appearance of the gastrointestinal tract. Raven Press New York 1984;1:13-15.&#xD;
&#xD;
2. Karish R. A study on histopathologic spectrum of upper gastrointestinal tract endoscopic biopsies. Int J MedRes Health Sci2013;2(3):418-424.&#xD;
&#xD;
3. Suvakovic Z. Improving the detection rate of early gastric cancer requires more than open access gastroscopy: a five-year study. Gut 1997;41(3):308-313.&#xD;
&#xD;
4. National Cancer Registry Programme. First All India Report 2001-2002. Vol 1. Indian Council of Medical Research. Bangalore, India. 2004.&#xD;
&#xD;
5. Shennak M. Upper gastrointestinal diseases in symptomatic Jordanians: A prospective study. Ann Saudi Med 1997;17(4):471-474.&#xD;
&#xD;
6. Paymaster J. Cancer of the gastrointestinal tract in western India. Cancer 1968;21:279-287.&#xD;
&#xD;
7. Khar H. Endoscopic and histopathological evaluation of 306 dyspeptic patients. Pak j Gastroenterol 2003;17:4-7.&#xD;
&#xD;
8. Memon F. Upper gastro-intestinal endoscopic biopsy; the morphological spectrum of lesions. ProfesMed J 2015;22(12):1574-1579. &#xD;
&#xD;
9. Fuchs C. Gastric Carcinoma. New EnglJ Med 1995;333(1):32-36.&#xD;
&#xD;
10. Kelley J. Gastric cancer: Epidemiology and risk factors. J ClinEpidemiol2003;56:1-9.&#xD;
&#xD;
11. Dicken B. Gastric Adenocarcinoma &#x2013; Review and considerations for future directions. AnnlSurg2005;241(1):27-39.&#xD;
&#xD;
12. Gajalakshmi V. An independent survey to assess the completeness of Registration: Population-based cancer registry, Chennai, India. Asian PacJ Cancer Prev2001;2:179-183.&#xD;
&#xD;
13. Marson B. Gastrointestinal pathology. 2nd edn, Black Well Scientific Publications, London, 1998:l48-151.&#xD;
&#xD;
14.Khandige S. The Conceding of Upper Gastro-intestinal Lesion Endoscopic Biopsy: A Bare Minimum for Diagnosis. IntJ SciRes 2015;4(2):264-266.&#xD;
&#xD;
15. Fenoglio-Preiser C. Gastric carcinoma. In: WHO Classification of Tumours - Pathology and Genetics of Tumours of the Digestive System. Hamilton SR and Aaltonen LA (Eds), IARC Press: Lyon, France, 2000: 38-52.&#xD;
&#xD;
16. Cherian J. Carcinoma of the oesophagus in Tamil Nadu (South India): 16-year trends from a tertiary centre. J GastrointesLiver Dis2007;16(3):245-249.&#xD;
&#xD;
17. Abilash SC. Gastric carcinoma and Diagnosis. Sch J Appl Med Sci 2016;4(5E):1807-1813.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>&#xD;
	Riga-Fede Disease and Natal Tooth Extraction: A Case Report&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>191</FirstPage><LastPage>193</LastPage><AuthorList><Author>Rachna Anand</Author><AuthorLanguage>English</AuthorLanguage><Author> Amil Joshi</Author><AuthorLanguage>English</AuthorLanguage><Author> Mansi Baviskar</Author><AuthorLanguage>English</AuthorLanguage><Author> Shagorika Choudhury</Author><AuthorLanguage>English</AuthorLanguage><Author> Kajol Thakur</Author><AuthorLanguage>English</AuthorLanguage><Author> Ishani Ratnaparkhi</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>&#xD;
	Introduction: Occurrence of natal teeth are extremely rare and the commonly seen teeth are lower primary incisors, which generally occurs in pairs. The natal tooth seen is early eruption of deciduous incisors. The prevalence of natal and neonatal teeth reported ranges from 1:2,000 to 1:3,500. Case Report: A 32-day-old male infant was referred to the OPD of DY Patil Dental College and Hospital with a complaint of one tooth in the lower jaw at birth. Clinical evaluation showed presence of one tooth in the mandibular anterior region with Grade I mobility. Moons probe was used to relieve the gingival margin. Primary anterior mandibular forceps was used to extract the tooth. Patient was evaluated after one week, healing was uneventful. No difficulty in breast feeding was reported by the mother. No history of fever was reported by the mother one week after the day of extraction. Complete resolution of Riga-Fede on the ventral aspect of the tongue observed one week after the day of extraction. Conclusion: Follow-up is essential for treatment of natal teeth along with parent counselling to bring about awareness eliminating misconceptions surrounding natal teeth.&#xD;
&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Natal teeth, Yellowish-brown discolouration, Deciduous incisors, Neonatal teeth, Misbeliefs and superstitions, Mandibular &#xD;
anterior region</Keywords><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=4662</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=4662</Fulltext></URLs><References>&#xD;
	1. Goncalves FA, Birmani EG, Sugaya NN, Melo AM. Natal teeth: Review of literature and report of an unusual case. Braz Dent J. 1998;9(1):53&#x2013;6. &#xD;
&#xD;
&#xD;
&#xD;
	2. Samuel SS, Ross BJ, Rebekah G, Koshy S. Natal and Neonatal Teeth: A Tertiary Care Experience. Contemp Clin Dent. 2018 Apr-Jun;9(2):218-222. doi: 10.4103/ccd.ccd_814_17. PMID: 29875564; PMCID: PMC5968686.&#xD;
&#xD;
&#xD;
&#xD;
	3. Rao RS, Mathad SV. Natal teeth: Case report and review of literature. J Oral Maxillofac Pathol. 2009 Jan;13(1):41-6. doi: 10.4103/0973-029X.44574. PMID: 21886998; PMCID: PMC3162856. &#xD;
&#xD;
&#xD;
&#xD;
	4. Massler M, Savara BS. Natal and neonatal teeth. A review of 24 cases reported in the literature. J Pediatr 1950;36(3):349&#x2013;59 &#xD;
&#xD;
&#xD;
&#xD;
	5. Anegundi RT, Sudha P, Kaveri H, Sadanand K. Natal and neonatal teeth: A report of four cases. J Indian Soc Pedo Prev Dent. 2002; 20:86&#x2013;92&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>&#xD;
	Full Mouth Rehabilitation of a 2-year-old Child Under General Anesthesia: A Case Report&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>194</FirstPage><LastPage>196</LastPage><AuthorList><Author>Shilpa Shetty Naik</Author><AuthorLanguage>English</AuthorLanguage><Author> Amil Joshi</Author><AuthorLanguage>English</AuthorLanguage><Author> Sanjana Kodical</Author><AuthorLanguage>English</AuthorLanguage><Author> Shivani Mehta</Author><AuthorLanguage>English</AuthorLanguage><Author> Parnaja Valke</Author><AuthorLanguage>English</AuthorLanguage><Author> Akshaya Mudaliar</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>&#xD;
	Introduction: Rampant caries is the most common chronic childhood disease leading to decreased oral function, undesirable esthetics and consequent malocclusion and psychological problems. Oral rehabilitation under general anesthesia under certain circumstances is the only choice for the comprehensive treatment of extremely young, emotionally immature patients unable to cope with the same on a dental chair. Case Report: This case report describes the challenging task of the full mouth rehabilitation of a 2-year-old patient with rampant caries having severely mutilated maxillary teeth under general anesthesia. Conclusion: Treatment under general anesthesia provides the advantage of providing thorough oral rehabilitation in a limited period of time, allowing immediate pain relief, even with little or no patient cooperation.&#xD;
&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords></Keywords><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=4663</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=4663</Fulltext></URLs><References>&#xD;
	1. Winter GB, Hamilton MC, James PMC. Role of the comforter as an etiological factor in rampant caries of the deciduous dentition. Arch Dis Child. 1966; 41(216):207&#x2013;21. &#xD;
&#xD;
&#xD;
&#xD;
	2. Enger DJ, Mourino AP. A survey of 200 paediatric dental general anesthesia cases. ASDC J Dent Child 1985;52(1):36-41. &#xD;
&#xD;
&#xD;
&#xD;
	3. Johnsen DC. Characteristics and background of children with &#x201C;nursing caries&#x201D;. Pediatr Dent 1982; 4(3):218-24 &#xD;
&#xD;
&#xD;
&#xD;
	4. Harrison MG, Roberts GJ. Comprehensive dental treatment of healthy and chronically sick children under intubation general anaesthesia during a 5-year period. Br Dent J 1998; 184(10):503- 6. &#xD;
&#xD;
&#xD;
&#xD;
	5. El-Bialy WB, Al-Rashid BA, El-Tanani H. Extraction of teeth under general anaesthesia for outpatient children and mentally retarded patients in Kuwait. Egypt Dent J 1992; 4:257-62. &#xD;
&#xD;
&#xD;
&#xD;
	6. Ripa LW. Nursing Caries: A comprehensive review. Pediatr Dent 1988; 10(4):268-82. &#xD;
&#xD;
&#xD;
&#xD;
	7. Agarwal P, Nayak R, Elangovan G. A predictable aesthetic rehabilitation of deciduous anterior teeth in early childhood caries. Case Reports in Dentistry. 2018; 2018: 1742529. &#xD;
&#xD;
&#xD;
&#xD;
	8. Sholapurmath SM, Anand S. Use of polyethylene fiber in pediatric esthetics clinical reports of two cases. Journal of International Oral Health. 2010;2(2) &#xD;
&#xD;
&#xD;
&#xD;
	9. Babaji P. Crowns in pediatric dentistry. New Delhi: Jaypee Brothers Medical Publishers; 2015. &#xD;
&#xD;
&#xD;
&#xD;
	10. Ram D, Fuks AB. Clinical performance of resin-bonded composite strip crowns in primary incisors: a retrospective study. International Journal of Paediatric Dentistry. 2006;16(1):49-54. 11. Paolone G. Direct composites in anteriors: a matter of substrate. Int J Esthet Dent 2017;12(4):468-48&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>&#xD;
	Comparative Evaluation of Surgical Treatment of Post-traumatic Ankylosis of Temporomandibular Joint Using Conventional Rotary Bur technique and Piezosurgery Unit&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>197</FirstPage><LastPage>201</LastPage><AuthorList><Author>Veenita Singh</Author><AuthorLanguage>English</AuthorLanguage><Author> Swapna Nayan</Author><AuthorLanguage>English</AuthorLanguage><Author> Ekta Keswani</Author><AuthorLanguage>English</AuthorLanguage><Author> Gokul Venkateshwar</Author><AuthorLanguage>English</AuthorLanguage><Author> Komal Navlakha</Author><AuthorLanguage>English</AuthorLanguage><Author> Shambhavi Singh</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>&#xD;
	Introduction: The temporomandibular joint (TMJ) is the most active joint of the body. Limitations of the mouth opening can be caused by bony or fibrous ankylosis of the TMJ as a sequela to trauma, infection, autoimmune disease or failed surgery. A significant effect of TMJ ankylosis is obstructive sleep apnea (OSA) which can progressively worsen and the symptoms associated with OSA can dominate sidelining the primary disorder itself. Aim/Objectives: The purpose of this study was to investigate and compare the use of conventional rotary bur technique and piezosurgery unit for gap arthroplasty in TMJ ankylosis. Method Used: Twenty patients were examined clinically and radiologically for the treatment. Out of the twenty patients, ten patients were operated using conventional rotary bur technique (Group A) and the remaining ten patients were operated using piezosurgery unit (Group B). Two major parameters that is blood loss and duration of surgery were evaluated intraoperatively and other parameters like pain, mouth opening, swelling and paraesthesia were evaluated on Post Operative Day (POD)-1, 5, 10, 15. Result: We observed that there was a significant reduction in blood loss intraoperatively with the piezosurgery unit though the operating time was prolonged. Post-operative physiotherapy had increased the inter-incisal distance in both groups. Pain levels and swelling were significantly higher in Group A. Other complications like paresthesia were not observed in either of the groups. Conclusion: This comparative study suggests piezosurgery can be a valuable alternative method to the bur technique due to its efficacy in the evaluated parameters.&#xD;
&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Gap arthroplasty, Piezosurgery, Temporomandibular joint ankylosis, Rotary bur technique</Keywords><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=4664</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=4664</Fulltext></URLs><References>&#xD;
	1. Guarda-Nardini L, Manfredini D, Ferronato G. Temporomandibular joint replacement prosthesis: current knowledge and considerations for the future. Int J Oral Maxillofac Surg. 2008; 37(2):103-110. &#xD;
&#xD;
&#xD;
&#xD;
	2. Given O. A clinical study of temporomandibular joint ankylosis. Auris Nasus Larynx. 2000;27(1):27-33.&#xD;
&#xD;
&#xD;
&#xD;
	3. Zhi K, Ren W, Zhou H, Gao L, Zhao L, Hou C, Zhang Y. Management of temporomandibular joint ankylosis: 11 years&#x2019; clinical experience. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2009; 108(5):687-692. &#xD;
&#xD;
&#xD;
&#xD;
	4. Guven O. A clinical study on temporomandibular joint ankylosis in children. J Craniofac Surg. 2008; 19(5):1263-1269. &#xD;
&#xD;
&#xD;
&#xD;
	5. Sporniak-Tutak K, Janiszewska J, Kowalczyk R. Management of temporomandibular ankylosis compromise or individualisation - a literature review. Med Sci Monit. 2011;17:RA111-116. &#xD;
&#xD;
&#xD;
&#xD;
	6. Miyamoto H, Kurita K, Ogi N, Ishimaru JI, Goss AN. The role of the disk in sheep temporomandibular joint ankylosis. Oral surg Oral Med Oral Pathol Oral Radiol Endod. 1999; 88(2):151-158.&#xD;
&#xD;
&#xD;
&#xD;
	7. Gundlach KK. Ankylosis of the temporomandibular joint. J Craniomaxillofac Surg.2010; 38:122-310. &#xD;
&#xD;
&#xD;
&#xD;
	8. Kerawal CJ, Martin IC, Allan W, Williams ED. The effect of operator technique and bur design on temperature during osseous preparation for osteosynthesis self-tapping screws. Oral surg Oral Med Oral Pathol Oral Radiol Endod. 1999;88(2);145-50 &#xD;
&#xD;
&#xD;
&#xD;
	9. Campbell JH, Murray RA. Handpiece speed and postoperative outcomes in third molar surgery. J Indiana Dent Assoc.2004;83(1);4-6. &#xD;
&#xD;
&#xD;
&#xD;
	10. Praveen G, Rajesh P, Neelakandan RS, Nandagopal CM, Comparison of morbidity following the removal of mandibular third molar by lingual split, surgical bur and simplified split bone technique. Indian J Dent Res. 2007;19(18);15-8 &#xD;
&#xD;
&#xD;
&#xD;
	11. Torella F, Pitarch J, Cabanes G, Anitua E. Ultrasonic ostectomy for the surgical approach of the maxillary sinus: A technical note. Int J Oral Maxillofac Implants. 1998;13(5);697-700. &#xD;
&#xD;
&#xD;
&#xD;
	12. Chidzonga MM. Temporomandibular joint ankylosis: review of thirty-two cases. Br J Oral Maxillofac Surg. 1999;37(2):123- 126. &#xD;
&#xD;
&#xD;
&#xD;
	13. Kaban LB, Perrott DH, Fisher K. A protocol for management of temporomandibular joint ankylosis. J Oral Maxillofac Surg. 1990;48(11): 1145-51. &#xD;
&#xD;
&#xD;
&#xD;
	14. Erdeem E, Alkan A. The use of acrylic marbles for interposition arthroplasty in the treatment of temporomandibular joint ankylosis: follow-up of 47 cases. Int J Oral Maxillofac Surg. 201;30(1):32-36. &#xD;
&#xD;
&#xD;
&#xD;
	15. Roychoudhury A, Parkash H, Trikha A. Functional restoration by gap arthroplasty in temporomandibular joint ankylosis: a report of 50 cases. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 1999;87(2):166-169. &#xD;
&#xD;
&#xD;
&#xD;
	16. Giuseppe S, Domenico V, Giuditta M, Mirco R, Francesco A. Surgical management of ankyloses of the temporomandibular joint by a piezoelectric device. Journal of Cranio-Maxillo-Facial Surgery. 2017; 45(4):441-448. DOI: 10.1016/j.jcms.2016.12.004&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>13</Volume><Issue>5</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2021</Year><Month>March</Month><Day>3</Day></PubDate></Journal><ArticleType/><ArticleTitle>&#xD;
	Ayurvedic Insights into Diabetes Etiology: Exploring&#xA0;Overlooked Perspectives&#xD;
&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>202</FirstPage><LastPage>206</LastPage><AuthorList><Author>Shrikant Pandey</Author><AuthorLanguage>English</AuthorLanguage><Author> B.K. Dwibedy</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>&#xD;
	The article explores the contemporary lifestyle shifts and dietary trends contributing to Prameha (diabetes) as described in Ayurveda, particularly focusing on overlooked factors and their relevance to modern understanding. It is also discussed here. The Article discuss the impacts of Avyayama (lack of physical exercise) and Mrjavarjan (lack of oil/scrub massage), emphasizing their effects on muscle tone and immune function. Additionally, it delves into the significance of dietary qualities such as Amla (sour) and Lavana (salty) tastes in disrupting bodily balance and immunity. The role of lifestyle habits, including Divaswapna (daytime sleep), is examined in aggravating doshic imbalances contributing to diabetes onset. The article also highlights Ayurvedic insights on dietary and lifestyle factors, including the consumption of Gramya, audaka, and anupa mansas (meats) and Nav madya (newly fermented beverages), and their correlation with diabetes development. Furthermore, the article draws parallels between Ayurvedic perspectives and modern scientific understanding, proposing potential synergies for comprehensive diabetes management. This article underscores the importance of integrating Ayurvedic wisdom with modern science to enrich our understanding of diabetes etiology and improve prevention and management strategies&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
	&#xA0;&#xD;
&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords/><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=4902</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=4902</Fulltext></URLs><References></References></Article></ArticleSet></xml>
