<?xml version="1.0"?>
<xml><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>A STUDY ON CO RELATION BETWEEN STRAIGHT LEG ANGLE AND FUNCTIONAL DISABILITY IN LOW BACK PAIN&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>06</FirstPage><LastPage>09</LastPage><AuthorList><Author>Abhishek Sharma</Author><AuthorLanguage>English</AuthorLanguage><Author> Urvi Bhavsar</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Back ground and Purpose: Low back Pain is a major cause of functional disability in India. It is because of trauma, degeneration or any pathology related to back. Low back pain is the most challenging job of physiotherapist to deal with it. The aim of the study was to study SLR angle, the angle at which the pain increases in severity or radiating starts, and functional disability. The second was to know severity of disability in routine functions of low back pain patients.&#xD;
&#xD;
Research Design: Co-relation method using Karl Pearson. Material and Methods: Personal interview of 30 patients with Low Back Pain was taken by using to know about the level of functional disabilities and Straight Leg Raise (SLR) angle was measured. Co-relation between both Roland and Morris questionnaire and Straight Leg Raise (SLR) Results: The co-relation between SLR angle and functional disability as measured by RM questionnaire is partial negative. The co-relation co-efficient is -0.75. Conclusion: SLR angle is indicative of the functional disabilities. The patient with more disability has less SLR angle&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Roland and Morris questionnaire, Straight Leg Raise (SLR) angle, Low back Pain</Keywords><Fulltext>INTRODUCTION &#xD;
Low back pain or lumbago is a common musculoskeletal disorder affecting 80% of people at some point in their lives. It is an extremely common human phenomenon which occurs because of trauma, degeneration or any pathology related to back. It can be either acute, sub acute or chronic in duration19. Low back pain (LBP) is defined as chronic after 3 months, unless pathoanatomic instability persists. A slower rate of tissue repair in the relatively avascular intervertebral disk may impair the resolution of some persistent painful cases of chronic LBP (cLBP) 18. The lumbar region (or lower back region) is made up of five vertebrae (L1-L5)5,8,17. In between these vertebrae lie fibro cartilage discs (intervertebral discs), which act as cushions, nerves runs from the spinal cord through foramina within the vertebrae, providing muscles with sensations and motor associated messages. Stability of the spine is provided through ligaments and muscles of the back, lower back and abdomen. Small joints those prevent as well as direct motion of the spine are called facet joints (zygapophysial joints).Low back pain is more persistent among people who previously required time off from work because of low back pain, those who expect passive treatments to help, those who believe that back pain is harmful or disabling or fear that any movement whatever will increase their pain, and&#xA0;people who have depression or anxiety3,4.This dysfunction leads to disability to perform any household activites, grooming and almost all daily activities. A disability is any long-term limitation in activity resulting from a condition or health problem. Disability mainly occurs in performing daily activities as dressing, grooming, lifting, etc.&#xD;
&#xD;
Purpose of the Study&#xD;
The first aim of the study was to study SLR angle, the angle at which the pain increases in severity or radiating starts, and functional disability. The second was to know severity of disability in routine functions of low back pain patients.&#xD;
&#xD;
METHODOLOGY&#xD;
Research Design: Simple Random Sampling Method .Co-relation method using Karl Pearson&#xD;
Source of Data: Patients with pathological back pain ???????&#xD;
Inclusion Criteria: Age group: 30 to 65 years of age.Sex: Male and female. Patients with pathological back pain like herniated disc, spinal Stenosis, spondylolisthesis, Sciatica, etc.&#xD;
&#xD;
Exclusion Criteria: Patients with mechanical back pain, osteoporosis, any spinal deformity, Ankylosis spondilitis.&#xD;
&#xD;
Sampling Technique and Sample Size&#xD;
All subjects who fulfilled the inclusion criteria were selected for the study which counts to a total of 30 patients&#xD;
&#xD;
Data Collection Method &#xD;
Personal interview method by using Roland and Morris questionnaire and measurement of Straight Leg Raise (SLR) angle.&#xD;
&#xD;
Outcome measures: RM (Roland and Morris questionnaire) scale was used to measure score of RM index.SLR angle was used to measure at which pain reproduces or radiating pain starts.&#xD;
&#xD;
Collection of Data &#xD;
Roland and Morris developed a questionnaire for evaluating patients with low back pain1,16 . This can be used to determine the level of patient disability and can help measure outcome following therapeutic intervention. The Questionnaire is usually paired with a visual analogue scale (VAS) for pain rating ranging from no pain at all to unbearable pain. There are total 24 questions, each has 1 point. If the answer is yes the score is 1 and for no score is 0.Total score = SUM (Points for all 24 statements).Interpretation-Minimum score: 0 Maximum Score: 24. The higher the score the more severe the disability associated with low back pain. A score of 0 indicates no disability and 24 severe disabilities. A score &#x2265; 14 indicates a patient in poor outcome group. Explain the patient the&#xD;
&#xD;
ROLAND AND MORRIS QUESTIONNAIRE. As they read a sentence that describes them today, put tick against it. If sentence does not describe them, then leave the space blank and go on to the next one.&#xD;
&#xD;
STRAIGHT LEG RAISING (SLR) 2,4,5,6,19: Unilateral SLR test test is positive if pain extends from the back down into the leg in the sciatic nerve distribution. With the patient in supine position, the hip is medially rotated and adducted, the knee is extended, and the examiner flexes the hip until the patient complains of the pain or tightness in back region or back of the leg. With the patient in supine position, the therapist passively flexes the hip until the symptom comes, this angle is measured by Goniometer.The fulcrum of goniometer is placed at greater trochanter; the moveable arm of the goniometer is placed along the shaft of the femur. The angle between fixed arm and movable arm is measured. The score of every patient and SLR angle should be noted and analyzed.&#xD;
&#xD;
DATA ANALYSIS &#xD;
The collected data were subjected to Karl Pearson Correlation Co-efficient method.&#xD;
&#xD;
RESULTS&#xD;
The co-relation co-efficient is -0.75.It shows moderately or partial negative co-relation between functional disability and SLR angle&#xD;
&#xD;
DISCUSSION&#xD;
There is partial negative co-relation between SLR and functional disability. That means, both variables are inversely related to each other. As a functional disability is more, the SLR angle is less. The pain produces at a lower angle because of more disability .The study also relates low back pain and functional disability. We can make the society aware about the disabilities 9,10,11,12,14 due to the back pain and explain them to take care about the daily activities. Low back pain is the most common problem in this era for physiotherapist to deal with.&#xD;
&#xD;
CONCLUSION&#xD;
The study concluded that there is a partial negative correlation between functional disability and SLR angle that is patient with more disability has less SLR angle.SLR&#xD;
&#xD;
ACKNOWLEDGEMENTS&#xD;
We are sincerely grateful to the god who showered blessings for our research. We are thankful to our principal for his help in every walk of our research. We would like to mention special thanks to my entire faculty who were always a standing rock for our great work. We are privilege to thank our patients without whom this research was not been possible. We acknowledge the immense help received from the scholar whose articles are cited and included in references of this manuscript. We are grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this research article has been reviewed&#xD;
&#xD;
ETHICAL COMMITTEE CLEARANCE: &#xD;
There was no ethical committee formed in the institution during the time in which research was performed.&#xD;
&#xD;
CONFLICT OF INTEREST: None&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1838</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1838</Fulltext></URLs><References>1. Brouwer S., Reliability and stability of Roland and Morris Disability Questionnaire was checked. Disability 2004 Feb; 26(3):162-5.&#xD;
&#xD;
2. Capra F, Vanti C, Donati R, Tombetti S, O&amp;#39;Reilly C, Pillastrini P.Validity of straight leg raise with sciatic pain with or without lumbar pain using Magnetic resonance imaging as standard Reference. Journal of Manipulative and Physiological Therapeutics. 2011; 34(4):231-8.&#xD;
&#xD;
3. Krause N, Ragland DR.Occupational disability due to low back pain: a new interdisciplinary Classification based on a phase model of disability. Spine. 1994 May; 19(9):1011-20.&#xD;
&#xD;
4. Lutz GK, Butzlaff M, Schultz-Venrath U. Looking back on back pain: trial and error of diagnoses in the 20th century. Spine .1976 Aug.; 28(16):1899-905.&#xD;
&#xD;
5. Bernard E.Finneson.Low Back Pain. McMinn Publishers.1998; 2nd Edition.&#xD;
&#xD;
6. Atul Patel, ABNA A. OGLE. Diagnosis and Management of Low Back Pain. Family Physician. 2000 Mar 15; 61(6):1779-1786&#xD;
&#xD;
7. Stratford, P.W., Binkley, J.M., and Riddle, D.L.Development and initial validation of the back pain functional scale. Health Services Research, 2000. 25 (16), 2095- 2102 8. B.D.Chaurasia.Clinical Anatomy.CBS Publishers; 1996,3rd edition.&#xD;
&#xD;
9. Debbie Ehrmann Feldman. Risk Factors for the Development of Low Back Pain in Adolescence. Oxford Journals, American Journal of Epidemiology: 2000.154(1); 30- 36&#xD;
&#xD;
10. Robbert Braton.Assessment and Management of Acute Low Back Pain. America Physician. 1999; 60(8):2299- 2306.&#xD;
&#xD;
11. Scientific approach of the assessment and management of activity-related spinal disorders. A Monograph for clinicians. Report of the Quebec Task Force on Spinal Disorders. Spine. 1987; 12(7):S1&#x2013;59.&#xD;
&#xD;
12. BK Mahajan.Methods in Biostatistics.Jaypee; 6th Edition.&#xD;
&#xD;
13. Maurits van Tulder.Exercise Therapy for Low Back Pain; A Systematic Review Within the Framework of the Cochrane Collaboration Back Review Group .SPINE. 2000.; 25(21): 2784 &#x2013;2796.&#xD;
&#xD;
14. A Kopec The Quebec Back Pain Disability Scale: conceptualization and development. Journal of Clinical Epidemiology.1996. ; 49(2):151-161.&#xD;
&#xD;
15. John Fran. Preventing disability from work-related low-back pain. Canadian medical journal.1998 ; 158:1625-3.&#xD;
&#xD;
16. Stratford PW et al. A comparison study of the back pain functional scale and Roland Morris Questionnaire. North American Orthopedic Rehabilitation Research Network. Journal of Rheumatology. 2000 Aug; 27(8):1928-36.&#xD;
&#xD;
17. Web supportswww.pubmed.com.www.google.com.&#xD;
&#xD;
18. A. F. Mannion, M. M&#xFC;ntener.et al.Comparison of three active therapies for chronic low back pain: results of a randomized clinical trial with one? year follow? up.Journal of Rheumatology (2001) 40 (7): 772-778.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>USE OF ANTIMICROBIAL PROPHYLAXIS IN SURGICAL AND MEDICAL INTENSIVE CARE UNITS - A&#xD;
COMPARATIVE STUDY&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>10</FirstPage><LastPage>15</LastPage><AuthorList><Author>Apurva Agrawal</Author><AuthorLanguage>English</AuthorLanguage><Author> Barna Ganguly</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Aims: To study the extent and pattern of use of antibiotics for prophylaxis in medical and surgical intensive care units. Subjects and Methods: 100 patients each from SICU and MICU were included inthe study. Case record files were analyzed daily until discharge from ICU or a maximum of 21 days. Details of all antibiotics prescribed for prophylaxis were recorded in a proforma, which were then analyzed using relevant statistical tests. Results: 65% patients in MICU and 99% in SICU received antibiotics (p value </Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Antibiotic, antimicrobial resistance, ICU.</Keywords><Fulltext>INTRODUCTION &#xD;
Infections are a frequent problem in Intensive Care Units (ICUs) and thus antibiotics are frequently used. Although antibiotics represent one of the most frequently prescribed classes of drugs among all hospitalized patients, total antibiotic consumption is much higher in the ICU than in general hospital wards. [1] Besides treatment of infections, antibiotics in ICU are administered as prophylaxis to prevent or limit major infections in critically ill patients. [2] Antibiotic prophylaxis is highly effective in some clinical settings, but in others, it accounts for misuses of antimicrobials, and may even be deleterious. [3] A number of studies have justified antibiotic prophylaxis in dirty or contaminated surgical procedures, where the incidence of wound infections is high, but such use must not be extended beyond 24 hours. [3] These include less than 10% of all surgical procedures. In clean surgical procedures, which account for approximately 75% of the total, antibiotics should not be routinely used as the expected&#xA0;incidence of wound infection is less than 5%. Except a very few conditions, non surgical antibiotic prophylaxis is not routinely indicated. Although awareness of the consequences of antibiotic misuse is increasing, overprescribing remains widespread. Overuse of antibiotics and poor compliance with infection control measures have been identified as the two major reasons for increasing antimicrobial resistance. [4] Studies on antibiotic prescription practices in ICUs have been done in some countries, [1,5] but information regarding studies done in Indian ICU setting is extremely limited. Antibiotic recommendations based on studies performed at a few selected centers may not be applicable and may not be generalized to all ICU settings. Singh N et al has suggested that research in individual ICU is essential in guiding antibiotic prescription practices. [6] As antibiotic policy for ICU in our Hospital was in developmental phase and we needed to know the potential areas of concern, a cross sectional study was done, to study the extent and pattern of use of antibiotics for prophylaxis in medical and surgical intensive care units.&#xD;
&#xD;
MATERIAL AND METHODS &#xD;
The Hospital, in which this study was conducted, is a 550 bedded tertiary care hospital. There are two adult ICUs, medical and surgical ICU, each ICU is a 12 bedded unit. In surgical ICU (SICU) majority of patients admitted are because of road traffic accidents and surgical patients admitted after various surgical procedures. In medical ICU majority of patients admitted are because of respiratory, cardiac or multiorgan failure.&#xD;
&#xD;
Inclusion and exclusion criteria: Patients admitted in SICU and MICU, of age above 18 years, irrespective of sex were included in the study from October 2007 to October 2009. Patients whose relatives were not willing to give consent and patients with age less than 18 years were excluded from the study.&#xD;
&#xD;
Collection of data: Permission was taken from Institutional Human Research Ethics Committee before starting the study. A total of 200 patients were included randomly, 100 from each ICU. As patients admitted in ICU are critically ill, written informed consent was taken from the relatives of the patients. Case record files of the included patients were analyzed daily until their discharge from ICU or a maximum of 21 days. Treatment was considered prophylactic if there was no evidence of infection and the drug was used to prevent infection. Details of all antibiotics prescribed for prophylaxis were recorded in a predecided proforma, including group of drug, route of administration, dose and duration of treatment.&#xD;
&#xD;
Statistical analysis: Data was analysed on Microsoft excel 2007. Mean and frequencies were calculated in the two groups. Chi square test was used to compare proportions and p value of &lt; 0.05 was considered as significant&#xD;
&#xD;
RESULTS&#xD;
In MICU 65 (65%) patients were prescribed antibiotics either single or in combination while in SICU 99 (99%) patients were prescribed antibiotics (p value </Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1839</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1839</Fulltext></URLs><References>1. Roder BL, Nielsen SL, Magnussen P, Engquist A, Frimodt-Moller N. Antibiotic usage in an intensive care unit in a danish university hospital. J Antimicrob Chemother 1993;32:633-42.&#xD;
&#xD;
2. Mangram AJ, Horan TC, Pearson ML, Silver LC, Jarvis WR. Guideline for prevention of surgical site infection, 1999. Hospital Infection Control Practices Advisory Committee. Infect Control Hosp Epidemiol 1999;20(4):250-78.&#xD;
&#xD;
3. Chambers HF. General principles of antimicrobial therapy. In: Brunton LL, editor. Goodman and gilman&#x2018;s the pharmacological basis of therapeutics. 11th ed. New York: McGraw-Hill; 2006. p. 1095- 110.&#xD;
&#xD;
4. Goldmann DA, Weinstein RA, Wenzel RP et al. Strategies to prevent and control the emergence and spread of antimicrobialresistant microorganisms in hospitals. a challenge to hospital leadership. JAMA 1996 Jan 17;275(3):234&#x2013;40.&#xD;
&#xD;
5. Malacarne P, Carlotta R, Bertolini G. Antibiotic usage in intensive care units: a pharmaco-epidemiological multicentre study. J Antimicrob Chemother 2004;54(1):221-4.&#xD;
&#xD;
6. Singh N, Yu VL. Rational empiric antibiotic prescription in the ICU &#x2013; clinical research is mandatory. Chest 2000;117(5):1496-9.&#xD;
&#xD;
7. Bergmans DCJJ, Bontena MJM, Gaillardc CA et al. Indications for antibiotic use in ICU patients: a one-year prospective surveillance. J Antimicrob Chemother 1997;39:527-35.&#xD;
&#xD;
8. Hartmann B, Junger A, Brammen D et al. Review of antibiotic drug use in a surgical ICU: management with a patient data management system for additional outcome analysis in patients staying more than 24 hours. Clin Ther 2004 June;26(6):915-24.&#xD;
&#xD;
9. Lampiris HW, Maddix DS. Clinical use of antimicrobial agents. In: Katzung BG, editor. Basic and clinical pharmacology. 11th ed. Boston Burr Ridge (IL): The McGraw-Hill Companies; 2009. p. 827-41.&#xD;
&#xD;
10. Marino PL. The ICU book. 3rd ed. Philadelphia (PA), USA: Lippincott Williams and Wilkins; 2007. p. 63-80.&#xD;
&#xD;
11. Bergmans DCJJ, Bonten MJM, Gaillard CA et al. Prevention of Ventilator-associated Pneumonia by Oral Decontamination. A Prospective, Randomized, Double-blind, Placebo-controlled Study. Am J Respir Crit Care Med 2001 Aug;164(3):382-8.&#xD;
&#xD;
12. Ulrich C, Harinck-de Weerd JE, Bakker NC, Jacz K, Doornbos L, de Ridder VA. Selective decontamination of the digestive tract with norfloxacin in the prevention of ICU-acquired infections: a prospective randomized study. Intensive Care Med 1989;15(7):424-31.&#xD;
&#xD;
13. van Kasteren MEE, Kullberg BJ, de Boer AS, Mintjes-de Groot J, Gyssens IC. Adherence to local hospital guidelines for surgical antimicrobial prophylaxis: a multicentre audit in Dutch hospitals. J Antimicrob Chemother 2003;51:1389-96.&#xD;
&#xD;
&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>SCENARIO OF BIOMEDICAL WASTE MANAGEMENT IN THE MAJOR HOSPITALS OF SRINAGAR CITY&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>16</FirstPage><LastPage>22</LastPage><AuthorList><Author>Rumisa Nazir</Author><AuthorLanguage>English</AuthorLanguage><Author> G. A. Bhat</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>In order to assess the biomedical waste management; the practices currently operative and compliance with Regulatory Notification for Biomedical Waste (Management and Handling) Rules, 1998, under the Environment (Protection Act 1986), Ministry of Environment and Forestry, Govt of India; the level of awareness regarding biomedical waste management and handling rules among the hospital staff; training imparted to the waste handlers and other particulars regarding risk associated with the handling of biomedical waste, the present study was carried out during May-July 2010 which involved the use of questionnaire method, in-depth interview and personal observation to crosscheck the authenticity of information gathered. During the study, the existing practices of biomedical waste management appeared&#xD;
to be unsatisfactory; hospitals did not conform to the Biomedical Waste (Management and Handling) Rules, 1998. Waste segregation was found not practiced by the hospitals surveyed and knowledge regarding biomedical waste management was found highest among the doctors i.e. 94.3% and 96% at SKIMS and SMHS hospital respectively indicating that people with higher qualification possessed more awareness regarding the prescribed rules. No specific training and awareness programs on biomedical waste management were organized by the hospital authorities.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Biomedical waste, Segregation, Knowledge, Training, Hospital, existing practices.</Keywords><Fulltext>INTRODUCTION&#xD;
Hospitals are service oriented institutes that provide medical facilities vital for our life and health. In the healthcare process, waste is generated which usually includes sharps, human tissues or body parts and other infectious materials (Baveja et al., 2000), also referred to as Hospital Solid Waste? and ?Biomedical Waste? (Manohar et al., 1998). It is a real problem of living nature and human world as it carries a higher potential for infection than any other type of waste. Waste is an unavoidable byproduct of human activities, pervading our environment for centuries and will continue to contaminate it. Therefore it is essential to have safe and reliable methods for waste management, focussing both on effective training and supervision. Waste management includes responsible planning of collecting, transporting, processing, and disposing waste material (Campbell, 1988; Stamenkovic, 2007). Within waste management, the healthcare waste management is a process that helps to ensure proper hospital hygiene and safety of healthcare&#xA0;workers and communities (Belkin et al.,1982; Baram, 1989).The primary sources of biomedical waste are hospitals, laboratories, diagnostic centres, blood banks, veterinary hospitals, nursing homes, clinics. Noninfectious waste forms nearly 85% of the waste generated by a hospital and the remaining 10% are hazardous (Pruss and Townend, 1998). Inappropriate and inadequate handling of biomedical waste may have a serious and significant impact on the public health and the environment. Sound management of biomedical waste needs to be given priority and made an integral feature of healthcare services. There is a need to sensitize the top level waste managers by making them aware of not only the various types of waste, but also its generation, collection, containment, handling, storage, transportation, treatment and final disposal. The proper segregation at source is an essential element of the successful waste management programme (pandit, 1999). If the infectious component gets mixed with the general noninfectious waste, the entire mass becomes potentially infectious (Nugget, 2010). Waste management has become a critical issue both at national and international level. In July 1998, the Government of India Environment Protection Act 1986 (Rule 29 of 1986) issued a Notification on Biomedical Waste (Management and Handling), Rules 1998, indicating the rules for the management and handling of biomedical waste. It defined ?biomedical waste? as any waste, which is generated during the diagnosis, treatment or immunization of human beings or animals or in research activities pertaining thereto or in the production or testing of biological and including categories mentioned in Schedule I (1998). Looking into the existing scenario of biomedical waste management in the country it was planned to undertake a study to assess the current practices of biomedical waste management and its compliance with Regulatory Notification for Biomedical Waste (Management and Handling) Rules, 1998, under the Environment (Protection Act 1986), Ministry of Environment and Forestry, Govt. of India; the level of awareness among the hospital staff; training imparted to the waste handlers and other particulars regarding risk associated with waste handling at two major hospitals of Srinagar, Kashmir known for their advanced diagnostic and surgical specialties. The study lasted for a period of 3 months.&#xD;
&#xD;
MATERIAL AND METHODS&#xD;
Data regarding the current biomedical waste management practices, level of awareness regarding biomedical waste management and handling rules prescribed therein was collected by the questionnaire method. The design of the questionnaire was based on the survey questionnaire of World Health Organization (WHO) with editorial changes and was framed according to the objective needs of the study. It was served to hospital administrators, doctors, nurses, sanitary staff and hospital engineers. Onsite personal observation of the management practices were carried out for confirmation and as a supplement to information gathered by the questionnaire. Formal interview was conducted to find whether the training is being imparted to the waste handlers and other particulars regarding risk associated with the waste handling. Authenticity of information so obtained was crosschecked through personal observation. The study was conducted with the prior approval of the subjects and institutions.&#xD;
&#xD;
STUDY AREA &#xD;
The historical Srinagar city is the summer capital of Jammu And Kashmir State, surrounded by hills on east and north eastern side loc E longitude. Altitude of Srinagar varies from 1580&#xA0;m in the low lying vicinity of River Jhelum and 1620m on the eastern hill slopes with an average elevation of about 1586m above mean sea level (Bates, 2005). The city lies on both side of river Jhelum, which swirls through the heart of the Srinagar city. For the present study two hospitals were selected which have different characteristics in terms of their size, treatment technology and the type of patients catered. The two study stations were:&#xD;
&#xD;
Sheri Kashmir Institute of Medical Sciences (SKIMS), Soura &#xD;
It is a tertiary care hospital, catering to the average socio-economic class of people and provides a total of 600 beds.&#xD;
&#xD;
Shri Maharaja Hari Singh Hospital (SMHS), Karan Nagar &#xD;
It is a teaching hospital associated to Government Medical College, Srinagar and is the biggest general hospital in terms of bed capacity (750).&#xD;
&#xD;
RESULTS&#xD;
Current biomedical waste management practices &#xD;
The important inferences regarding the various components of the waste management hierarchy like segregation, packaging, storage, collection, transportation and disposal were drawn and then the framework of compliance was assessed. Barring SKIMS, the waste was not segregated at source as prescribed in the Biomedical Waste Management Rules, 1998 (Table 1). Due to poor segregation practices, the general waste gets mixed up with the infectious waste. Hospitals were using uncovered plastic bins for waste collection provided with same kind of color coded labelled polybags. Polybags were not sealed properly and its integrity was found not to be preserved. In SMHS hospital, waste sharps were contained without being subjected to disinfection in open trays or in any of the bins. While in SKIMS, sharps were disinfected properly and finally incinerated. Waste storage area at SKIMS was of a size appropriate to the quantities of waste produced but did not have secured bins to eliminate the possibility of access to the waste by rodents, flies, or other natural scavengers. The waste was placed in an open area before disposal at SMHS hospital, so it was easily accessible to unauthorized personnel and animals. The transportation of waste to the storage site was done manually in SMHS hospital, while in SKIMS trolleys and pipeline system (Chute) was employed. Biomedical waste was autoclaved and incinerated (Type Brick Kiln; capacity 125 kg/hr) onsite, at SKIMS. Ash so obtained was buried in onsite ash pits, neither lined from below nor sealed above. Liquid waste was treated in the treatment plant and flushed into the sewers (Fig.1). SMHS hospital treats its biomedical waste at Common Biomedical Waste Treatment Facility (CBWTF), Lassipora Pulwama, Kashmir, while the liquid waste was flushed directly into the River Jhelum.&#xD;
&#xD;
The level of awareness among the hospital staff &#xD;
Knowledge regarding biomedical waste management and rules prescribed therein at SKIMS and SMHS hospital was found highest among the doctors in the tune of 94.3% and 96% respectively. Sanitary staff scored the least which indicates that the authority neither informed them in the form of instructions nor did they supervised their biomedical waste management practices (Fig. 2).&#xD;
&#xD;
Training and other particulars regarding risk in the waste handling &#xD;
Although 10% waste handlers were aware of risks involved in biomedical waste handling, 7.27% had received special training on this aspect. While 18.18% of waste handlers suffered from skin infections but none reported it to the&#xA0;higher authorities. 3.63% of waste handlers stated about being immunized (Table 2). Out of 100 waste handlers which were interviewed at SMHS hospital, 4% of waste handlers were aware of risks involved in biomedical waste handling. None has received special training on this aspect, 5% suffered from eye and skin infection and none reported to higher authority. None was found immunized against the infections (Table 3).&#xD;
&#xD;
DISCUSSION&#xD;
Biomedical waste seems to have received very little attention in waste management process in Srinagar city, Kashmir. Neither the government nor hospital authority pays proper attention to its management. Biomedical waste is disposed off randomly leading to unhealthy and hazardous environment affecting people living within the vicinity of health institutions in particular and city dwellers in general. The study revealed that the hospitals do not practice segregation, which was due to lack of trained waste handlers and proper supervision. As a result of failure to follow segregation protocols and infrastructure, the waste as a whole is potentially infectious. Rijal et al., (2007) observed segregation far from satisfactory in most of the healthcare institutions. Such a practice of non-segregation may increase the costs of final disposal of the waste. Hospitals under study were found not to be complying with the specifications for storage facilities. Untreated waste in SKIMS was transported to the collection point through pipeline system, which consists of a network of pipelines from various floors within the hospital.The vertical conduit allows the waste to be collected at a central collection point by means of gravity, thus preventing the horizontal movement of waste through the hospital corridors. But, there are some hygienic and technical problems associated with it (Bashir, 2009). Then the waste was carried to the onsite incinerator plant. In SMHS hospital, waste was collected manually and trolleys meant fo the same were not used at all. Part of the waste was taken to the CBWTF and part to the municipal site at Achan Syedpora for its disposal. Barring SKIMS, liquid waste from the other hospital was flushed into the River Jhelum without any treatment. Observation similar to the present investigation have also of course been made by the Purvi et al., (2006) in Gujarat, India. Doctors outscored nurses and sanitary staff in knowledge regarding biomedical waste management and rules prescribed therein.Doctors rated 94.3% in SKIMS, 96% in SMHS hospital with regard to knowledge.Sanitary staff exhibited poor knowledge in the tune of 26.6% and 25% respectively.This was indicative of the fact that the sanitary staff was never given even a capsule training with regard to biomedical waste management.Continuous awareness regarding biomedical waste management was needed to be promoted. It was found that the waste handlers were not in receipt of special training on biomedical waste handling which was prerequisite and necessary to ensure an understanding of the risks that wastes pose, to know how to manage waste etc. Waste handlers were found suffering from infections with no reporting to higher authorities. Reportedly, very few waste handlers were found immunized against the infections. Hence implementation of a waste management policy, training and motivation must be given paramount importance to meet the current needs and standards of biomedical waste management (Sharma and chauhan, 2008).&#xD;
&#xD;
CONCLUSION&#xD;
The management of biomedical waste in the study centres do not conform to the Biomedical&#xA0;waste (Management and Handling) Rules, 1998. It seemed that no significant action has been taken by the hospital authorities in compliance with the rules. The resistant attitude of hospital staff, lack of technical knowhow, and lack of skilled manpower could be responsible for the non-compliance of biomedical waste management rules. In order to achieve an effective and sustainable biomedical waste management system in the hospitals, the following suggestions were put forward for consideration:&#xD;
&#xD;
(i) Segregation practices were needed to be imposed within hospitals to separate infectious waste, which will result in a clean solid waste stream.&#xD;
&#xD;
(ii) Demonstrative programs should be conducted for employees who are in direct contact with the biomedical waste in order to provide an understanding of risks and importance of health and safety measures during handling.&#xD;
&#xD;
(iii) Periodic meetings of staff involved with the waste management be conducted in order to discuss problems and provide suggestions.&#xD;
&#xD;
(iv) Strict enforcement of law will help in improving the overall biomedical waste management scenario in Srinagar city.&#xD;
&#xD;
ACKNOWLEDGEMENT &#xD;
We acknowledge with thanks the (i) administrative staff of SKIMS and SMHS hospital, Srinagar, India for granting permission and cooperation during the study period and (ii) Scientists of State Pollution Control Board for their support and invaluable help that provided this study much of its pace and momentum. The noted patience of respondents is also highly appreciated. Authors acknowledge the immense help received from the scholars whose articles are cited and included in reference of this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1840</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1840</Fulltext></URLs><References>1. Baram, M. 1989. Hospital management of medical waste: legal framework and policy issues, Ch. IV: Perspectives on Medical Waste, Albany, NY: The Nelson A. Rockfeller Institute of Government, State University of New York.&#xD;
&#xD;
2. Bashir, F. 2009. Study of solid waste management at SKIMS. School of health sciences IGNOU.&#xD;
&#xD;
3. Bates, E.C. 2005. A Gazetteer of Kashmir. Pp: 352.&#xD;
&#xD;
4. Baveja, G., Muralidhar, S., Aggarwal, P., 2000. Hospital Waste Management- an overview. Hospital Today&#xD;
&#xD;
5 (9), 485-486. 5. Belkin, N.L. 1982. Do reusable or disposal gowns give better protection against infection? Laundry News, 8 (2): 10, 17-18.&#xD;
&#xD;
6. Campbell, D. 1988. Hospital Waste Management in Canada, proceeding of the national workshops on hospital waste incineration and hospital sterilization, U.S. EPA, San Francisco, C.A.&#xD;
&#xD;
7. Manohar, D., Reddy, P.R., Kotaih, B., 1998. Characterization of solid waste of a superspeciality hospital &#x2013; a case study. Ind. J. Environ. Health 40 (4), 319-326.&#xD;
&#xD;
8. Nugget, Hospital Waste Management and Biodegradable Waste, Government of India, Press Information Bureau, http://pib.nic.in/infonug/infaug,99/i3008991.ht ml-downloaded on 25.04.2010.&#xD;
&#xD;
9. Pandit, N.A. 1999. Study of biomedical waste management in teaching hospitals of Kashmir, P.hd thesis, Dept. of Hospital Administration, SKIMS.&#xD;
&#xD;
10. Pruss, A., Townend, W.K. 1998. Teacher&#x2018;s Guide: Management of wastes from healthcare activities. Geneva, WHO. Pp: 160.&#xD;
&#xD;
11. Purvi, M., sheth, K.N., Desai, H. 2006. Characterization and management of biomedical waste in SAE hospital, Anand- a case study, Electronic journal of environmental, agricultural and food chemistry, 5 (6): 1579-4377, 1583-89.&#xD;
&#xD;
12. Rijal , K., Despande, A. 2007. Critical evaluation of biomedical waste management practices in Kathmandu valley. Proceedings of the International Conference on Sustainable Solid Waste Management. Pp: 142- 47.&#xD;
&#xD;
13. Sharma, S., Chauhan, S.V.S. 2008. Assessment of biomedical waste management in three apex Government hospitals of Agra, 29(2): 159-162.&#xD;
&#xD;
14. Stamenkovic, M., Kralj, D. 2007. Healthcare and waste management, WSEAS Int. Conference on energy planning, energy saving, environmental education, Arcachon, France. Pp: 116-19.&#xD;
&#xD;
&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>PATIENTS&amp;#39; PERCEPTION ON HOSPITAL SERVICES WITH SPECIAL REFERENCE TO BEHAVIOR OF DOCTORS IN VILLUPURAM DISTRICT&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>23</FirstPage><LastPage>32</LastPage><AuthorList><Author>D. Karthikeyan</Author><AuthorLanguage>English</AuthorLanguage><Author> M. Thurunarayanasamy</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>This study aims to examine the patient perception of hospital services in villupuram district. A total of 600 respondents were selected in the study area in and out patients were included in the study to know their perceptions towards the public and private health facilities. The major reason of choosing the public health facility was inexpensiveness, infrastructure, and proximity of health facility. From the analysis of the respondents regardless of their social status have expressed the same ?poor&#x2018; views, but there is a significant difference in the degree of poor opinion across respondents categories by age, sex, education&#xA0;and occupation. It is finally concluded that behavior of doctors is significantly better in private hospitals compared to Government hospitals in villupuram district.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords/><Fulltext>INTRODUCTION &#xD;
Studies of patient satisfaction towards health services, health personnel and resources constitute important elements in the extent to which health services meet consumers&#x2018; expectations and needs. In recent years, patient&#x2018;s opinion is increasingly considered to be a useful component in the determination of care outcomes. Users&#x2018; perceptions are now considered to be important source of information in screening for problems and developing an effective plan of action for quality improvement in health care organization1 . Quality of health care is the degree of performance in relation to a defined standard of interventions known to be safe and that have the capacity to improve health within available resources. It can also be defined as meeting the health needs at the lowest cost and within regulations2 . Traditionally quality of health care has been measured using professional standards and neglecting the importance of patient perception and opinions in assessments of medical services, It has gained greater prominence over the past 25 years In any field, including medicine, customers&#x2018; perception on any service providing paramount importance and it is necessary for continual service improvement.3&#xD;
&#xD;
Statement of the Problem&#xD;
Last three decades provision of health care was dominated by Govt - run Hospitals. Owing to population explosion and consequent pressure on hospital infrastructure, Government hospitals could not cater to the needs of ever-growing patient population. With the result, patients belonging to middle class and upper middle class started switching to private health care providers in getting quality medical service. The newer diseases, life style diseases caused by environmental degrade warrant a heavy demand&#xA0;on health care services. Besides Government hospitals, and private hospitals have begun health care needs proliferating to cater to the mounting health care space. It is also apparent that there is a growing dissatisfaction among the patient clients about the services provided by health care service providers. Studies of patients&#x2018; perception towards health personnel, health services and resources are important to determine whether they meet patients&#x2018; expectations and needs and to judge patient satisfaction. This information can be used by hospital management in the improvements of programs and the problems identified by the patients. This will further provide a detailed picture of the patients&#x2018; experience at the hospital from which the hospital management can direct and focus their resources for better service in the future.. In this context this study proposed patients&#x2018; perception doctors on hospital services with in Villupuram District.&#xD;
&#xD;
Objective of the study&#xD;
1. To measure the patients&#x2018; perception on behavior of health personal in select hospitals in the study area.&#xD;
&#xD;
METHODOLOGY&#xD;
Period of the study &#xD;
The required primary data would be collected from the selected respondents during three months period, from May 2011 to July 2011. Secondary data will be collected for ten years period from 2002 to 2011&#xD;
&#xD;
Sources of data &#xD;
Primary data will be collected through questionnaires as well as through personal. Secondary data will be collected from published books, journals, and other documents&#xD;
&#xD;
Sampling Design&#xD;
The survey is proposed to conduct only on the target population of the selected hospitals. The details regarding the selected hospitals were obtained from the Deputy Direct of Health services, Villupuram. There are 575 public sector health establishments namely Government hospitals, Primary Health Centres (PHCs) and Health Sub-Centres (HSCs) in the district. There are and 143 private sector health establishments are namely private hospitals, nursing homes and clinics. Stratified random sampling was adopted for the selection of hospitals.&#xD;
&#xD;
Sampling Technique for Selection of Hospitals and respondents &#xD;
With regard to the selection of hospitals more than 50 bedded hospital from both private and government hospital in the study area will be selected, ten hospital from the government and ten from the private sector by using stratified random sampling technique. Thirty patients from each such sample hospital will be selected using convenience sampling technique. Thus, the sample size of the patients of Government hospitals amounts to 300 and 300 patients from private hospitals. Thus, the total sample size of the patients for this would be 600; it consists both in and out patients&#xD;
&#xD;
RESULTS AND DISCUSSION&#xD;
The reliability analysis calculates the following: item to total correlation, alpha if deleted and overall Cronbach&#x2018;s alpha coefficient. The Cronbach&#x2018;s alpha coefficient is widely used measure to find out the reliability and validity of a scale items. A scale items with Cronbach&#x2018;s alpha value of 0.70 and above is considered as reliable and valid in the acceptable level. George and Mallery (2003) provide the following rules of thumb: ? &gt; 0.90 &#x2013; Excellent, &gt; 0.80 &#x2013; Good, &gt; 0.70 &#x2013; Acceptable? (p. 231). As a rule of thumb, the cutoff value for item to total correlation is 0.30 and above, and alpha if deleted value should be less than overall Cronbach&#x2018;s alpha coefficient for any item to be&#xA0;retained in the scale. However, if alpha if deleted value is less than overall Cronbach&#x2018;s alpha, and item to total correlation is a bit less than 0.30 (&gt;= 0.25), then the item can be considered for retaining in the measurement scale. Next to reliability analysis, data pertaining to behavior of doctors are exposed to principal components of factor analysis with varimax rotation to identify the primary behaviours of doctors. The perceived status of primary behaviours are then compared across different socio-economic categories of respondents. This is carried to know whether the respondents regardless of the difference in socio-economic characteristics have perceived the behavior of doctors and nurses in similar manner or not. If there is similarity in the perception regardless of the socio-economic characteristics then final perceived status based on the entire sample regarding the doctors&#x2018; as well as nurses&#x2018; behavior will be irrefutable and conclusive. The results of the analysis are tabulated and discussed in the remaining part of this chapter.&#xD;
&#xD;
&#xD;
&#xD;
From Table 1, which presents the reliability analysis for items in the scale measuring behavior of doctors, it understood that ?item to total correlation&#x2018; for all items is above 0.30 and alpha if deleted value is below the overall Cronbach alpha coefficient of 0.7913. Hence, all 10 items in the scale used in the present study for measuring behavior of doctors towards patients are reliable and valid. Table 5.2 and 5.3 provides the results of factor analysis of the items in the scale measuring doctors&#x2018; behaviors. The eigenvalue produced by the factor analysis is nothing but variance explained in (extracted from) the actual original data by an underlying factor. The size of the eigenvlaue determines how many factors are extractable (valid) from the actual data. According to Kaiser Rule, a factor with eigenvalue of one or above is considered as a valid factor.&#xD;
&#xD;
&#xD;
&#xD;
In Table 5.2, it can be seen that the eigenvalue of first, second and third factors is above one, explaining 35.56 per cent, 14.58 per cent and 10.19 per cent of the variance in the actual data. All these factors together could posses 60.13 per cent of the essence of actual data. This further reveals that there are three factors underlying the behaviours of doctors and these three factors can be extracted for further analysis. To know the characteristics of each one of the valid factors, loadings of items in the scale with these factors are used.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
From Table 5.3, which provides the loadings of items in the scale with each one of the extracted factors, it is understood that the first factor is highly loaded with items 7 (Providing information about condition and treatment), 2 (Time spend by doctors with patient), 9 (Trust worthiness, reliability and honesty of doctors) and 1 (The level of communication between patient and doctors), second factor is loaded with items 10 (Routine preliminary test taken prior to admission of the patient), 3 (Advice given by doctor about ways to avoid illness) and 6 (Care taken by doctor to check everything), and third factor has high loadings of items 5 (Explanation given as reason for different medical test to be made), 8 (The level of understanding on language and medical terms used by doctors) and 4 (Explanation given by doctors about the cause of disease). Further, the loading of items 7 and 2 with first factor, items 10 and 3 with second and item 8 with third factor is very high. Hence, based on the items with highest loadings, the first, second and third factors is identified as the factors possessing the behaviours of the doctors in respect of ?Providing information about condition and treatment?, ?conducting Preliminary test prior to admission &amp; advising patients to avoid illness?, and ?Giving reasons for conducting different medical test?. The perceived status of above these three primary behaviours of doctors is evaluated based on the entire sample as well as across sub-sample groups based on their socioeconomic characteristics. The mean of the entire sample is compared with ?3&#x2018;, the value for neutral range using one-sample t-test to statistically identify the opinion range. The independent sample t-test and one-way ANOVA is used to compare the means of two groups and more than two groups respectively. Table 5.4 presents the mean opinion level of entire sample about primary behaviours of doctors in both private and government hospitals.&#xD;
&#xD;
&#xD;
&#xD;
An observation of the table shows that the mean level of opinion of the entire sample with ?providing information about condition and treatment? (Mean = 3.13), is significantly higher than the neutral level (t-value = 3.69, p &lt; 0.01) whereas the opinion of the total sample regarding ?giving reasons for conducting different medical test? (Mean = 2.92) is significantly less than neutral level (t = -2.16, p &lt; 0.05). On the other hand, the all respondents in the sample have expressed neutral opinion about ?Preliminary test prior to admission &amp; Advicing patients to avoid illness? (Mean = 3.05, t value is insignificant). Hence, it is found that behavior of doctors in providing information about condition and treatment is good, giving reasons for conducting different medical test is poor and conducting routine preliminary test prior to admission and advising patients to avoid illness is neither poor nor good.&#xD;
&#xD;
&#xD;
&#xD;
As shown in Table 5.5, the mean scores across age groups ranges from 2.99 to 3.45 for ?Providing information about condition and treatment?, 2.93 to 3.19 for ?Conducting routine preliminary test prior to admission &amp; Advising patients to avoid illness? and from 2.66 to 3.20&#xD;
&#xD;
?Giving reasons for conducting different medical test?. From significant F value of 5.18 (p &lt; 0.01) and 7.65 (p &lt; 0.01), it is understood that the opinion of the respondents about behavior of doctors regarding ?Providing information about condition and treatment? and ?Giving reasons for conducting different medical test? differ by age while their opinion about ?Conducting routine preliminary test prior to admission &amp; Advising patients to avoid illness? is independent of the age.&#xD;
&#xD;
&#xD;
&#xD;
From the comparison of opinion about behaviour of doctors between male and female patients, results of which are presented in Table 5.6, it is evident that both male and female regardless of the difference in sex have perceived similarly about ?Providing information about condition and treatment? and ?Giving reasons for conducting different medical test?. At the same time, regarding doctors&#x2018; behavior in respect of ?Conducting routine preliminary test prior to admission &amp; Advising patients to avoid illness?, the level of opinion of female group is significantly less than that of male counterparts (t-value = 2.02, p &lt; 0.01).&#xD;
&#xD;
&#xD;
&#xD;
When the opinion of the respondents compared across categories by education using one-way ANOVA test, results of which are depicted in Table 5.7, it is understood that there is a significant difference in the mean level of opinion across groups by educational status. This is because, F values, 9.60, 9.85 and 7.94 for the difference in group means are all significant at 1 per cent level. However, mean scores are much below 3 only for illiterates. Hence, it is found that perceived status of doctors&#x2018; behavior among patients is poor according to illiterates and differ significantly from other educational groups in this regard. Table 5.8 presents the results of test comparing the mean perception between patient group in urban and rural areas.&#xD;
&#xD;
&#xD;
&#xD;
Figure in brackets are standard deviation; Degrees of freedom = 598 for t values. Table value for 598 df @10 = 1.64, @5%=1.96; @1% = 2.58. *Significant at 10% evel; significant at 5% level From the results presented in the table, the mean level of opinion is significantly higher for urban group regarding ?Providing information about condition and treatment? (Mean = 3.21 Vs 3.08 and t-value = 1.76, p &lt; 0.10) and ?Giving reasons for conducting different medical test? (Mean = 3.02 Vs 2.85 and t-value = 2.25, p &lt; 0.05)) compared to that of rural counterparts. That is, urban patients perceive ?Providing information about condition and treatment? as good and ?Giving reasons for conducting different medical test? as neither good nor bad and this level of opinion is significantly than that of rural patient group. At the same time, regarding ?Conducting routine preliminary test prior to admission &amp; Advising patients to avoid illness?, both urban and rural group have perceived as neither poor nor good. Table 5.9 provides mean opinion across respondent categories with different occupational status about behaviours of doctors in hospital towards patients.&#xD;
&#xD;
&#xD;
&#xD;
According to the table, the mean perception of the agriculture group against all three factors and that of unemployed against ?Giving reasons for conducting different medical test? is below the neutral level (below 3.0). The mean scores for other occupational groups ranges between 3.01 (for professional group regarding ?preliminary test prior to admission &amp; Advising patients to avoid illness?) and 3.34 (for salaried in respect of ?Providing information about condition and treatment?. Further, F values 5.35, 3.71 and 4.46 for the different in group means against all three factors are significant at 1 per cent level. So, it is found that there is a significant difference in the perceived status of doctors&#x2018; behavior in hospitals among patients with different occupational status. Regarding behavior of doctors in private and government hospitals, the opinion of the patients is compared and results of the comparative analysis are reported in Table 5.10.&#xD;
&#xD;
As reported in the table, the behavior of doctors in government hospital is found to be poor as mean perception of the patients, which ranges between 2.50 and 2.86, is much less then neutral level (value of 3) against all three factors. At the same time, mean perception of the patient group belong to private hospitals ranging from 3.31 to 3.40 is well above 3 (neutral level) and in ?good&#x2018; range. Moreover, the t-values, 7.84, 7.79 and 13.57 for the difference in mean opinion level between private and government hospital patient groups with regard to ?Providing information about condition and treatment?, ?Conducting routine preliminary test prior to admission &amp; Advising patients to avoid illness? and ?Giving reasons for conducting different medical test? are significant at 1 per cent level. Therefore, it is concluded that doctors&#x2018; behavior in Government hospital is poor whereas it is good in private hospitals.&#xD;
&#xD;
CONCLUSION&#xD;
In this study, an attempt was made to know whether the respondents regardless of the difference in socio-economic characteristics have perceived the behavior of doctors. The perceived status of primary behaviours is then compared across different socio-economic categories of respondents, based on the items with highest loadings, the first, second and third factors is identified which are ?Providing information about condition and treatment?, ?conducting Preliminary test prior to admission &amp; advising patients to avoid illness?, and ?Giving reasons for conducting different medical test?. The perceived status of above these three primary behaviours of doctors is evaluated based on the entire sample as well as across sub-sample groups based on their socioeconomic characteristics. From analysis of the respondents regardless of their social status have expressed the same ?poor&#x2018; views, but there is a significant difference in the degree of poor opinion across respondents categories by age, sex, education and occupation. It is finally concluded that behavior of doctors is significantly better in private hospitals compared to that of those in Government hospitals in the villupuram district.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1841</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1841</Fulltext></URLs><References>1. Krupat, E., Rosenkranz, S. L., Yeager, C. M., Barnard, K.,Putnam, S. M., &amp; Inui, T. S. (2000). The practice orientations of physicians and patients: The effect of doctor&#x2013; patient congruence on satisfaction. Patient Education and Counseling, 39(1), 49&#x2013;59.&#xD;
&#xD;
2. Bureau ofIndian Standard. Quality Management and Quality System Elements: Guidelines for Services : IS : 14004 (part - 2), 1992.&#xD;
&#xD;
3. Torres E. J. and Guo K. L., 2004, ?Quality improvement techniques to improve patient satisfaction? International Journal of Health Care Quality Assurance Vol. 17, No. 6, pp. 334-338.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>DNA BARCODING, PHYLOGENETIC DIVERSITY STUDIES OF ETROPLUS SURATENSIS FISH FROM&#xD;
POORANANKUPPAM BRACKISH WATER, PUDUCHERRY&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>33</FirstPage><LastPage>42</LastPage><AuthorList><Author>Sachithanandam V.</Author><AuthorLanguage>English</AuthorLanguage><Author> Mohan P.M.</Author><AuthorLanguage>English</AuthorLanguage><Author> Muruganandam N.</Author><AuthorLanguage>English</AuthorLanguage><Author> Chaaithanya I.K.</Author><AuthorLanguage>English</AuthorLanguage><Author> Arun Kumar P</Author><AuthorLanguage>English</AuthorLanguage><Author> Siva Sankar R</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Etroplus suratensis is known for the high commercial value fish available in South India. The identification of the species of this fish cumbersome and inaccurate in different life stages of the fish. Therefore, DNA sequence of cytochrome Oxidase subunit I gene was analysed for the species identification and phylogenetic relationship of the species. The average genetic distance of conspecifics species value was found to be 0.005%. The present work suggests that COI sequence provides sufficient information on phylogenetic and evolutionary relationship to distinguish the Etroplus suratensis species, the brackish waters species of pearl spots, unambiguously. Further, this work revealed that every species having individual genetic distances depended upon the environmental stress and water quality, which play an important role for its minor morphometric variations. Therefore, it was concluded that a DNA COI barcoding tool can be used for fish identification by non technical personnel (other than taxonomist).&#xA0;&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>DNA barcoding, COI, brackish water, Pooranankuppam and Etroplus suratensis</Keywords><Fulltext>INTRODUCTION&#xD;
The chromids or the pearl-spots (Family: Cichlidae) form an important group among the brackish water fishes of the tropics. One of the genus Etroplus contains E. suratensis fish is inhabitant in fresh water and brackish water in southern India. E. suratensis has many desirable features which make them ideal fishes for aquaculture like wide salinity tolerance, ability to breed in confined waters, fast rate of growth, good body weight, tasty flesh, highly adaptable feeding habits, robust, sturdy body1 . Experimental cultures of this species show its potential for polyculture and integrated farming with poultry. In addition to export, it has high demand in the local market and fetches a price of more than US$ 3/kg2 . These fish is available throughout the year. The average production is about 1000 kg/ha/year over 8-10 month growout period. Morphometric studies are not only essential to understand the taxonomy but also the health of a species (including reproduction) in an environment. The morphometric features of the fish are unique to the species whereas the variations in its feature are probably related to the habit and habitat3 . Morphometric measurements have been widely used to discriminate populations of various fish species4-6 . Fishes are considered to be phenotypically more variable than most other vertebrates, having relatively higher withinpopulation coefficients of variation of phenotypic characters. Genetic polymorphism or environmental factors may induce&#xA0;morphological variability among spatially separated fish populations7 , and phenotypic plasticity in fish morphology has been documented for various species, including cichlids8,9 . E. suratensis is known to have variations in various morphological features which are dependent on the geographical partition. Further environmental comparisons of these estuaries would be worthwhile in understanding the evolution of such variations. In addition, genetic investigations of the variation and differentiation involving more estuarine samples of E. suratensis will be useful in substantiating the conclusions. The genotypic and phenotypic variation of species is a prerequisite in conserving them. DNA barcoding is highly efficient method in the analysis of genetic divergences among species as well as for intra species-level identifications10 . Among the marine living organisms of the IndoWest Pacific, Teleosts are among the bestdescribed, even though their systematics and taxonomy still need considerable research effort11,12. Southeast Asia has been identified as one of the world&#x2018;s biodiversity hotspots based on both plant and animal diversity13 . Many time taxonomic ambiguities exist due to morphological and meristic similarities. Modern taxonomic work includes analysis of a host of other traits, including anatomy, physiology, behaviour, genes, and geography, yet morphological traits remain cornerstone14 . In such circumstances, DNA barcodes has revealed that this could be helpful even for larval stage fish taxonomical identification15. To facilitate DNA barcode identification of fishes, regional working groups are conjoining under the Fish Barcode of Life (FISH-BOL) initiative16, which seeks to establish a barcode reference sequence library for all fishes17. The phylogenetic systems, in combination with conservation genetics, provide a critical frame work for understanding diversity18 and predict vulnerability to exploitation of tropical reef fishes19 . As the morphometric measurements could lead to misidentification of the species in different life stages of fish especially E. suratensis, which would affect the conservation strategy and the market value of the same. Molecular taxonomy appears to be the best tool for the species identification and advantageous over the other method of taxonomy, so the effort was taken to identify the E. suratensis through molecular taxonomy.&#xD;
&#xD;
METHODS&#xD;
Study Area, Sample collection and preservation: Fishes were collected from local fish landings at Pondicherry brackish area of Pooranankuppam (Fig.1). The identification of fishes was done as described in FAO14. A piece of muscle in the lateral line was collected and stored in 95% ethyl alcohol at -20 C for DNA extraction. The DNA Isolation and PCR condition work was carried out in Department of Ocean studies and Marine Biology centre at Port Blair, Andaman and Nicobar Islands. Molecular Taxonomy: Total DNA extracted from 0.25g of muscle by the standard proteinase-K/ phenol-chloroformisoamyl alcohol-ethanol method20. PCR amplification of a 650bp DNA fragment coding COI gene of the mitochondrial (mt) DNA genome was amplified using published primer set11 . PCR components and conditions for 50 l reaction were as described in our previous work21. The PCR product was resolved in 1% Agarose gel and visualized using Gel Doc System, to confirm the presence of amplified product sized 650 bp. Nucleotide sequencing was performed using BigDye Terminator Cycle Sequencing kit, following manufacturer&#x2018;s instructions (Applied Bio-systems, Foster City, CA, USA).&#xD;
&#xD;
Sequence Analysis: The DNA sequences of phenotypically identified fishes were assembled using the SeqMan II version 5.03 (DNASTAR). The sequence of Etroplus suratensis reference sequences retrieved from the NCBI GenBank were aligned using Clustal W pair-wise and multiple alignment of MEGA version 4.122 . Sequence divergence was calculated using the Kimura 2- parameter (K2P) model23 and the mid-point rooted Neighbour-joining (NJ) tree of K2P distances was created to provide a graphic representation of the species divergence24 (Fig. 2). RESULTS DNA barcoding is a unique concept with many innovative attributes undertakes continuous improvement in taxonomy. The estimated Etroplus suratensis species DNA sequences were submitted to GenBank under the mentioned accession number in Table 1. NCBI BLASTn result revealed that 21 reference sequences were matched with maximum identity of Etroplus suratensis of Puducherry as described in Table 2. The average genetic distance within the species (K2P) is 0.005. The species genetic evolutionary pair wise distance proximity was calculated by the species similarity of genetic base pair. The Etroplus suratensis DOSMB species closely related to the species (FJ237544 &#x2013; 0.006: GU5666028 &#x2013; 0.006: FJ347966 &#x2013; 0.006 and AY263870 &#x2013; 0.009) in the Indian waters and USA respectively (Table 3). The nucleotide composition of Etroplus suratensis from the present studied species is A = 23.4%, T = 29.9%, G = 18.6% and C = 28.1%. The average nucleotide composition of E. suratensis among the species level is noted as A = 23.48%, T = 30.08%, G = 18.1% and C = 28.36% (Table 4, Fig.3). The NJ and K2P genetic distances were created to provide a graphic representation of the patterns of divergences. Two distinct clad with two sub clad of the same species were recognized with more than 90% bootstrap value. These two sub clad formation was identified based on the independent assemblages of close related species with differences in region and environmental closeness. The results clearly shows that every species having individual genetic distances depended upon survival of any species adaptation of the environmental stress and its water quality, which play an important role of significant values of the genetic distances internally and morphometric minor variations externally. DISCUSSION Fishes are largest group of vertebrates, which exhibits remarkable diversity of morphological attributes and biological adaptations25. In these circumstances fish taxonomist facing a large problems while the identification of fishes. To overcome this problem, a morphology- based identification combined with molecular based approach for the species identification using DNA barcoding would be an ideal tool26 . This tool is an efficient method for species-level identification of the mitochondrial Cytochrome c Oxidase I (COI) gene27. Mitochondrial DNA (mtDNA) has been widely employed in phylogenetic studies of animals because it evolves much more rapidly than nuclear DNA, resulting in the accumulation of differences between closely related species 28-30 . This study provides the interspecific heterogeneity which enhanced the efficiency of species identification through bar coding. This was proved in Australian marine fishes11 , freshwater fish barcoding from Canadian31 and carangid fishes from Indian waters32 . The variations of phenotypic character of species are unique and it is probably related to the habit and&#xA0;habitat among the variants of this species33 . Genetic variation of the green chromid has not been studied previously of the genus E. suratensis in Indian waters. In the studies of bar coding, it has been reported that K2P values between two species should be greater than 0.0227,34 and in e.g. Indian mosquito DNA barcoding average K2P values is 0.032935 . The present bar code exhibited K2P pair wise genetic distances variation among the species level is 0.005. However, such variation has greater impact on the survival of the haplotypes and its evolution. The efficiency of species identification by molecular method was enhanced by the interspecific heterogenetic relationship displayed36 . Based on the above investigation it is clearly evident that the E. suratensis identified in Puducherry waters represented the haplotypes species morphometrically, the other part of the India and USA waters. However, bar code results suggested that they are genetically varied. Since, this species identified as haplotypes it may be of low level differences in morphometrically because of low genetic distances. Results of phylogenetic and evolutionary relationship of present study were supported by earlier studies11. Further, it has also confirmed that the DNA barcoding help to recover phylogenetic information and to understand the relationship with the species as well as Order level36. The present study also supported that mtDNA COI barcode region offers best species identification, which is most applicable and comparable with the mtDNA 12S - 16S rRNA region sequences37 . CONCLUSION The study concludes that the fish which identified morphometrically and DNA barcoding method using COI gene sequence are one and same species of E. suratensis, the brackish waters species of pearl spots. Further, this result also informed that every species having individual genetic distances depended upon the environmental stress and water quality which play an important role for its minor morphometric variations. Moreover, the mtDNA COI gene based identification provides high resolution in species identification in fishes.&#xD;
&#xD;
ACKNOWLEDGMENTS &#xD;
The Authors express their sincere acknowledges to Prof. J. A. K. Tareen, Vice-Chancellor of Pondicherry University and the constant help and encouragement of Dr. P. Vijayachari, Director, Regional Medical Research Centre (ICMR), Port Blair for the extension of facility during this study. The manuscript valuable review and commands supported by Chandal Lal and Sayi Dev. We express thanks to the Pondicherry University and Central Marine Living Resources and Ecology (CMLRE) for funding this work. Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/ editors/ publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1842</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1842</Fulltext></URLs><References>1. Hora, S. L and PilIay, T. V. R. (1962). Hand&#xB7;book on the fish culture in the Indo&#xB7;Pacific region. FAO Fish. BioI. Tech. pp. 14:124.&#xD;
&#xD;
2. James, C. M. (2000). Potential of marine fish farming in India: www\Grp\Grouper\Research\Economics\20 00\2103.htm pp. 1-3.&#xD;
&#xD;
3. Mauro Jos&#xE9; Cavalcanti., Leandro Rabello Monteiro and Paulo Roberto Duarte Lopes. (1999). Landmarkbased Morphometric Analysis in Selected Species of Serranid Fishes (Perciformes: Teleostei) Zool.stud. 38: pp. 287294.&#xA0;&#xD;
&#xD;
4. Elliott, N. G., Haskard, K. and Koslow J. A. (1995). Morphometric analysis of orange roughy (Haplostethus atlanticus) off the continental slope of southern Australia. Journal of Fish Biology 46, 202-220.&#xD;
&#xD;
5. Uiblein, F. (1995). Morphological variability between populations of Neobythites stefanovi (Pisces: Ophidiidae) from deep Red Sea and Gulf of Aden. Marine Ecology Progress Series 124: 23-29.&#xD;
&#xD;
6. Hurlbut, T. and Clay, D. (1998). Morphometric and meristic differences between shallow and deep-water populations of whitehake (Urophycis tenuis) in the southern Gulf of St. Lawrence. Canadian Journal of Fisheries and Aquatic Sciences 55: 2274-2282.&#xD;
&#xD;
7. Carvalho, G. R. (1993). Evolutionary aspects of fish distribution: genetic variability and adaptation. Journal of Fish Biology 43 (Supl. A), 53-73.&#xD;
&#xD;
8. Wimberger, P. H. (1991). Plasticity of jaw and skull morphology in the neotropical cichlids Geophagus brasiliensis and G. steindachneri. Evolution 45, 1545-1561.&#xD;
&#xD;
9. Wimberger, P. H. (1992). Plasticity of fish body shape. The effects of diet, development, family and age in two species of Geophagus (Pisces: Cichlidae). Biological Journal of the Linnaean Society 45, 197-218.&#xD;
&#xD;
10. Suneetha Gunawickrama, K.B. (2007). Morphological heterogeneity and population differentitation in the green chromid Etroplus suratensis (pisces: Cichlidae) in Sri Lanka, Ruhuna journal of Science, 2: 70-81.&#xD;
&#xD;
11. Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R. and Hebert, P. D. N. (2005). DNA barcoding Australia&#x2018;s fish species, Philos. Trans. R. Soc. B., 360: 1847&#x2013;1857.&#xD;
&#xD;
12. Knowlton, N. (2000). Molecular genetic analyses of species boundaries in the sea, Hydrobiologi 420: 73&#x2013;90.&#xD;
&#xD;
13. Myers, N., Mittermeier, R. A., Mittermeier, C. G., Fonseca G. A. B. and Kent, J. (2000). Biodiversity hotspots for conservation priorities. Nature 403: 853&#x2013;858.&#xD;
&#xD;
14. Fish Base. (2004). FishBase. World Wide Web electronic publication www. Fishbase.org.&#xD;
&#xD;
15. Packer, L., Gibbs, J., Sheffield, C. and Hanner, R. (2009). DNA barcoding and the mediocrity of morphology. Molecular Ecology Resources, 9: 42&#x2013;50.&#xD;
&#xD;
16. Swartz, E. R., Mwale, M. and Hanner, R. (2008). A role for barcoding in the study of African fish diversity and conservation. South African Journal of Science, 104: 293&#x2013; 298.&#xD;
&#xD;
17. Ward, R. D., Hanner, R. H. and Hebert, P. D. N. (2009). The campaign to DNA barcode all fishes, FISH-BOL. Journal of Fish Biology, 74: 329&#x2013;356.&#xD;
&#xD;
18. Jean-Pierre Fe&#xB4;ral. (2002). How useful are the genetic markers in attempts to understand and manage marine biodiversity? Journal of Experimental Marine Biology and Ecology, 268: 121&#x2013; 145.&#xD;
&#xD;
19. Simon Jennings., John, D. R., Nicholas, V. C. and Polunin. (1999). Predicting the Vulnerability of Tropical Reef Fishes to Exploitation with Phylogenies and Life Histories. Conservation Biology., 13: 1466- 1475.&#xD;
&#xD;
20. Sambrook, J., Fritsch E. F. and Maniatus, T. (1989). Molecular Cloning: A Laboratory Manual, second edition. Cold spring Harbor Laboratory press, Cold Spring harbour, New York.&#xD;
&#xD;
21. Sachithanandam, V., Mohan, P. M., Dhivya, P., Muruganandam, N., Baskaran, R., Chaaithanya, I. K. and Vijayachari, P. (2011). DNA barcoding, phylogenetic&#xA0;relationships and speciation of Genus: Plectropomus in Andaman coast Journal of research in Biology 3: 179-183.&#xD;
&#xD;
22. Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution&#xD;
&#xD;
24: 1596-1599. 23. Kimura. (1980). A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 15: 111&#x2013;120.&#xD;
&#xD;
24. Saitou, N. and Nei, M. (1987). The neighbour-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406- 425.&#xD;
&#xD;
25. Nelson, J. S. (2006). Fishes of the World, fourth ed. John Wiley &amp; Sons, Hoboken, NJ.&#xD;
&#xD;
26. Steinke, D., Zemlak, T. S., Boutillier, J. A. and Hebert, P. D. N. (2009). DNA barcoding of Pacific Canada&#x2018;s fishes. Mar. Bio 156: 2641&#x2013;2647.&#xD;
&#xD;
27. Hebert, P. D. N., Ratnasingham, S. and DeWaard, J. R. (2003a). Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proc R Soc Lond B Biol Sci 270: S596&#x2013; S599.&#xD;
&#xD;
28. Brown, W. M., George, M. and Wilson, A. C. (1979). Rapid evolution of animal mitochondrial DNA. Proc Natl Acad Sci USA 76: 1967&#x2013;1971.&#xD;
&#xD;
29. Moore, W. S. (1995). Inferring phylogenies from mtDNA variation: Mitochondrialgene trees versus nuclear-gene trees. Evolution, 49: 718&#x2013;726.&#xD;
&#xD;
30. Mindell, D. P., Sorenson, M. D., Huddleston, C. J., Miranda, H. C. and Knight, A., et al. (1997). Phylogenetic relationships among and within select avian orders based on mitochondrial DNA. In: DP Mindell, editor. Avian molecular evolution and systematics, New York: Academic Press. pp. 214&#x2013;247.&#xD;
&#xD;
31. Hubert, N., Hanner, R., Holm, E., Mandrak, N.E., Taylor, E., Burridge, M., Watkinson, D., Dumont, P., Curry, A., Bentzen, P., Zhang, J., April, J. and Bernatchez, L. (2008). Identifying Canadian freshwater fishes through DNA barcodes. PLos ONE, 3: 2490&#x2013;2490.&#xD;
&#xD;
32. Persis, M., Reddy, A. C. S., Rao, L. M., Khedkar, G. D., Ravinder, K. and Nasruddin, K. (2009). COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India. Molecular Biology Report. 36: 1733-1740.&#xD;
&#xD;
33. Manimegalai, M., Karthikeyeni, S., Vasanth, S., Arul, G. S., Siva, V. T. and Subramanian, P. (2010). Morphometric Analysis &#x2013; A tool to identify the different variant in a fish species E. Maculatus. International journal of Environmental Sciences, 1: 1-17.&#xD;
&#xD;
34. Hebert, P. D. N., Cywinska, A., Ball, S. L. and DeWaard, J. R. (2003b). Biological identifications through DNA barcodes. Proc R Soc Lond B Biol Sci 270: 313&#x2013;321.&#xD;
&#xD;
35. Kumar, N. P., Rajavel, A. R., Natarajan R. and Jambulingam, P. (2007). Morphology, Systematics, Evolution DNA barcodes can distinguish species of Indian Mosquitoes (Diptera: Culicidae). Journal of medical Entomol 44: 1-7&#xD;
&#xD;
36. Lievens, S., Goormatching, S. and Holsters, M. (2001). A critical evaluation of differential display as a tool to identify genes involved in legume nodulation: looking back and looking forwared. Nucl. Acids Res, 29: 3459 &#x2013; 3468.&#xD;
&#xD;
37. Ward, R. D., Holmes, B. H., White, W. T. and Last, P. R. (2008). DNA barcoding Australian chondrichthyans results and potential uses in conservation. Marine and Freshwater Research 59: 57-71&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Fig 4 Neighbour-Joining (NJ) Method for Phylogenetic analysis and Evolutionary relationships of E. suratensis with NCBI references sequence The bootstrap test (1000 replicates) is shown next to the branches length is = 0.41765812 [Felsenstein 1985]. The evolutionary distances were computed using the Maximum Composite Likelihood method. Codon positions included were 1st+2nd+3rd. Phylogenetic analyses were conducted in MEGA4 [Tamura, et al 2007].&#xD;
&#xD;
&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>IS SKELETAL MUSCLE "A TARGET ORGA" IN LONG TERM UNCONTROLLED DIABETES MELLITUS? A&#xD;
COMPARATIVE AND CORRELATIVE STUDY OF TYPE I AND TYPE II DIABETES&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>43</FirstPage><LastPage>48</LastPage><AuthorList><Author>Prathamesh Haridas Kamble</Author><AuthorLanguage>English</AuthorLanguage><Author> Sunil Bhamre</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background and Objective: Diabetes Mellitus is the most common endocrinal disorder worldwide. Long term uncontrolled diabetes is associated with complications of eyes, kidney, heart, blood vessels and nerves. Studies have been carried out to see the effect of diabetes on skeletal muscle strength but the results are conflicting; while very few studies have considered the muscle endurance. Moreover, the correlation of glycosylated haemoglobin levels (HbA1c) with handgrip strength (HGS) and hand grip endurance (HGE) has not been studied. So the present study was carried out in 100 type I diabetics and 164 type II diabetics to compare the HGS and HGE with 100 and 160 normal healthy non diabeticsubjects respectively. Also the objective of this study was to determine the relation of HbA1c with HGS and HGE. Research Methodology: HGS and HGE were measured using Handgrip dynamometer. HbA1c was assessed by cation - exchange resin method using Monozyme&#x2018;s Glycohemin kit on Transasia&#x2018;s semiautoanalyzer. Outcome of Study: Results of the study showed that type I &amp; II diabetics had significantly lower HGS than non diabetics. HGE was lower in type II diabetics while it was significantly higher in type I diabetics as compared to controls. This study also indicated that HGS and HGE had no significant correlation with HbA1c. Thus present study reveals that uncontrolled diabetics are at a risk of decreased muscle strength and endurance and the magnitude of affection is highly individual specific. Thus there is a need for development of strategies in the form of strict glucose control and resistant training exercise program to slow or prevent rapid decline in muscle function in diabetics.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Handgrip strength, Handgrip endurance, glycosylated haemoglobin, diabetes.</Keywords><Fulltext>INTRODUCTION &#xD;
Diabetes mellitus is the most common endocrine disorder. It is a syndrome of impaired carbohydrate, fat and protein metabolism which is characterized by hyperglycemia caused by either reduced insulin secretion or decreased sensitivity of tissues to insulin. The worldwide prevalence rate of Diabetes Mellitus (DM) for all ages was about 2.8 % in 2000 and projected to be 4.4 % in 2030 [1]. The chronic hyperglycemia and its associated metabolic deregulation, is associated with potential long term complications that can affect various tissues like kidney, eye, heart, blood vessel and nerve. [2] There is a new concept to explain these long term complications of DM called as ?hyperglycemic memory&#x2018; which proposes that if a cell remains in hyperglycemic environment for&#xA0;certain duration, then it adapts to work in the hyperglycemic state. [3] Meticulous control of blood glucose can decrease the symptoms and improve the diseased condition. Even after the return of plasma glucose to normal or near normal level, the progression of long term diabetic complications still continues. [4] Thus, measurement of glycosylated hemoglobin (HbA1c), which provides the information about the average blood glucose concentration over preceding 6-8 weeks, is a good indicator of long term complications of diabetes mellitus. The possibility that the skeletal muscle is also a target organ for diabetic complication was suggested by Sayer A A et al who found reduced muscle strength and impaired physical function in Type 2 diabetes. [5] There have been many studies of handgrip strength in diabetic patients with conflicting results. Many reports have suggested possible patho-physiological mechanism also. Reduction in handgrip strength is generally found in diabetics. [6, 7, 8] It seems that reduction in handgrip strength has a linear relationship with severity of diabetes which in turn is in linear relationship with functional ability of daily living activities. However, at the present time there are no reports of functional limitations in daily activities ascribable to diabetes. The present study attempts to compare handgrip strength and handgrip endurance in type I, type II diabetics and normal subjects (controls), to evaluate whether there is any correlation between glycosylated haemoglobin (HbA1c) and magnitude of reduction in hand grip strength and endurance in type I and type II diabetic patients.&#xD;
&#xD;
MATERIAL AND METHODS&#xD;
The present study was carried out in the diabetic clinic in Indira Gandhi Government Medical College and Mayo hospital, Nagpur. The Institutional Ethics Committee approved the study. The study was divided into two groups: A) Group I, B) Group II.&#xD;
&#xD;
A) Group I: Based on detailed history and physical examination, subjects were further divided into two sub-groups: (i) Type I diabetic group: Comprised of 100 male subjects in the age group of 31-45 years, having duration of diabetes between 5-10 years, regularly visiting the diabetic clinic and taking regular insulin therapy, were selected. (ii) Control I group: For comparison, a separate group of 100 healthy subjects, with no history of diabetes or disorder of defective sugar metabolism, was selected. They belonged to the same age group and nearly had the same height, built, socioeconomic status and ethnic group, as that of type I diabetic group subjects.&#xD;
&#xD;
B) Group II: Similarly, on the basis of detailed history and physical examination, subjects were further divided into two sub-groups (i) Type II diabetics group: 164 males, belonging to age group of 41-55 years, having duration of diabetes between 5-10 years, regularly visiting the diabetic clinic and taking only oral anti diabetic drugs regularly, were included. (ii) Control II group: A group of 160 healthy non diabetic male subjects in the age group of 41-55 years and having nearly the same height, weight, built, ethnicity and socioeconomic status were selected. Subjects, who were left handed, involved in regular handgrip exercise or constant method of working with handgrip or suffering from asthma, chronic obstructive pulmonary diseases, congestive cardiac failure, Myasthenia gravis and hypothyroidism, were excluded from the study. Also factors that interfere with HbA1c test results like diagnosed cases of hyperbilirubinemia and chronic alcoholism were excluded from the study. After selection, written informed consent was obtained from all the participants. Then anthropometric measurements like standing height and weight were taken. Early morning 5&#xA0;cc fasting blood sample was obtained under all aseptic precautions. Serum was separated and fasting blood sugar and glycosylated haemoglobin levels (HbA1c %) were estimated. Blood sugar levels were assessed by glucose oxidase biosensor method using glucometer and glycosylated haemoglobin levels (HbA1c %) were assessed by cation - exchange resin method using Monozyme&#x2018;s Glycohemin kit on Transasia&#x2018;s semiautoanalyzer. Handgrip strength was determined by using handgrip dynamometer. The use of this instrument was illustrated to participants prior to testing. Handgrip dynamometer was given in the right hand of subjects in standing position and arm by their side, not touching the body and were asked to squeeze the dynamometer with as much force as possible, taking care to squeeze only once for each measurement. 3 trials were performed with a pause of about 10- 20 seconds between each trial to avoid the effect of fatigue. Best amongst the 3 measurements was noted. The handgrip endurance was also measured. The subjects were asked to maintain 80% of their handgrip strength for as long as they could and time in seconds was recorded using a stop watch.&#xD;
&#xD;
STATISTICAL METHODS &#xD;
The statistical analysis of observations was carried out. Mean and standard deviation were calculated and significance of difference was tested statistically by the unpaired student&#x2018;s ?t test? at P &#x2264; 0.05. Correlation coefficient (r) was calculated and tested for statistical significance.&#xD;
&#xD;
RESULTS&#xD;
Table no. 1 shows the various parameters and their mean values and standard deviations for both type I diabetics and type II diabetics and their respective control groups. The mean age of Group 1 (type I DM and control I) was 37.8 years and 37.9 years, while for Group 2 (type II DM and control II) it was 48.1 and 46.4. There was no significant difference in the age of Group 1 and Group 2. Thus both the groups were age matched. There was no significant difference in height, weight, BSA and BMI; indicating that the groups were homogenous in this respect. Fasting and post meal blood sugar levels were higher in type I and type II diabetics than respective controls. For HbA1c the normal reference value is &lt; 6 %. [4] It was observed that for both type I and type II diabetics, HbA1c was on a statistically higher side than controls indicating poor control of long term blood sugar levels. The handgrip strength (HGS) was significantly lower in type I and type II diabetics as compared to controls. Handgrip endurance (HGE) was significantly higher in type I diabetic subjects as compared to controls, while for type II diabetics, HGE was lower than the controls. Table II depicts the correlation of Handgrip strength and Handgrip endurance with various parameters. It indicated that there was no statistically significant correlation existing between HGS and HGE with any of the parameters of present study for both Group I and Group II diabetics. This shows that the magnitude of skeletal muscle strength and endurance changes produced due to uncontrolled diabetes were based upon individual susceptibility of subjects.&#xD;
&#xD;
DISCUSSION&#xD;
The present study has demonstrated that both type I and type II diabetic subjects had lesser muscle strength than non diabetics. This finding is consistent with the findings of Park SW [6], Savas S [7] and Lord SR [8].The probable explanations for this finding are: (1) diabetes is associated with increased systemic inflammatory cytokines such as tumor necrosis factor &#x3B1; and interleukin-6. These cytokines have a&#xA0;detrimental effect on muscle function. [9,10, 11] (2) Uncontrolled diabetics are associated with glycation of skeletal muscle proteins such as actin and myosin leading to a significant reduction in vitro speed of actin and myosin filament. [12] (3) Cotter M 1989 [13], Klueber KM 1989 [14] and Medina -Sanchez M 1991 [15] demonstrated a significant and selective atrophy of type II b fibers in diabetic rats although this mechanism remains unclear in human (4) As suggested by Anderson H 1996 [16] motor neuronal neuropathic processes give rise to peripheral neuropathy which might be associated with decreased muscle strength in type I and type II diabetic subjects, and (5) long term uncontrolled diabetes leads to metabolic consequences like muscle protein catabolism and inadequate energy use, which results in potential reduction in muscle strength. Handgrip endurance in the present study was significantly longer in type I diabetics than non diabetics, while for type II diabetics it was significantly shorter than the controls. Though the mechanism of this finding is unclear in humans, in experimental diabetic rats it has been demonstrated that prolonged increased or decreased blood insulin levels lead to a change in the composition of muscle fiber type. Hypoinsulinemia shifts the muscle fiber composition towards red muscle fiber also known as fatigue resistant fibers [10, 11] and hyperinsulinemia induces an increase in the number of white muscle fibers which are least fatigue resistant. Thus due to hypoinsulinemia seen in type I diabetics, there is an increased proportion of fatigue resistant red muscle fibers which might be responsible for increased handgrip endurance in them. While type II diabetes is a condition characterized by insulin resistance and high blood insulin levels. So this prolonged hyperinsulinemia induced-easy fatigable white muscle fiber composition of in case of type II diabetics, might be the reason for their lower endurance as compared to non diabetics. In the present study, there was no linear correlation of glycosylated hemoglobin (HbA1c %) with handgrip strength and handgrip endurance for both type I and type II diabetics. These findings suggest that in uncontrolled diabetics skeletal muscle weakness is produced but the magnitude of affection depends upon individual subject&amp;#39;s susceptibility to the glycemic changes as well as the irregularities in the treatment compliance of each subject. Thus considering these two factors the linear correlation might not have been observed.&#xD;
&#xD;
CONCLUSION&#xD;
From the present study it is clear that if the blood sugar level in diabetics remains uncontrolled then they are at risk of decreased skeletal muscle strength and its magnitude of affection is highly individual specific. It is important because the accelerated loss of muscle strength may lead to functional limitation and physical disability and morbidity. We need to develop strategies to slow or prevent rapid declines in muscle function in high risk population of adults with diabetes to decrease morbidity. Every potential way such as strict glucose control and resistive training exercise programs should be introduced.&#xD;
&#xD;
ACKNOWLEDGEMENTS &#xD;
We acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. We are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1843</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1843</Fulltext></URLs><References>1. Rathmann W, Giani G. Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care. 2004; 27(10):2568-9.&#xD;
&#xD;
2. Alberti KG, Zimmet PZ. Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med. 1998; 15(7):539- 53.&#xD;
&#xD;
3. Wright A. Metabolic memory in type 1 diabetes. Br J Diabetes Vasc Dis. 1998; 9:254-257.&#xD;
&#xD;
4. Foster DW. Diabetes Mellitus. In: Fauci AS, Martin JB, Kasper DL, Hauser S. (eds), Harrison&#x2018;s Principles of Internal Medicine. 2011. Volume 2, (pp.2078-2080.) New York; McGraw Hill.&#xD;
&#xD;
5. Sayer AA, Dennison EM, Syddall HE, Gilbody HJ, Phillips DIW, Cooper C. Type II Diabetes, muscle strength and impaired physical function. Diabetic Care. 2005; 28 (10): 2541-2542.&#xD;
&#xD;
6. Park SW, Goodpaster BH, Strotmeyer ES, de Rekeneire N, Harris TB, Schwartz AV, et al. Decreased muscle strength and quality in older adults with type 2 diabetes: the health, aging, and body composition study. Diabetes. 2006; 55(6):1813-8.&#xD;
&#xD;
7. Savas S, Koroglu BK, Koyuncuoglu HR, Uzar E, Celik H, Tamer NM. The effects of the diabetes related soft tissue hand lesions and the reduced hand strength on functional disability of hand in type 2 diabetic patients. Diabetes Res Clin Pract. 2007; 77(1):77-83.&#xD;
&#xD;
8. Lord SR, Caplan GA, Colagiuri R, Colagiuri S, Ward JA. Sensori-motor function in older persons with diabetes. Diabet Med. 1993; 10(7):614-8.&#xD;
&#xD;
9. Temelkova-Kurktschiev T, Henkel E, Koehler C, Karrei K, Hanefeld M. Subclinical inflammation in newly detected Type II diabetes and impaired glucose tolerance. Diabetologia. 2002; 45(1):151.&#xD;
&#xD;
10. Visser M, Pahor M, Taaffe DR, Goodpaster BH, Simonsick EM, Newman AB, et al. Relationship of interleukin-6 and tumor necrosis factor-alpha with muscle mass and muscle strength in elderly men and women: the Health ABC Study. J Gerontol A Biol Sci Med Sci. 2002; 57(5):M326-32.&#xD;
&#xD;
11. Helmersson J, Vessby B, Larsson A, Basu S. Association of type 2 diabetes with cyclooxygenase-mediated inflammation and oxidative stress in an elderly population. Circulation. 2004; 109(14):1729-34.&#xD;
&#xD;
12. Ramamurthy B, Hook P, Jones AD, Larsson L. Changes in myosin structure and function in response to glycation. FASEB J. 2001; 15(13):2415-22.&#xD;
&#xD;
13. Cotter M, Cameron NE, Lean DR, Robertson S. Effects of long-term streptozotocin diabetes on the contractile and histochemical properties of rat muscles. Q J Exp Physiol. 1989; 74(1):65-74.&#xD;
&#xD;
14. Klueber KM, Feczko JD, Schmidt G, Watkins JB 3rd. Skeletal muscle in the diabetic mouse: histochemical and morphometric analysis. Anat Rec. 1998; 225(1):41-5.&#xD;
&#xD;
15. Medina-Sanchez M, Rodriguez-Sanchez C, Vega-Alvarez JA, Menedez-Pelaez A, Perez-Casas A. Proximal skeletal muscle alterations in streptozotocin-diabetic rats: a histochemical and morphometric analysis. Am J Anat. 1991; 191(1):48-56.&#xD;
&#xD;
16. Andersen H, Poulsen PL, Mogensen CE, Jakobsen J. Isokinetic muscle strength in long-term IDDM patients in relation to diabetic complications. Diabetes.1996; 45(4):440-5.&#xD;
&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>IN-SILICO STUDIES ON P43 PROTEIN FROM PLASMODIUM FALCIPARUM&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>49</FirstPage><LastPage>54</LastPage><AuthorList><Author>Tarun Kumar Bhatt</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Eukaryotic Aminoacyl-tRNA synthetases exist in large complex consists of different tRNA synthetases with auxiliary proteins. P43 is one of the three non-synthetases proteins found in multi-synthetases complex. P43 has been shown to involve in various biological processes like tRNA transport from nucleus, apoptosis etc. Homologous sequence of P43 is also found in Plasmodium falciparum (PfP43). In this study, homology modeling, structure validation and active site determination methods were used to perform structural characterization of P43. Results show the overall three-dimensional structure of P43 with proper Ramachandran plot. Also, Active site residues were nicely located onto the structure of P43. In addition, structural comparison between P43 of human and parasite origin provided information on&#xD;
subtle differences in overall structures of proteins. Our results suggest that elucidation of PfP43 structure is critical in developing anti-malarial drugs.&#xA0;&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>P43, Homology modeling, Plasmodium</Keywords><Fulltext>INTRODUCTION &#xD;
Plasmodium falciparum is the causative agent of epidemic disease malaria. Many developing countries are suffering from socio-economic burden of this fatal parasitic disease. Several drugs have been identified against malaria parasite but prime concern remains are the rapid development of drug resistance among parasites. In addition, P. falciparum adapts different strategies to overcome immune responses1-4 and because of it, effective vaccine against parasite has not been developed. Taking into consideration all the facts discussed above, there is regular need of identifying new protein molecules of the parasite which could be targeted as potential drug target. Aminoacyl-tRNA synthetases (aaRSs) are conserved class of proteins which play important role in protein synthesis machinery of all living organism. In eukaryotes, aaRSs are found in the form of multi-synthetases complex (MSC), comprises of 9-10 different tRNA synthetases and 3 non-synthetases proteins5 . P43 is part of the non-synthetases component of MSC. Protein P43 has been shown to involve in different biological processes which include trafficking of tRNA, involvement in autoimmune disease, inhibition of formation of new vascular tissue in metastatic carcinoma and in stability to MSC6-9 . In addition, the important function of P43 comes into play as precursor of EMAPII (Endothelial Monocyte Activating Polypeptide) domain.&#xD;
&#xD;
EMAPII is involved in acute inflammation and play crucial role in apoptotic processes10. This aaRSs family of proteins have been identified in Plasmodium along with the homolog of P43 (PfP43). Nothing much has been done in characterization of this protein but PfP43 was found to be secretory in nature during parasite asexual life cycle in human. Pro-inflammatory property of PfP43 might play an important role in modulating host immune response and could be vital in malaria patho-physiology. In this work, we have utilized the quick and effective method of solving three-dimensional structure of PfP43 using homology modeling. Comparative studies with human counterparts along with the identification of active site of the protein P43 could pave the way in identifying new effective drug-like molecules against deadly malaria parasite.&#xD;
&#xD;
MATERIALS AND METHODS &#xD;
The sequence of PfP43 was obtained using NCBI Blast by taking human counterpart as template. Other information of PfP43 was extracted from PLASMODB using PF14_04013 as accession number. 1E7Z and 1FL0 pdb structures were used as a template for homology modeling. Identification of template structures was carried out using NCBI BlastP where search parameters were restricted to PDB (Protein Data Bank). Sali&#x2018;s Modeller and Swiss Model Server were used to build the in-silico structure of PfP43. Online facility of sequence submission and locally downloaded program of Modeller, both were used to construct three-dimensional structure of P43 domain. RAMPAGE online server was used for structure validation which gives output of Ramachandran plot describing maximum allowed amino acids present in modelled structure. Active site prediction was performed with CASTp using modelled structure of PfP43 domain. Images were created using CHIMERA11. Images were processed at higher resolution in PNG format.&#xD;
&#xD;
RESULTS AND DISCUSSION&#xD;
The three-dimensional structure of PfP43 domain is highly compact in nature and it is typically EMAPII like domain. Structure is the mixture of alpha helices and beta sheets where beta sheets are predominantly occupying the most of the space (fig.1). In addition there are several loops hanging out of the core part of structure probably involved in making contact with interacting molecules which include both protein and nucleic acid in case of P43. Panel B of fig.1 shows the surface topology of PfP43 where most of the surface is positively charges with intermittent negative charged patches, indicative of nucleic acid binding ability of PfP43. However, one side of the PfP43domain is highly negative in nature typically nucleic acid binding site whereas other side is mixture of both negative and positively charged residues which might be interacting with other proteins based on charge complementarily. Ramachandran plot of the modelled PfP43 suggest that most of the amino acid residues are in allowed region of three-dimensional space and thus validate the homology modeling (fig.3). Further, structural comparison between P43 of human and Plasmodium was performed. Overall the both the proteins share common fold and domain topology but there are few structural differences like secondary structure of beta sheet present in PfP43 whereas absent in human counterpart, subtle changes in three-dimensional space of helices and loops (fig.2). These structural differences could become basis of drug development strategy as small differences in three-dimensional space are enough for an inhibitor to bind with variable affinity. Computed Atlas of Surface Topography of Proteins (CASTp) provided the predicted active site location within PfP43. The amino acid&#xA0;residues which make the active site pocket are coloured in green and there 3D-space locations are highlighted both in ribbon and surface diagram (fig.4). The active site volume and area are 149 Ao and 176.9, good enough to accommodate one or two bases in case on nucleic acid and two or three amino acids in case of proteins.&#xD;
&#xD;
CONCLUSION&#xD;
To understand the mechanism of enzyme reaction or binding of two protein molecules, structural information play a Very critical role, and to get the structure of proteins using X-ray crystallography or NMR or Electron microscopy is very expensive and time consuming process. Thereby, we adopted relatively cheap and fast method of solving three-dimensional structure using molecular modeling. Homology modeling of PfP43 provided the much needed structural information required to understand involvement of this protein in many biological processes. For example, occurrence of highly negative patches on one side of protein led us to speculate the tRNA binding region which is necessary for the function of transport of tRNA molecules out of the nucleus as well as for the stable formation of multi-synthetases complex. Note only that, remaining area of protein in three-dimensional space with variable charge distribution might be responsible for binding to other cellular factors engaged in apoptosis or inflammatory pathways. In the end, structural differences between PfP43and human counterparts might pave the way for in-silico screening which might lead to malaria specific drug like molecules discovery.&#xD;
&#xD;
ACKNOWLEDGEMENT &#xD;
I would like to thank Central University of Rajasthan, Department of Biotechnology for providing resources to conduct these studies. I also thank Deepti Joshi for her help in performing homology modeling. Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1844</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1844</Fulltext></URLs><References>1. Smith JD, Chitnis, CE, Craig AG, Roberts DJ, Hudson-Taylor DE, Peterson S, Pinches R, Newbold CI and Miller LH. Switches in expression of Plasmodium falciparum var genes correlate with changes in antigenic and cytoadherent phenotypes of infected erythrocytes. Cell, 1995, 82:101&#x2013;110.&#xD;
&#xD;
2. Florens L, Liu X, Wang Y, Yang S, Schwartz O, Peglar M, Carucci DJ, Yates JR, 3rd, and Wub Y. Proteomics approach reveals novel proteins on the surface of malaria-infected erythrocytes. Mol. Biochem. Parasito 2004, l135:1&#x2013;11.&#xD;
&#xD;
3. Gazzinelli RT, and Denkers EY. Protozoan encounters with Toll-like receptor signalling pathways: implications for host parasitism. Nat. Rev. Immunol. 2006, 6:895&#x2013;906.&#xD;
&#xD;
4. Jangpatarapongsa K, Chootong P, Sattabongkot J, Chotivanich K, Sirichaisinthop J, Tungpradabkul S, Hisaeda H, Troye-Blomberg M, Cui L, and Udomsangpetch R. Plasmodium vivax parasites alter the balance of myeloid and plasmacytoid dendritic cells and the induction of regulatory T cells. Eur. J. Immunol. 2008, 38:2697&#x2013;2705.&#xD;
&#xD;
5. Kerjan P, Cerini C, Semeriva M, Mirande M. The multienzyme complex containing nine aminoacyl-tRNA synthetases is ubiquitous from Drosophila to mammals. Biochem Biophys Acta 1994, 1199:293-297.&#xD;
&#xD;
6. Han JM, et al. Aminoacyl-tRNA synthetase interacting multifunctional protein 1/p43 controls endoplasmic reticulum retention of&#xA0;heat shock protein gp96: Its pathological implications in lupus-like autoimmune diseases. Am J Pathol 2007, 170:2042&#x2013;2054.&#xD;
&#xD;
7. Liu B, et al. Cell surface expression of an endoplasmic reticulum resident heat shock protein gp96 triggers MyD88-dependent systemic autoimmune diseases. Proc Natl Acad Sci USA 2003, 100:15824&#x2013;15829.&#xD;
&#xD;
8. Park SG, et al. Dose-dependent biphasic activity of tRNA synthetase-associating factor, p43, in angiogenesis. J Biol Chem 2002, 277:45243&#x2013;45248.&#xD;
&#xD;
9. Lee YS, et al. Antitumor activity of the novel human cytokine AIMP1 in an in vivo tumor model. Mol Cells 2006, 21:213&#x2013;217.&#xD;
&#xD;
10. Ko HS, et al. Accumulation of the authentic parkin substrate aminoacyl-tRNA synthetase cofactor, p38/JTV-1, leads to catecholaminergic cell death. J Neurosci 2005, 25:7968&#x2013;7978.&#xD;
&#xD;
11. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC and Ferrin TE. UCSF Chimera - A Visualization System for Exploratory Research and Analysis, J Comput Chem. 2004, 25:1605- 1612.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>COMPARATIVE MICROBIOLOGIC ANALYSIS OF SUBGINGIVAL PLAQUE SAMPLES IN TYPE II DIABETIC AND NON - DIABETIC PATIENTS WITH CHRONIC PERIODONTITIS BY POLYMERASE CHAIN REACTION&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>55</FirstPage><LastPage>62</LastPage><AuthorList><Author>Mythireyi D</Author><AuthorLanguage>English</AuthorLanguage><Author> M G Krishnababa</Author><AuthorLanguage>English</AuthorLanguage><Author> Kalaivani</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background: Although Immuno inflammatory relationship between periodontal diseases and diabetes mellitus is acknowledged, the difference in putative periodontal microorganisms between diabetic and non diabetic individuals is not well established. Aim: To compare the prevalence of two putative periodontal pathogens namely Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis in Type II Diabetic and Non Diabetic patients with chronic periodontitis by Polymerase chain reaction Materials and Method: Sixty subjects were selected from the Department of Periodontics, Tamilnadu Government Dental College and Hospital, Chennai &#x2013; 03. 30 Type II diabetic patients with chronic periodontitis were categorized as Group I and 30 Non diabetic patients with chronic periodontitis were categorized as Group II based on American Dental Association classification 1997 and American Academy of Periodontology classification 1999. Two sites- 1 healthy site and 1 diseased site were chosen in each patient, Group I H, II H &#x2013; healthy site samples and Group I D, II D- diseased sites samples. Subgingival plaque was collected, DNA isolation was done &amp; the presence of A.actinomycetemcomitans &amp; P.gingivalis DNA was determined by PCR. The PCR products were sequenced and confirmed. The data was statistically analysed. Results: A.actinomycetemcomitans was detected in 6.7 %, 6.7%, 13.3%, 10% in Groups I H, II H, I D, II D respectively. P.gingivalis was detected in 40%, 46.7%, 46.6%, 53.3% in Groups I H, II H, I D, II D respectively. When comparisons were made between Groups I H &amp; II H and Groups I D &amp; II D for the two organisms, no statistically significant difference was obtained Conclusion: The present study shows no statistically significant difference in the prevalence of A.actinomycetemcomitans and P.gingivalis in Type II Diabetic and Non Diabetic patients with chronic periodontitis.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Aggregatibacter actinomycetemcomitans, Porphorymonas gingivalis, Diabetes, Periodontitis, Polymerase chain reaction</Keywords><Fulltext>INTRODUCTION &#xD;
Chronic inflammatory periodontal disease (periodontitis) is primarily an anaerobic Gram negative oral infection that leads to gingival inflammation, destruction of periodontal tissues, loss of alveolar bone and eventual exfoliation of teeth in severe cases 11. Certain organisms within the microbial flora of dental plaque are the major etiological agents of periodontitis. Traditional thinking / paradigms have maintained that periodontitis is an oral disease&#xA0;&#xD;
&#xD;
and that the tissue destructive response remains localized within the periodontium. Whereas studies by Cohen DW et al 19704 , Mattila KJ et al 19898 have indicated that periodontitis may produce a number of alterations in systemic health. Diabetes mellitus is a metabolic disorder characterized by altered glucose tolerance or impaired lipid and carbohydrate metabolism 1 . It has been suggested that a positive correlation exists between diabetes and periodontal destruction based on the fact that loss of periodontal attachment occurs more frequently and more extensively in moderately and poorly controlled diabetic patients than those under good control. Diabetes mellitus influences prevalence and severity of periodontal disease. Although host immune inflammatory response plays an important role, it is the microflora that&#x2018;s proved to be the etiological agent in periodontitis&#xD;
&#xD;
AIM &#xD;
The aim of the present study was to compare the prevalence of two putative periodontal pathogens namely Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis in Type II Diabetic and Non Diabetic patients with Chronic periodontitis by Polymerase chain reaction.&#xD;
&#xD;
MATERIALS AND METHOD&#xD;
SUBJECT SELECTION&#xD;
Sixty subjects were screened and selected from the out patient Department of Periodontics, Tamilnadu Government Dental College and Hospital, Chennai &#x2013; 600 003. 30 Type II diabetic patients with chronic periodontitis were categorized as Group I (Study group) and 30 Non diabetic patients with chronic periodontitis patients were categorized as Group II (Control group). Within each group sub categorization was done as follows: Group I H - 30 Healthy sites of Type II Diabetic patients with chronic periodontitis Group I D - 30 Diseased sites of Type II Diabetic patients with chronic periodontitis Group II H - 30 Healthy sites of Non Diabetic patients with chronic periodontitis Group II D - 30 Diseased sites of Non Diabetic patients with chronic periodontitis The criteria for selection of patients with Type 2 Diabetes was based on American Diabetes Association classification (1997)1 and for Chronic periodontitis and Chronic periodontitis modified by Diabetes, the American Academy of Periodontology classification (1999)2 was utilized.&#xD;
&#xD;
INCLUSION CRITERIA&#xD;
Age 30 &#x2013; 60 yrs, Either sex, At least 3 sites with PPD 7 mm, CAL &gt;1mm, At least 2 sites with PPD &#x2264; 3mm, Type 2 Diabetic patients (Group I), Systemically healthy individuals (Group II)&#xD;
&#xD;
EXCLUSION CRITERIA &#xD;
Patients with systemic disease other than Type 2 diabetes(Group I), Patients with systemic disease (Group II), Antibiotic therapy for the past 6 months, Smokers, Periodontal therapy for the past 1 year&#xD;
&#xD;
Following Institutional Ethical Committee Approval, selection of subjects was done. Informed consent was obtained and a thorough medical and dental history was taken. Intra-oral examination was done using mouth mirror and William&#x2018;s periodontal probe. Periodontal evaluation was done by measuring the Plaque Index, the Gingival Bleeding Index, Probing Pocket depth( PPD) and Clinical Attachment level(CAL).&#xD;
&#xD;
Collection of subgingival plaque sample and polymerase chain reaction&#xD;
Two plaque samples were taken from the most diseased site and a healthy site from each patient with individual sterile Gracey curettes. The plaque was dislodged into a vial containing&#xA0;200 l of sterile lysis solution (10mm tris, 1.0 mm EDTA , 1.0% Tris X &#x2013; 100, pH 78), sealed and stored at -20oC. Subgingival plaque samples was boiled for 10min, cooled to room temperature, centrifuged at 10,000 rpm for 3 min and the supernatant was stored at -20&#xBA;C till assay. 10&#xB5;l of the supernatant was directly used as template in PCR.&#xD;
&#xD;
Primers utilized in this study&#xD;
Aggregatibacter actinomycetemcomitans (Aa) &#xD;
Forward primer : 5&#x2018; CAGCAAGCTGCACAGTTGCAAA &#x2013; 3&#x2018; Reverse primer : 5&#x2018; CATTAGTTAATGCCGGGCCG TCT &#x2013; 3&#x2018;&#xD;
&#xD;
(Kraig E et al / Infect Immun 1900, 58 : 920 &#x2013; 929)&#xD;
Porphyromonas gingivalis (Pg) &#xD;
Forward primer : 5&#x2018; ATAATGGAGAACGCAGG AA -3 Reverse primer : 5&#x2018; - TCTTGCCAACCAGTTCCA TTGC &#x2013; 3&#x2018;&#xD;
&#xD;
(Dickinson et al / J Bacteriol 1998 ; 170 ; 1658 &#x2013; 1665)&#xD;
10 &#xB5;l of the PCR master mixture was pipette into micro centrifuge tubes. 1.0 l of forward primer, 1.0 l of reverse primer, 3.0 l of template DNA and 5.0 l of nuclease free water was added and mixed thoroughly. The micro centrifuge tubes were placed in thermocycler and cycling conditions were set. PCR was performed for 35 cycles of Denaturation at 95oC for 1 min, Primer Annealing at 55oC for 30 sec, Primary extension at 72oC for 1 min, Final extension was 72oC for 10 min. The PCR product was detected by 2% Agarose gel electrophoresis. After the completion of the electrophoresis, gel was taken to the transilluminator and observed under UV-light. (Biorad gel documentation) The PCR product of 238 bp A.actinomycetemcomitans and131 bp P.gingivalis were given to MWG &#x2013;&#xD;
&#xD;
BIOTECH, GERMANY for sequencing the PCR products by automated DNA sequencer. The data was collected and statistically analyzed.&#xD;
&#xD;
STATISTICAL ANALYSIS&#xD;
Pearson&#x2018;s chi square test was used to calculate the overall p value The statistical package SPSS V18 (Statistical Package for Social Science, Version 18) was used for statistical analysis. In the present study, &lt; 0.05 was considered as the level of significance.&#xD;
&#xD;
RESULTS&#xD;
In the present study A.actinomycetemcomintans was detected in 6.7% Type II diabetic patients with chronic periodontits -healthy sites (2 out of 30 healthy sites), 13.3% Type II diabetic patients with chronic periodontits -diseased sites(4 out of 30 diseased sites), 6.7% Non diabetic patients with chronic periodontits - healthy sites (2 out of 30 healthy sites) and10.0% Non diabetic patients with chronic periodontits -diseased sites(3 out of 30 diseased sites). In the present study P.gingivalis was detected in 40% Type II diabetic patients with chronic periodontits - healthy sites (12 out of 30 healthy sites, 46.6% Type II diabetic patients with chronic periodontits -diseased sites( 14 out of 30 diseased sites), 46.7% Non diabetic patients with chronic periodontits - healthy sites(14 out of 30 healthy sites) and 53.3% Non diabetic patients with chronic periodontits -diseased sites (16 out of 30 diseased sites DISCUSSION The clinical parameters used in this study were Gingival Bleeding Index, Plaque Index, Probing Pocket Depth and Clinical Attachment level similar to the study by Yuan K et al 200113. Earlier studies employed curettes or paper points for subgingival plaque collection. Sampling by paper point is less invasive than by curette but may result in an underestimation of tightly&#xA0;adherent bacteria in subgingival sites5, 12.Hence in this study curettes were used for sample collection. Although various diagnostic techniques are available to analyse the microbial population of subgingival plaque, PCR technique was opted as it can detect organisms of less than 100 cells3 . In the present study, PCR procedure followed by Yuan et al 200113 was used. Mandel et al 19907 detected 7% A.actinomycetemcomitans, 13% P. gingivalis in diseased sites of NIDDM patients by culture. Zambon et al 198813 employed culture and ELISA assays and detected P.gingivalis in 75% NIDDM subjects. In the present study, 13.3% and 46.6% diseased sites in Type II Diabetic patients with chronic periodontitis and 10.0% and 53.3% of diseased sites in Non Diabetic patients with chronic periodontitis were positive for A.actinomycetemcomitans and P.gingivalis respectively. Our microbiological data revealed higher detection rates when compared with the results of others (except Zambon et al). This may be due to the higher sensitivity of PCR, PCR is more sensitive than culture, immunofluroesence and DNA probes for which sensitivities are 2 x 102 , 2 x 105 , 2 x 104 , 2 x 103 respectively6,14. In a PCR study by Yuan et al 200113, 6.7% and 64.8% of diseased sites in Type II diabetic subjects and 5.7% and 66.7% of diseased sites in Non diabetic patients were positive for A.actinomycetemcomitans and P.gingivalis respectively. The discrepancy in results, may be because a large sample size of 150 patients was chosen by Yuan et al 200113 when compared to the small sample of 30 patients chosen in this study. Also, different authors have analyzed the microorganism distribution in different population and races. When comparing the prevalence rates of A.actinomycetemcomitans and P.gingivalis, the results in our study showed a lower detection rate for A.actinomycetemcomitans which is in concurrent to the study by Yuan K et al 200113 . This may be explained by the conclusion drawn from the studies by Rhodenburg JP et al 19909 , Slots J et al 199010 that the prevalence of A.actinomycetemcomitans was age related and decreased with increasing age. A.actinomycetemcomintans is more responsible for aggressive periodontitis whereas P.gingivalis contributes to chronic periodontitis. Since our subjects were all adults beyond 30 years of age, it is speculated that the contribution of A.actinomycetemcomitans to the periodontitis we examined was minimal. There was no statistically significant difference in the detection rates of the 2 tested microorganisms The plausible reasons are 1) There was no difference in the contribution of the microbiological pathogens in patients with Type II diabetic patients with chronic periodontitis and in Non diabetic patients with chronic periodontitis. 2) The PCR assay is limited in the ability to differentiate large or small amounts of the same pathogen. 3) Other microflora rather than our targeted microorganism such as P.intermedia, C.rectus and Capnocytophaga species (since they are also regarded as important pathogen in periodontitis of NIDDM patients13 )could be an etiological agent in Type II diabetic patients with chronic periodontitis and Non diabetic patients with chronic periodontitis.&#xD;
&#xD;
CONCLUSION&#xD;
The search for the etiologic agent of periodontal diseases has been in progress for over a century. In this study it was found that the composition periodontal microflora in periodontal disease sites of Type II diabetic patients with chronic periodontitis was similar to that found in non diabetic patients with chronic periodontitis.&#xD;
&#xD;
However, the significantly higher detection rate of P.gingivalis in diseased sites further confirms the possible pathogenic role of this bacteria for both groups studied. A.actinomycetemcomintans may not be a causative pathogen in Type II diabetic patients with chronic periodontitis and non diabetic patients with chronic periodontitis. Also, PCR assay provides only a binary results i.e it detects the presence/absence of the microorganism and cannot differentiate positive result s quantitatively. Therefore the difference may exist in the quantitative composition of periodontal microorganism present in Type II diabetic patients with chronic periodontitis and non diabetic patients with chronic periodontitis. Hence further studies with a large sample size and diagnostic technique to quantitatively analyse the composition of microorganisms may be needed.&#xD;
&#xD;
ACKNOWLEDGEMENT&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1845</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1845</Fulltext></URLs><References>1. American Diabetes Association . Report of the Expert Committee on the Diagnosis and Classification of Diabetes mellitus Diabetes Care 2001: 24 (Suppl 1 ) S5 &#x2013;S20&#xD;
&#xD;
2. Armitage GC: Periodontal diagnosis and classification of periodontal diseases Periodontology 2000 :2004; 34;9 -21&#xD;
&#xD;
3. Ashimoto A, I Bakker I Slots : Polymerase chain reaction detection of 8 putative periodontal pathogens in subgingival plaque of gingivitis and advanced periodontitis lesions. Oral Microbiol Immunol 1996; 11;266 -273&#xD;
&#xD;
4. Cohen DW, Friedman LA, Shapiro J, Kyle GC, Franklin S Diabetes mellitus and periodontal disease Two year longitudinal observations Part I J Periodontol 1970 , 41; 709 -712&#xD;
&#xD;
5. Hartroth B, Jeyfabrt I, Comado G Sampling of periodontal pathogens by paper points : Evaluation of basic parameters Oral Microbiol Immunol 1999; 14; 326 -330&#xD;
&#xD;
6. Maiden MFJ, Tanner A, Mc Ardle S, Nagpauer K, Goodson JM Tetracycline fibre therapy monitored by DNA probe and culture methods J Periodont Res 1991 ;26;452-459&#xD;
&#xD;
7. Mandell RL, Dirienzo T, Kent R, Joshipura K,Haber J Microbiology of healthy and diseased periodontitis sites in poorly controlled insulin dependant diabetes J Periodontol 1992;63; 274- 279&#xD;
&#xD;
8. Mattila KJ, Nieminen MS, Valtonen W, Rasi VP, Kesaniemi YA, Syrjala SL Association between dental health and myocardial infarction BMJ 1989 ;298;779- 782&#xD;
&#xD;
9. Rodenburg JP, Van Winkelhoff AJ, Winkel EG, Goene RJ, Abbas F, de Graff J Occurrence of Bacteroides gingivalis, Bacteroides intermedius and Actinobacillus actinomycetemcomitans in severe periodontitis in relation to age and treatment history J Clin Periodontol 1990; 17; 392-399&#xD;
&#xD;
10. Slots J, Feik D, Rams JE Actinobacillus actinomycetemcomitans and Bacteroides intermedius in human periodontitis Age relationship and mutual association J Clin Periodontol 1990; 17;659 -662&#xD;
&#xD;
11. Socransky SS and Haffajee AD The bacterial etiology of destructive periodontal disease current concepts J Periodontol 1992;63;4;322-331&#xD;
&#xD;
12. TannerAC, Goodson JM Sampling of microorganisms associated with periodontal disease Oral Microbiol Immunol 1986; 1; 15 -22&#xD;
&#xD;
13. Yuan K, Chang CJ, Hsu pc, Sun HS, Tseng CC, Wang Jr Detection of putative periodontal pathogens in non insulin dependant diabetes mellitus and diabetes mellitus by Polymerase chain reaction Periodont Res 2001; 36;18-24&#xD;
&#xD;
14. Zappa u, Reinking &#x2013; Zappa M ,Graf H, Comparison of serological and DNA probe analysis for detection of suspected periodontal pathogens in subgingival plaque samples Arch Oral Biol 1990; 35;161-164.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>EXPERIMENTAL BEHAVIOUR OF A PYRAMID TYPE SOLAR STILL COUPLED AND DECOUPLED TO AN ELECTRICAL TEMPERATURE CONTROLLER&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>63</FirstPage><LastPage>76</LastPage><AuthorList><Author>S.Kalaivani</Author><AuthorLanguage>English</AuthorLanguage><Author> S.Rugmini Radhakrishnan</Author><AuthorLanguage>English</AuthorLanguage><Author> B.Selvakumar</Author><AuthorLanguage>English</AuthorLanguage><Author> M.Indhumathy</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>In this communication, an experimental investigation of the behaviour of a pyramid type solar still coupled and decoupled to an electrical temperature controller unit has been presented. The main advantage of the pyramid type solar still is that the maximum radiation can penetrate inside the basin from electrical temperature controller. The main objective oh this present paper is to study the behaviour of the still performance with and without of electrical temperature by analyzing the internal and external heat transfer co-efficient.In general the still performance is reasonable with a good daily output including nocturnal output. The addition of electrical temperature controller where capable of enhancing the productivity with heat retention causing continued evaporation&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Solar still, water collection, and temperature controller.</Keywords><Fulltext>INTRODUCTION &#xD;
Mahmoud I.M. Shatat and K. Mahkamov (2010) described the performance of a multi stage water desalination still connected to a heat pipe evacuated tube solar collector with aperture area of 1.7 m&#xB2;. The multi stage solar still water desalination system was designed to recover latent heat from evaporation and condensation processes in four stages. V.K. Dwivedi et al., (2008) has made an attempt to evaluate the internal heat transfer coefficients of single and double slope passive solar stills in summer as well as winter climatic conditions for three different water depths (0.01, 0.02, and 0.03 m) by various thermal modes. The experimental validation of distillate yield using different thermal models was carried out for composite climate of New Delhi, India (latitude 28&#xBA;35&#x2018; N, longitude 77 &#xBA;12&#x2018;E). By comparing theoretical values of hourly yield with experimental data it has been observed that Dunkle&#x2018;s model gives better agreement between theoretical and experimental results. Dunkle&#x2018;s model has been used to evaluate the internal heat transfer coefficient for both single and double slope passive solar stills. With the increase in water depth from 0.01 m to 0.03 m there was\a marginal variations in the values of convective heat transfer coefficients. It was also observed that on annual basis output of a single slope solar still is better as compared with double slope solar still. M.K. Phadatare et al., (2007) made an attempt to study the effect of water depth on the internal heat and mass transfer in a single basin single slope plastic solar still. The experimental still was fabricated from Plexiglas. The bottom and&#xA0;ll sided of the still are made from a sheet of black Plexiglas. The cover is made from a transparent Plexiglas of the same thickness. The solar still was sealed to reduce the leakage of vapour to the surroundings. The study covers the influence of different environmental and operational parameters on the still productivity. The operational parameter such as depth of water in the basin is varied from 2 cm to 12 cm to find out its influence on internal heat and mass transfer and hence the productivity of the still. The maximum distillate output of 2.1 L/m2 /day was obtained with water depth in still basin 2 cm. The maximum efficiency of the experimental still varied from 10% to 34%. The results indicated that with increase in depth of basin water, still productivity decreases Salah Abdallah et al., (2007) developed an experiment work to improve the single slope solar still performance through increasing the production rate of distilled water. Design modifications were introduced to the conventional solar still, involving the installation of reflecting mirrors on all interior sides, replacing the flat basin by step-wise basin, and by coupling the conventional solar still with a sun tracking system. The inclusion of internal mirrors improved the system thermal performance up to 30%, while step-wise basin enhanced the performance up to 180% and finally the coupling of the step-wise basin with sun tracking system gave the highest thermal performance with an average of 380%. The accumulated production of the deep-basin solar still and that of the tilted tray solar still with longitudinal baffles are compared by Badawi W.Tleimat et al., (2003). The comparisons show that evaporation in the deep basin still continues during the entire 24 hour period while the tilted tray still ceases to produce a relatively short time after sunset. Thus nocturnal production is maximum for the deep basin type and nearly zero for the tilted tray still is studied. A small experimental still was constructed to determine the factors affecting the nocturnal production of solar stills. The experimental results indicate that a substantial increase of product water could be obtained from the continuous addition of warm water to the still. This increase was found to be a function of flow rate, feed-water temperature, evaporating and condensing areas and ambient temperature. Nikola Nijegorodor et al., (2003) described two solar thermal &#x2013;electrical methods to purify water by distillation. In this first method air saturated with water vapour is removed from a basin type still by using a low power exhaust fan, and is passed through a condenser where the latent heat of water vapour is used to pre heat the mineralized water for the basin. This also results in lower temperature for the glazing and a faster rate of evaporation from the basin. The net effect in an increased thermal efficiency of the still more than twice the thermal efficiency of the conventional still. In the second design a condenser collector is used to boil water in the absorber tube. A low power vacuum pump is employed to lower the boiling temperature of water by about 10&#xBA;c. The yield of distillate from the still is nearly double. M.Boukar and A. Harmim (2001) has studied the effect of desert climatic conditions on the performance of a simple basin solar still and a similar one coupled to a flat plate collector. A three months round study showed that the productivity of the simple basin and similar coupled to a flat plate solar collector strongly depends on the solar radiation and ambient temperature The effect of intermittent flow of waste hot water in the basin of solar stills on its performance has been discussed by Madhuri et al., (2001) as well as the effect of various parameters- duration of flow of hot water, flow rate and water depth. It is concluded that for&#xA0;higher yield, the waste hot water should be fed into the basin during off-sunshine hours. The results have also been compared with those of Tiwari and Malik and sodha et al. A single basin solar still with basin area of 0.98*0.98 m was constructed from galvanized iron sheets and an inclined glass cover. The still was provided with 525 W electrical heating tapes, fixed under the still for indoor steady state operation. The variations of basin temperature and evaporation rate were measured during both indoor and outdoor operation. Transient analysis of the still requires the evaluation of evaporative, convective and radiative heat transfer coefficients. The Dunkle model, which has been widely used for the prediction of the evaporative coefficient, was found to be over predicting evaporation rates. The models developed in this work were found to provide better prediction for the evaporation rate measured in this work and this work was investigated by Ahmad Taleb Shawaqfeh et al., (2000). A techno-economic analysis of multi-stage stacked tray (MSST) solar still coupled with a solar collector through a heat exchanger has been developed by R.S. Adhikari et al., (2000). The study also includes a discussion on the sensitivity of cost of unit mass of distilled water in references to the useful life of distillation chamber, cost of solar collector and other associated parameters. Faten H. Fahmy et al., (1998) has presented a new way to realize continuous operation of a solar desalination system to produce fresh water using solar energy for a dual purpose. To realize the continuity of still operation daily and overnight, the batteries are discharged during the night at a suitable rate to feed an electric heater. The electric heater is designed to generate the required heat for desalination during the night. This modified still is provided with a packed bed layer installed in the bottom of the basin to assist the system during the day and at night, i.e., this modified still will be more efficient. The use of PV and packed bed systems means higher efficiency than the passive still, as the modified still produces large quantities of fresh water in August for a saline water depth of 0.01 m by using glass wool insulation 0.05 m thick and glass spheres as a packed bed with 0.0213 m bed length. Multiple linear regression equations relating to ambient, air temperature, wind speed and solar radiation were developed by A.N. Minasian et al., (1992) to estimate the productivity of a still. The study shows that condensation process inside the stills is achieved during the period between sunset and sunrise. Results reveal that the average wall&#x2018;s contribution in supplying fresh water is about 56%, whereas base contribution is about 31%. It is concluded, therefore, that setting many stills on a number of separated holes will give higher output rather than setting a single still on one large hole of the same volume. H.M. Ali (1991) has been studied a mathematical model to predict the performance of the solar still using forced convection inside the solar still to enhance the productivity of the still. It shows that the productivity increases about 60% more than that of a natural convection solar still. Good agreement between the theoretical and experimental results is obtained. Enhancing mass transfer co-efficient due to forced convection has a major role in the productivity enhancements. S.A. Lawrence and G.N.Tiwari (1991) have been studied the thermal modeling based on heat and mass transfer relations of a green house integrated with a solar still. An experiment was carried out for a typical greenhouse in Port Moresby. The following observations were made. (i) There is a reasonable agreement between theoretical and experimental results and (ii) the amount of distilled water obtained is sufficient to grow the plants&#x2018; inside the greenhouse.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
2. Construction details for both pyramid solar still and temperature controller Pyramid solar still of base area 0.85m x 0.85m is designed. The still is filled with the water to a height of 0.05m. Top of the system is covered by a 3 mm transparent glass pyramid cover with a height of 0.30m at the middle. It is air tightened using the cushion supports at the interface between the top cover and the sides of sliding support for uniform landing. Bottom of the still is insulated using sawdust, while the side is insulated with glass wool. The specification of different parts of the still is given below.&#xD;
&#xD;
&#xD;
&#xD;
2.1 CONSTRUCTION OF ELECTRICAL TEMPERATURE CONTROLLER &#xD;
Electrical backup made up of Temperature controller, Heater coil and Thermocouple. Temperature controller has various plug-in from number 1 to number 20. For temperature controller setting plug-in 1, 2, N1, C, N0, 12 and 13 are used. Temperature of the controller unit can be kept at any temperature by using set key function (4 digit display), which has two buttons to increase and decrease the temperature. Connections from plug-in 2 and C are interconnected and used as one end of input power supply. Pug-in 1 is used as another end of power supply input. Also a connection is taken from Plug-in 1 and it is connected to one end of the coil. Plug-in N0 is connected to another end of coil. Pluginn&#x2018;s 12 and 13 are connected to thermocouples. Heater coil is made up of stainless steel and is placed inside the solar still. Sensor thermocouple should be placed near to the heater coil. Schematic representation of electrical backup circuit with temperature controller is shown in Fig (3.2).&#xD;
&#xD;
&#xD;
&#xD;
The physical and chemical analysis for the tap water and distilled water were made at the Regional Laboratory of Tamil Nadu Water Board (TNWB), Coimbatore. The samples were tested for colour, turbidity, total dissolved solids, electrical conductivity, pH, alkalinity chloride, fluoride, sulphate, phosphate and the results are tabulated in the tables (3.17-3.18)&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
3.4 Techno &#x2013; Economic Analysis The simple techno &#x2013; economic analysis (Tiwari and Yadav, 1987) of the effectiveness of solar distillation systems considers the capital cost of the system ?P&#x2018; and the rate of capital recovery ?C&#x2018;. The first annual cost of the system A can be determined by the following formula.&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
The distillate output yield for both solar radiation utilizing solar still and still with electrical temperature controller is more or less same. But the Cost of the solar still utilizing electricity for evaporation is 15 times greater than that of the solar still with the use of solar radiation. This analysis shows that solar still which is exposed to solar energy is highly economical and profitable. Graphical Analysis The graphs are plotted between the various observed parameters such as solar insolation, efficiency, distillate output, temperature profiles of various junctions etc, during selected sunny days of experimentations.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
Fig (4.1) shows the variation of temperature profiles with time, still decoupled with electrical thermal controller. The cover temperature of the still increases as the day progresses because of the increased evaporation of water from basin and consequent condensation of water vapour at the bottom surface of the top cover. Ambient temperature variation depends on atmospheric condition. The temperature of water and glass cover increases in the morning hours to maximum values around noon time before they start to decrease late in the afternoon. This is due to the increase of solar insolation in the morning and the decrease in the afternoon. Distillate output with respect to time increases in the morning and then decreases in the afternoon because of varying solar insolation. It is found out in the Fig (4.2) The variation of insolation with respect to time shown in the Figure (4.3) it increased linearly with time and reached the maximum value from 12 noon to 2 p.m. and then decreased. Radiation received during this study is in the range of 0 to 1200 W/m2 The variation of the average efficiency with respect to no. of days is drawn in Figure (4.4) Average efficiency is varied according to solar insolation and water collection for different days. Figure (4.5) shows the variation of the average insolation with respect to no. of days. Average insolation is varying for different days. The water temperature and distillate output with respect to time decoupled with electrical thermal controller is shown in fig (4.6). Water Temperature and the distillate yield increases in the morning hours and starts to decrease late in the afternoon because of decrease in solar insolation Figure (4.7) shows the variation of temperature profile and distillate output with respect to time decoupled with electrical thermal controller. Temperature and the distillate yield increases in the morning hours and starts to decrease late in the afternoon because of decrease in solar insolation. Figure (4.8) shows the histogram for water temperature with respect to distillate output for the Pyramid still decoupled with electrical thermal controller. Figure (4.9), (4.10), (4.11) shows the histogram for water temperature with respect to distillate output for the Pyramid still coupled with electrical thermal controller. The histogram for water temperature with respect to distillate output for the Pyramid still decoupled and coupled with electrical thermal controller is found out Table (3.15) .This shows that both studies give approximately distillate output for corresponding temperatures. In general Still performance which is decoupled with electrical thermal controller is reasonable with a good daily output. The still coupled with electrical thermal controller is cost effective, even though it gives daily output similar to the conventional still. CONCLUSION Solar still with pyramid cover is investigated for its performance in this study for a number of days. Temperature profiles of water, ambient, cover, air, absorbent, amount of distillate output including nocturnal output were observed. The performance of the still with and without electrical thermal controller is analyzed, for augmenting the productivity. The instantaneous and daily efficiency were calculated. Heat transfer coefficients were computed. Numerical calculations are carried out for comparing the observed values of heat transference with theoretical values. Techno economic analysis is estimated for the system reliability. The quality of distilled water yield is examined by a physical and chemical properties test carried out on a collected sample of water in the Regional&#xA0;Laboratory, Tamilnadu Water Supply and Drainage Board, Coimbatore.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1846</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1846</Fulltext></URLs><References>1. Dwivedi V.K. Tiwari G.N. (2008), Comparison of internal heat transfer coefficients in passive solar stills by different thermal modes: An experimental validation , Desalination, Vol. 246, Issue. 1- 3, Pp 304-318&#xD;
&#xD;
2. Phadatare M.K. and verma S.K.(2007), Influence of water depth on internal heat and mass transfer in a plastic solar still, Desalination, Vol. 217, Issue.1-3, Pp 267- 275&#xD;
&#xD;
3. Salah Abdallah, Omar Badran and Mazen M. Abu-Khader(2007), Performance of a modified design of single slope solar still, Desalination, Vol. 219, Issue 1-3, Pp 222- 230&#xD;
&#xD;
4. Badawi W. Tleimat and Everett D. Howe (2003), Nocturnal production of solar distillers, Solar Energy, Vol.10, Issue. 2, Pp. 61-66&#xD;
&#xD;
5. Nikolai Nijegorodov, Pushpendra K. Jain and Stig Carlsson (2003), Thermalelectrical, high efficiency solar stills, Renewable Energy Vol. 4, Issue 1, Pages123-127&#xD;
&#xD;
6. Boukar M and Harmim A. (2001), Effect of climatic conditions on the performance of a simple basin solar still: a complete study, Desalination, Vol. 137, Issue. 1-3, Pp. 15-22&#xD;
&#xD;
7. Madhuri and Tiwari G.N.( 2001), Performance of solar still with intermittent flow of waste hot water in the basin, Desalination, Vol. 52, Issue 3, Pp. 345-357&#xD;
&#xD;
8. Ahmad Taleb Shawaqfeh and Mohammed Mehdi Farid (2000). New development in the theory of heat and mass transfer in solar stills, Solar Energy Vol. 55, Issue 6, Pp. 527-535&#xD;
&#xD;
9. Adhikari R.S. Ashvini kumar and Grag H.P. (2000) ,Techno- economic analysis of a multi- stage stracked tray(MSST) solar still, Desalination, Vol. 127, Issue.1-1, Pp 19-26&#xD;
&#xD;
10. Faten H. Fahmy (1998), Efficient Design of Desalination System Using Photovoltaic and Packed Bed Systems , Energy Sources, Part A: Recovery, Utilization, and Environmental Effects, Vol. 20, Issue 7 , Pp 615 &#x2013; 629&#xD;
&#xD;
11. Minasian A.N., Al-Karaghouli A.A., Hasan M. and Shakir A. (1992), Utilization of solar earth waterstills for desalination for ground water, Energy conversion management, Vol. 49, Issue 2, Pp 107-110&#xD;
&#xD;
12. Ali H.M. (1991), Mathematical model of the solar still performance using forced convection with condensation process outside the still, Energy conversion management, Vol. 1, Issue 5/6, Pp. 709-712&#xD;
&#xD;
13. Lawerence S.A. and Tiwari G.N. (1991), performance of a green house cum solar still for the climatic condition of Port Moresby, Energy conversion management, Vol. 1, Issue. 2, Pp. 249-255&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>GEOMAGNETIC STORMS ASSOCIATED WITH IV-RADIO BURSTS AND THEIR RELATION WITH SOLAR AND INTERPLANETARY PARAMETERS&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>77</FirstPage><LastPage>84</LastPage><AuthorList><Author>P.L.Verma</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>I have studied geomagnetic storms (Dst ?-75nT), associated with Type IV radio bursts, observed during the period 1997 to 2007 with solar and interplanetary parameters. We have observed 33 geomagnetic storms associated with type IV radio bursts, out of which most of the geomagnetic storms (85.00%) are intense or sever geomagnetic storms. All the geomagnetic storms are found to be associated with halo and partial halo coronal mass ejections (CMEs).The association rates of halo and partial halo CMEs are 27 (81.82%) and 06 (18.18%) respectively .All the type IV radio bursts associated geomagnetic storms are found to be associated with X-ray solar flares of different categories .The association rates of geomagnetic storms with different types of flare related CMEs are found 08 (24.24)% X class flare&#xD;
related CMEs,15 ( 45.46% ) M class flare related CMEs ,08 (24.24 )% C class flare related CMEs and 02(6.06)% B class flare related CMEs. Some of the type IV radio bursts associated geomagnetic storms are found to be associated with magnetic clouds 13 (39.39 %).Majority of the geomagnetic storms are found to be related with interplanetary shocks 31 (93.94) .We have inferred that geomagnetic storms are closely related to interplanetary magnetic fields. We have determined positive co-relation with correlation coefficient 0.70 between magnitude of geomagnetic storms and maximum value of IMF and 0.77 between magnitude of geomagnetic storms and magnitude of maximum value of southward component of interplanetary magnetic fields (IMF Bz).&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Coronal mass ejections, X-ray solar flares, radio bursts, solar wind plasma parameters and geomagnetic storms.</Keywords><Fulltext>INTRODUCTION The solar disc exhibits a variety of drastic solar features, many of which have a direct influence on interplanetary space and earth&#x2018;s magnetosphere. Coronal mass ejections associated with solar flares, filaments, and type II and type IV radio burst are the most energetic solar features which derive solar wind disturbances and these disturbances cause geomagnetic disturbances at the earth. The recurrent storm activity is due to coronal holes that cause fast solar wind streams [1].Geomagnetic storms which are characterized by a prolonged period in which the horizontal component of geomagnetic field is depressed in the mid to low latitudes in the range of several tens to several hundred nT with such periods lasting from one-half to several days and are classified as recurrent (periodic) and non recurrent (sporadic). Recurrent geomagnetic&#xA0;storms occur most frequently in the declining phase of the solar cycle when equatoward extensions of the polar coronal holes are prominent [2, 3]. The non recurrent (sporadic) geomagnetic storms are caused by interplanetary disturbances driven by fast coronal mass ejections (CMEs) and typically involve an encounter with both interplanetary shock wave and the CME that drive it. Since the CME rate tracks the sun spot cycle [4], the non recurrent geomagnetic storms occur most frequently near solar maximum.Landi and Moreno et al (5) have investigated the role of the coronal mass ejections in producing non recurrent geomagnetic storms in period 1969-1974. They have concluded that coronal mass ejections associated with chromospheric flares, accompanied by type IV radio emission, are the most effective in perturbing the geomagnetic field. Webb et al (6) have studied geomagnetic storms with halo coronal mass ejections and concluded that halo coronal mass ejections are very much effective in producing geomagnetic storms.Yurchyshyn [7] have analyzed data for major geomagnetic storms and found a relationship between hourly averaged magnitude of the Bz component of IMF and projected speed of CMEs launched from the central part of the solar disk. They have concluded that CMEs with V&gt; 1000 Km/s are capable of furnishing. Lepping (8) has studied geomagnetic storms with southward directed magnetic field; they have determined that intense geomagnetic storms are caused by intense southward directed magnetic field. They have found high co-relation between Bz and Dst index. Zhag et al [9] have studied major geomagnetic storms for the period 1996-2000 with coronal mass ejections and concluded that 59% major geomagnetic storms are associated with front side halo (FSH) CMEs and 22% are associated with multiple FSH CMEs. The events which are associated with multiple FSH CMEs show complex solar wind flows and complex geomagnetic storms which are probably the result of halo CMEs interacting in interplanetary space. 15% events are found to be associated with partial halo gradual CMEs emerging from the east limb. Michalek, and Gopalswamy et al [10] have studied geomagnetic storms with properties of halo coronal mass ejections (H-CMEs) and concluded that only fast halo CMEs (with space velocity higher than 1000 km/s) an originating from the western hemisphere close to the solar centre could cause intense geomagnetic storms. Gopalswamy et al [11] have studied geoeffectiveness, speed, solar source, and flare association of a set of 378 halo coronal mass ejections (CMEs) of solar cycle 23 (1996-2005). They have compiled the minimum Dst values occurring within 1 - 5 days after the CME onset. They have compared the distribution of such Dst values for the subset of halo CMEs as disk halos, limb halos, and back side halos CMEs. Defining that a halo CME is geoeffective if it is followed Dst &lt; -50 nT, moderately geoeffective if -50nT &lt; Dst &lt; -100nT, and strongly geoeffective if Dst &lt; -100nT, they have found&#xA0;that the disk halos are followed by strong geomagnetic storms, limb halos are followed by moderate storms, and back side halos are not followed by significant storms.&#xD;
&#xD;
Experimental Data In this investigation hourly Dst indices of geomagnetic field have been used over the period 2003 through 2007 to determine onset time, maximum depression time, magnitude of geomagnetic storms. This data has been taken from the NSSDC omni web data system which been created in late 1994 for enhanced access to the near earth solar wind, magnetic field and plasma data of omni data set, which consists of one hour resolution near earth, solar wind magnetic field and plasma data, energetic proton&#xA0;fluxes and geomagnetic and solar activity indices. The data of coronal mass ejections (CMEs) have been taken from SOHO &#x2013; large angle spectrometric, coronagraph (SOHO / LASCO) and extreme ultraviolet imaging telescope (SOHO/EIT) data. To determine disturbances in interplanetary magnetic fields, hourly data of interplanetary magnetic field has been used and these data has also been taken from omni web data (http;//omniweb.gsfc.nasa.gov/form/dxi.html)). The data of X ray solar flares radio bursts, prominences and other solar data, solar geophysical data report U.S. Department of commerce, NOAA monthly issue and solar STP data (http://www.ngdc.noaa.gov/stp/solar/solardatase rvices.html.) have been used. The data of interplanetary shocks has taken from shocks arrival derived by WIND group from WIND observations, ACE list of transient and disturbances.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
DATA ANALYSIS AND RESULTS &#xD;
In this study I have observed 33 geomagnetic storms associated with type IV type radio bursts, occurred during the period 1997 to 2007.I have divided observed geomagnetic storms in three categories, geomagnetic storms Dst &#x2264;-75nT &gt;100 nT as moderate, Dst&#x2264;-100 nT &gt;200nT as intense and Dst&#x2264;-200 nT as severe .It is found that most of most of the type IV associated geomagnetic storms (85.00%) are intense or severe geomagnetic storms .I have 33 geomagnetic storms in list out of which 28 geomagnetic storms have been found to be associated with intense or severe geomagnetic storms .The association rates of moderate, intense and severe geomagnetic storms have been found 15.15%,60.60% and 24.25% respectively. From the data analysis of observed geomagnetic storms associated with type IV radio bursts and coronal mass ejections, all the geomagnetic storms associated with type IV radio bursts have been found to be associated with halo and partial halo coronal mass ejections and majority of them are halo coronal mass ejections. The association rates of halo and partial halo CMEs have been found 27(81.82%) and 06(18.18%) respectively .From the further analysis it is observed that ,CMEs which are associated with geomagnetic storms associated with type IV radio bursts are related with X-ray solar flares of different categories and majority of them are M class solar flares . The association rates of geomagnetic storms associated with type IV radio bursts with different types of flare related CMEs are found 08(24.24)% X class flare related CMEs,15( 45.46% ) M class flare related CMEs ,08(24.24 )% C class flare related CMEs and 02(6.06)% B class flare related CMEs respectively .The data analysis of observed geomagnetic storms associated with type IV radio bursts and magnetic clouds, some of the geomagnetic storms associated with type IV radio bursts have been found to be associated with excellent, good and poor quality magnetic clouds 13 (39.39 %). Majority of the geomagnetic storms associated with type IV radio bursts are found to be related with interplanetary shocks 31 (93.94) .From the data analysis of geomagnetic storms associated with type IV radio bursts and interplanetary magnetic&#xA0;field ,I have found that geomagnetic storms associated with type IV radio bursts are closely related to disturbances in interplanetary magnetic fields and southward component of interplanetary magnetic field. Further to see how the magnitude of geomagnetic storms associated with type IV radio bursts are correlated with the maximum values of Jimf events, a scatter diagram have been plotted between the magnitude of geomagnetic storms associated with type IV radio bursts and maximum value of Jimf events in fig.1.From the fig it is clear that maximum geomagnetic storms associated with type IV radio bursts which have large magnitude are associated with such Jimf events which have relatively large maximum value. I have determined positive co-relation between magnitude of geomagnetic storms associated with type IV radio bursts and maximum value of IMF with correlation coefficient 0.70 .Further to see how the magnitude of geomagnetic storms associated with type IV radio bursts are correlated with maximum value of Jimfbz events, a scatter diagram have been plotted between the magnitude of geomagnetic storms associated with type IV radio bursts and maximum value of Jimfbz events in fig.2. From the fig it is clear that maximum geomagnetic storms associated with type IV radio bursts which have large magnitude are associated with such Jimfbz events which have relatively large maximum values .Positive correlation with correlation coefficient 0.77 have also been found between and magnitude of geomagnetic storms associated with type IV radio bursts and maximum value of southward component (IMF Bz) .&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
CONCLUSION &#xD;
From our study, most of the radio bursts related geomagnetic storms have been identified as intense or severe geomagnetic storms and associated with coronal mass ejections (CMEs) related to different types of X ray solar flares. Majority of the geomagnetic storms associated with type IV radio bursts are found to be related with interplanetary shocks and some of them are found to be related with magnetic clouds. Large positive co-relation have been determined between magnitude of geomagnetic storms associated with type IV radio bursts and maximum value of IMF with correlation coefficient 0.70 and magnitude of geomagnetic storms associated with type IV radio bursts and magnitude of maximum value of southward component of IMF Bz with correlation coefficient 0.77.These results shows that geomagnetic storms associated with type IV radio burst are mainly caused by coronal mass ejections related with X- ray solar flares and related with X-ray solar flares and their interplanetary manifestations (interplanetary shocks and magnetic clouds).Further it is concluded that disturbances in interplanetary magnetic fields are closely related to geomagnetic storms associated with type IV radio bursts .&#xD;
&#xD;
ACKNOWLEDGEMENT &#xD;
The author would like to thank Prof. P.K Shukla, S.K.Nigam and B.P.Chandra for valuable suggestions. The author is grateful to&#xA0;OMNIWEB and SOHO data group whose data have been used in this study&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1847</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1847</Fulltext></URLs><References>1. Crooker N.U. and E.W. Cliver. J. Geophys. Res. 99 A12 23, 383, 1994.&#xD;
&#xD;
2. Webb D.F. Revs. Geophys, (Supply) 33, 577, 1995&#xD;
&#xD;
3. Y. Kamide J. Geophys. Res. V. 103, NO. A8 PP - 17705 - 17, 728, 1998&#xD;
&#xD;
4. Webb, D.F. and R.A. Howard. J. Geophys Res, 99, 4201, 1994.&#xD;
&#xD;
5. R. Landi and G. moreno J. Geophys. Res Vol. 103 No. A20, 553 &#x2013; 20 - 559 &#x2013; 1998.&#xD;
&#xD;
6. Webb, D.F. Cliver, E.W. Crooker N.U. J. Geophys Res. 105, 7491, 2000.&#xD;
&#xD;
7. V. Yurchyshyn, Astrophys. J., 614, 1054, 2004.&#xD;
&#xD;
8. Wu. C.C. and R.P. Lepping. J. Atm. Sol - Terr. Phys. 67, 283, 2005.&#xD;
&#xD;
9. G. Zhang K.P. Dere et al Astrophysical Journal, 582, 520 - 533, 2003&#xD;
&#xD;
10. Michalek, G. Gopalswamy, N. Lara, A : Yashiro, S Space. Weather, Volume 4, Issue 10th, citel ID S10003, 2006.&#xD;
&#xD;
11. N. Gopalswamy, S.Yashiro, S. Akiyama, J. Geophys. Res Vol. 112, A06112, dio : 1029/2006 JA 012149, 2007.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>PHYTOCHEMICALS ANALYSIS OF COLECUS AROMETICUS BENTH&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>85</FirstPage><LastPage>88</LastPage><AuthorList><Author>Iffat Khan</Author><AuthorLanguage>English</AuthorLanguage><Author> Kirti Jain</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Coleus aromaticus Benth. Of the family Lamiaceae is a large succulent aromatic herb used for flavoring drinks and medicine. The leaves are considered as carminative, digestive, anthelmintic and diuretic. The present study is dealt with the phytochemicals analysis of the leaf extracts. The leaf extracts with various solvents like petroleum ether extract, Ethanolic extract and Aqueous extract were prepared and both qualitative and quantitative tests for phytochemicals were done.It showed the presence of saponins,carbohydrates, tannins,flavonoids,proteins,triterpenoids in various quantities.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Colecus, Ethanolic , saponins, phytochemicals.</Keywords><Fulltext>INTRODUCATION &#xD;
About two and a half species of flowering plants belonging to 10,500 genera and about 300 families are found in nature .of these a number of genera are source of drugs. Many of the plant products are important therapeutic agents, which are represented by the various phytochemicals like saponins,carbohydrates, tannins,flavonoids, proteins, triterpenoids. The present study is concentrated on colecus arometicus Benth., belongs to family Lamiaceae.Although phytochemicals are not classified as nutrients, substances necessary for sustaining life, they have been identified as containing properties for aiding in disease prevention.phytochemical are associated with the prevention and treatment of at least four of the leading causes of death in the united statescancer,Diabetes,cardiovascular disease, and hypertensation. They are involved in many processes including one that helps prevent cell damage, prevent cancer cell replication, and decrease cholesterol levels.&#xD;
&#xD;
MATERIALS AND METHODS &#xD;
Suitable explants will be taken from the authenticated and identified plant taxonomist. The identified and authenticated species were collected quantity, dried and powdered for further studies. The phytochemicals present in the plant material was extracted by the distillation method using soxhlet apparatus. Different solvent, solvent systems were used for the sepration of chemicals according to the polarity (petroleum ether extract, Ethanolic extract, aqueous extract) about 650 g of plant tissue were weighed and shade dried for 10 days. The dried materials were powdered and 50g of powder sample was packed in a thimble and kept in soxhlet apparatus. Each of the solvent was taken&#xA0;separately for the extraction and the powdered material was siphoned by 3 times. The whole apparatus was kept over a heating mantle and was heated continuously for 8 hours at boiling ponit of each solvent. The extract was concentrated to dryness and the residues were transferred to a pre-weighed sample bottle and were stored in desiccators for further studies.&#xD;
&#xD;
"Phytochemicals screening of different plant extracts found by soxhlat method. in different media"&#xD;
Different biochemical parameters like, saponins,carbohydrates, tannins,flavonoids,proteins,triterpenoids. 1. Test for flvonoids =Take 1 ml of the extract and add few magnesium turnings, followed by the addition of conc.HCL drop. Development of pink colour indicates the presence of flavonoids is present by ethanolic extract and aqueous extract. 2. Terpenoids = Take 2mlof extract, dry and dissolve in chloroform. Add a few drops of acetic anhydride and conc.H2S04 and keep undisturbed for few minutes. Formation of pink colour indicates the presence of terpenids by petroleum ether extract. 3. Test for tannins and phenolic compound = To 1ml of the extract, add 2 drops of 5% Fecl3. Presence of dirty green precipitate indicates the presence of tannins and phenolic compound by ethanolic extract and aqueous extract. 4. Test for saponins =5ml of the extract was shaken with 5ml of distilled water and was heated to the boiling point. Froathing indicates the presence of saponins by ethanolic extract and aqueous extract. 5. Total carbohydrate=weighed amount of fresh tissue was homogenized with distilled water. The homogenate was filtered using a two layered cheese cloth. The filtrate was then centrifuged at 10,000g for 15 min. The supernatant was collected and the volume was made up to 25 ml using distilled water .an aliquot of sample was pippetted out and 4ml anthrone reagent added. It was then kept in a boiling water bath for 10 min. The tubes were cooled and the absorbance was measured at 530nm. The amount of total carbohydrate present was determined using the standard graph of glucose.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
tannins,flavonoids,triterpenoids in the soxhlet method . Study showed that the extract of plant contain most phytochemicals. Such as ?&#x2018; saponins,carbohydrates, tannins,flavonoids,proteins,triterpenoids&#x2018;&#x2018;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
DISCUSSION &#xD;
Phytochemical compound of the plant were analyzed. In the analysis of phytochemical compound of colecus arometicus Benth extract showed the presence of ?&#x2018;saponins,carbohydrates, tannins,flavonoids,proteins,triterpenoids&#x2018;&#x2018; arometicus used to treat asthma for a long time with any undesirable side effect . colecus arometicus is responsible for its pharmaceutical value.&#xD;
&#xD;
CONCLUSION &#xD;
Phytochemical analysis showed that the presence of terpenoids and phenolic compounds were responsible for the effects. Phytochemicals are also found in colecus arometicus, hence it may be the reason for the activity. In short, based on the present study it was abserved that the plant extracts, colecus arometicus in various phytochemicals like &#x2018;saponins,carbohydrates, tannins,flavonoids,proteins,triterpenoids&#x2018;&#x2018; In view of the above, present study was undertaken keeping mainly following objects:-&#xD;
&#xD;
&#xD;
	Study of phytochemicals of colecus arometicus Benth&#xD;
	Secondary metabolite analysis of colecus arometicus Benth.&#xD;
&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1849</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1849</Fulltext></URLs><References>1. Abelson (1990) Editorial- Science 247 : 513.&#xD;
&#xD;
2. Ajaiyeoba, E.O., Onocha, P.A. and olarenwaju, O.T. (2001) in vitro anthelmintic properties of Buchholzia coriaceae and Gynanadropsis, Mc Graw Hill Book Company, pp:42.&#xD;
&#xD;
3. Am,bujakshi, H.R., Thakkar Heena and Shyamnanda (2009) Anthelmintic activity of Gmelina arborea Roxb leaves extract. Internatiopn journal of Pharma. Research and Development, Vol :1.&#xD;
&#xD;
4. Asha, M.K., prashant, D., Murali,B., Padmaja, R. and Amit, A. (2001) Anthelmintic activity of essential oil of Ocimum sanctum and eugenol, Fitoterapia, 72: 669-670&#xD;
&#xD;
5. Bradford, M.M. (1976) Annual Biochem.P. 72.&#xD;
&#xD;
6. Chatterjee, K.D. (1967) Parasitology, Protozoology and Helmintholgy, 6th Edn., Guha Ray Sree Saraswaty Press Ltd, Calcutta. Dipak, N. Raut; Subodh C. Pal and Subhash&#xD;
&#xD;
7. Chandrashekhar C.H., Latha, K.P., Vagdevi&#xA0;13. Manjamalai, A., Sardar Sathyajith Singh, R., Guruvayoorappan, C. and Berlin Grace, V.M. (2010) Analysis of phytocontituents and Anti microbial activity of some mediinal plants in Tamilnadu, India. Global J. Biotech and Biochem., 5(2) : 120 - 128&#xD;
&#xD;
8. Dipak, N.Raut; Subodh C.Pal and Subhash C. Mandal (2009) Anthelmintic potential of Dendrophthoe falcate Etting. (L.F.) Leaf. International journal of Pharmaceutical Farnsworth, N.R. and Morris, R.W (1976) Higher plants the sleeping gaint of drug development American journal of pharmacology. 147 :46-52&#xD;
&#xD;
9. Gamble, J.S. (1918) Flora of the Presidency of Madras, Vol.II, pp. 1123-1124&#xD;
&#xD;
10. Harbone, J.B. (1973) Phytochemical methods, Chapman and Hall, London, pp.7.&#xD;
&#xD;
11. Kingdom, A.D. and Balandrin, M.F. (1993) Huan medicinal agents from plants, Amer Chem. Symp. ser 534: 1-348.&#xD;
&#xD;
12. Mandal (2009) Anthelmintic potential of Dendrophthoe falcate Etting. (L.F.) Leaf. Intenational Jounal of Pharmaceutical Research and Development, Vol-6 Aug/002&#xD;
&#xD;
14. Mayr, V.D., Trutter, C., Santos- Dudga, H., Baner and Senchitt, W. (1995) Development changes in the phenol concentrations of golden delicious apple fruits and leaves. J. Phyto.Chem., 38(5) : 1151 - 1155.&#xD;
&#xD;
15. Minija Janardhanan and John E. Thoppil (2004). Herb and spice essential oils (therapeutic, flavour and aromatic chemicals of Apiaceae). Discovery publishing house, New Delhi.&#xD;
&#xD;
16. Patra, A., Jha, S., Murthy, N.P. and Vaibhav, A.D. (2008) Anthelmintic and antibacterial activities of Hygrophila spinosa T. Anders. Research J. Pharm and Tech. (4) Oct. &#x2013; Dec. 531 - 532.&#xD;
&#xD;
17. Pelezcar, M.J. (1957) Microbiological methods by the society of American Bacteriologist, Mc Graw Hill Book Company, pp:42.&#xD;
&#xD;
18. Perry, B.D. and Randoph, T.F. (1999) Improving the assessment of the economic impact of parasitic diseases and of their control in production animals. Veterinary parasitolgy., 84:145-168.&#xD;
&#xD;
19. Pessoa, L.M., Moris, S.M., Bevilaqna, L.M.L. and Luciano, J.H.S. ?Anthelmintic activity of essenbtial oil of Ocimum gratissimum Linn. and eugenol against. Haemonchus controtus?. Veterinary parasitolgy, Vol: 109 No: 1-2, Oct-16 pp: 59 - 63.&#xD;
&#xD;
20. Research and Development, Vol-6 Aug/0002.&#xD;
&#xD;
21. Roe, J.H. (1965) Determination of food carbohydrates D.A.T. Sathgate, Uni. Cambr., England pp. 258.&#xD;
&#xD;
22. Sadasivam, S. and Balasubramanian, T. (1987) in. to Practical Manual in Biochemistry,Tamilnadu, Agriculture University, Coimbatore, pp. 14-27.&#xD;
&#xD;
23. Srinivasa Rao, D., Prasada Rao, V. and Samvisiva Rao, K.R.S. (2010) Pharmacological effects of forskolin isolated from Coleus aromaticus on the lung damage rats. An international Journal of Advances in Pharmaceutical Sciences. Vol (1) Sep-Oct.&#xD;
&#xD;
24. Soodabeh Sacidina, Ahmad Reza Gohari, Fumiyuki kiuchi and Gisho Honda (2005) in vitro anti-epimastigote activity of some Iranian medicinal plants. Iranian Jouranl of Pharmaceutical research, 2:101-103&#xD;
&#xD;
25. Suil S. Jalalpure, Kallanagoda R. Alagawadi, Channabasappa S. Mahajanshetty (2006) in vitro Anthelmintic proerty of various seed oils. Iranian Jouranal of Pharmaceutical Research, 4: 281- 284.&#xD;
&#xD;
26. Thorn, G.W., Adams, R.D., Braunwald, E., Isselbacher, K.J. and Petersdrof, R.G. (!977) Harrison&#x2018;s Principles of Internal Medicine, In : Mcraw Hill Co., New York, pp: 1088- 1089.&#xD;
&#xD;
27. Updegroff, D.M. (1969) Anal iochem: Academic Press, New York, 32:420&#xD;
&#xD;
28. Vigar, Z. (1984) Atlas of Medical Parasitology 2nd ed. Singapore. Publishing House; p.216-18.&#xD;
&#xD;
29. Zafar iqbal; Muhammad Lateef; Abdul Jabar; Muhammad Shoaib Akhtar, Muhammad Nisar Khan (2006) Anthelmintic activity of Vernonia anthelmintica seeds against. Trichostrongylid nematodes of sheep. Pharmaceutical Biology, Vol.44, pp. 563- 567&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>TOXICOLOGICAL EVALUATION OF AQUEOUS LEAF EXTRACT OF SENNA ALATA IN PREGNANT WISTAR&#xD;
RATS&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>89</FirstPage><LastPage>109</LastPage><AuthorList><Author>Yakubu M. T.</Author><AuthorLanguage>English</AuthorLanguage><Author> Adeshina A. O.</Author><AuthorLanguage>English</AuthorLanguage><Author> Ibrahim</Author><AuthorLanguage>English</AuthorLanguage><Author> O. O. K.</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Objective: Aqueous leaf extract of Senna alata at 250, 500 and 1000 mg/kg body weight was evaluated for toxicity in pregnant Wistar rats. Methods: Pregnant rats were grouped into four (A, B, C and D) of five animals each such that rats in groups A, B, C and D received 0.5 ml of distilled water, 250, 500 and 1000 mg/kg body weight of the extract respectively, from days 10-18 post-coitus. Results: The extract reduced (P</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Senna alata, Fabaceae, Pregnancy, Functional toxicity, Structural toxicity, Biomarkers</Keywords><Fulltext>INTRODUCTION &#xD;
Senna alata (Linn) Roxb. (=Cassia alata Linn) which belongs to the Fabaceae family (subfamily Caesalpiniaceae) is often variously called Ringworm Bush, Candlebra Bush, Empress Candle Plant and Ringworm Tree (English), asunwon oyinbo (Yoruba-Western Nigeria) and nelkhi or okpo (Igbo-Eastern Nigeria).1 It is native to Mexico and grows in forest areas of West Africa. S. alata is an erect, tropical, annual herb of 0.15 m high with bilateral, leathery compound leaves (50-80 cm long) that fold together in the dark. The fruit is a straight pod of about 25 cm long.2 The seeds are small and square in shape while the inflorescence looks like a yellow candle. The root, stem, stem bark and leaves have been separately claimed to be used to manage hepatitis, scabies, pruritis, jaundice, gastroenteritis, ringworm, ulcer, eczema, burns, wound, skin and upper respiratory tract infection, diarrhoea, constipation, food poisoning and poisonous bites.3,4 The leaves have been implicated to be used as abortifacient and to hasten labour.1&#xD;
&#xD;
S. alata have been scientifically evaluated for a variety of pharmacological activities such as antibacterial, antifungal, antiparasitic, laxative, antidiabetic, antiinflammatory, analgesic and abortifacient.5-12 The toxicological studies available in the open scientific literature on S. alata thus far have used normal mice and rats as models.13, 14 Since the extract have been reported to possess abortifacient activity in pregnant rats, there is also the need to investigate the toxic implications of the same doses of extract in pregnant rats. Therefore, the present study was aimed at providing information on the effect of aqueous leaf extract of S. alata on some functional indices of the liver, heart and kidney of pregnant Wistar rats. We also investigated the haematological and lipid profile as well as the histoarchitectural changes in the selected organs of the pregnant animals following the administration of the extract on days 10-18 post-coitus.&#xD;
&#xD;
MATERIALS AND METHODS &#xD;
Materials Plant materials The plant sample, obtained from herb sellers at a market (Oja tuntun) in Ilorin, Nigeria was authenticated at the Forestry Research Institute of Nigeria, Jericho, Ibadan, Nigeria. A voucher specimen (FHI 10845) was deposited at the Herbarium of the Institute. Assay kits and other reagents The assay kits for urea, creatinine and uric acid were products of Quinica Clinical Aplicada, S.A Amosta, Spain, while those for albumin, bilirubin, globulin, aspartate transaminase (AST), alanine transaminase (ALT), &#x3B3;-glutamyl transferase (GGT), sodium, potassium, calcium, chloride, phosphate, cholesterol, triacylglycerol, low- and high- density lipoprotein cholesterol were products of Randox Laboratories, Ltd, United Kingdom. Paranitrophenyl phosphate was a product of Sigma-Aldrich Chemical, United Kingdom. All other reagents used were of analytical grade and were prepared in glass-distilled water.&#xD;
&#xD;
Laboratory animals &#xD;
Forty rats (Rattus norvegicus) made up of equal number of males (184.80 &#xB1; 4.16 g) and females (163.65 &#xB1; 3.11 g) were obtained from the Animal Breeding Unit of the Department of Biochemistry, University of Ilorin, Ilorin, Nigeria. The animals, housed in aluminium cages that were placed in well-ventilated room conditions (temperature: 22 &#xB1; 3&#xBA;C; 12 h light-dark cycle; humidity: 45%-50%) were also supplied with rat pellets (Bendel Feeds and Flour Mill, Ewu, Edo, Nigeria) and water ad libitum.&#xD;
&#xD;
Preparation of aqueous leaf extract &#xD;
The leaves of Senna alata were oven-dried at 400C for 72 h to a constant weight using Uniscope SM9053 Laboratory Oven, (Surgifriend Medicals, Essex, England). The dried leaves were then pulverized with an electric blender (Crown Star Blender CS- 242B, Trident (H.K.) Ltd, China) from which 100 g each was extracted in 1000 ml of cold distilled water for 48 hours with constant shaking. This was later filtered with Whatmann No. 1 filter paper and thereafter lyophilized (Micromodulyo Freeze Dryer, FS400-05, USA) to give a yield of 16.50 g which was reconstituted in distilled water to give the required doses of 250, 500 and 1 000 mg/kg body weight used in this study. The doses were as used previously in our study on the abortifacient activity of the aqueous leaf extract of S. alata in pregnant rats.12&#xD;
&#xD;
Animal grouping and extract administration&#xD;
Female rats were paired overnight with the male rats in ratio 1:1 in aluminium cages that made the animals have free access to food and water. The day when vaginal plug and spermatozoa (detected with the aid of light microscope) appeared in the vaginal smear was considered as day zero of pregnancy. Pregnancy was also confirmed with the aid of pregnancy strip dipped into their urine. The pregnant animals were thereafter completely randomized into four groups (A, B, C and D) of five animals each. The distilled water and the extracts were administered orally to the various groups of animals on days 10 to 18 (organogenetic period) post coitus on daily basis, using oropharyngeal cannula as follows: Group A (control) received 0.5 ml of distilled water while animals in Groups B, C and D, were treated in the same manner as the control except that they received equal volume of the extract containing 250, 500 and 1000 mg/kg body weight respectively. The animals were humanely handled according to the guidelines of National Institute of Health on the Care and Use of Laboratory Animals.15 This study was carried out following approval from the Ethical Committee on Animal Use and Care of the Department of Biochemistry, University of Ilorin, Ilorin, Nigeria (Ref: UIL/BCH/EC/2008/001).&#xD;
&#xD;
Preparation of serum and tissue supernatants &#xD;
The animals were anaesthetized in a glass jar containing cotton wool soaked in diethyl ether. The unconscious rat was quickly removed and the neck area cleared of fur. The jugular veins were cut and blood was collected into the test tubes. The blood samples were allowed to clot at room temperature for 10 min after which they were centrifuged at 894 g x 10 min. The resulting serum was collected using Pasteur pipette and kept frozen overnight before being used for the biochemical analyses. The animals were thereafter dissected; the liver, heart and kidney removed and cleaned of blood by blotting in tissue paper. The kidneys were decapsulated after which the organs of interest were weighed separately and homogenized in ice-cold 0.25M sucrose solution (1:5 w/v). The homogenates were centrifuged at 1398 g x 15 min to obtain the supernatant, which were then used within 24 hours for the biochemical analyses.&#xD;
&#xD;
Determination of biochemical and haematological parameters &#xD;
The procedures adopted for the biochemical parameters were as described for alkaline phosphatase16, aspartate and alanine transaminases17, gamma glutamyl transferase18, total protein19, bilirubin20 , albumin21, urea22, creatinine23, calcium, phosphate, uric acid, globulin, potassium, sodium and chloride ions24. The blood urea nitrogen (BUN): creatinine ratio was computed as the ratio of serum urea to creatinine. The lipids assayed included total cholesterol25, low density lipoproteincholesterol26, high density lipoproteincholesterol27, triglycerides28 and atherogenic index29. The organ-body weight ratio was computed using the expression of Yakubu et al30. The haematological parameters of haemoglobin (Hb), packed cell volume (PCV), red blood cells (RBC), mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH), mean corpuscular haemoglobin concentration (MCHC), white blood cells (WBC), platelets, neutrophils and lymphocytes were analysed using Haematologic Analyzer, Sysmex, KX-21, Japan by&#xA0;adopting the principles described by Dacie and Lewis31 .&#xD;
&#xD;
Histological examination&#xD;
Tissue sections of the liver, heart and left kidney of the animals were prepared using the procedures described by Drury and Wallington32 and Krause33. The tissues were stained with hematoxylin/eosin (H and E) and photomicrographs captured at x 400 with a Canon PowerShot A560 Digital Camera, Canon USA Inc., NY, USA. Statistical analysis Data were expressed as the means + SEM of five replicates. Significant differences were determined using a one-way analysis of variance and Duncan Multiple Range Test at P</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1850</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1850</Fulltext></URLs><References>1. Gill LS. Ethnomedical uses of plants in Nigeria. Nigeria: Uniben Press, Benin; 1992: 60-1.&#xD;
&#xD;
2. Martin H, Bindanda MP. Natural Medicine in the Tropics I: Foundation text. anamed, Winnenden, Germany 2008.&#xD;
&#xD;
3. Adedayo O, Anderson WA, MooYoung M, Snieckus V, Patil PA, Kolawole DO. Phytochemistry and antibacterial activity of Senna alata flower. Pharm Biol 2001; 39(6): 408- 12.&#xD;
&#xD;
4. El-Mahmood AM, Doughari JH, Chanji FJ. In vitro antibacterial activities of crude extract of Nauclea latifolia and Daniella oliveri. Sci Res Essays 2003; 31(3): 102-5.&#xD;
&#xD;
5. Owoyale JA, Olatunji GA, Oguntoye SO. Antifungal and antibacterial activities of an alcoholic extract of Senna alata leaves. J. Appl. Sci. Environ. Mangt 2005; 9(3): 105-7.&#xD;
&#xD;
6. Abubacker MN, Ramanathan R, Kumar TS. In vitro antifungal activity of Cassia alata Linn. flower extract. Nat Prod Radiance. 2008; 7(1): 6-9.&#xD;
&#xD;
7. Sule WF, Okonko IO, Omo-Ogun S, Nwanze JC, Ojezele MO, Ojezele OJ, Alli JA, Soyemi ET, Olaonipekun TO. Phytochemical properties and in-vitro antifungal activity of Senna alata Linn. crude stem bark extract. J Medicinal Plants Res 2011; 5(2): 176- 83.&#xD;
&#xD;
8. Moundipa PF, Melanie Flore KG, Bilong Bilong CF, Bruchhaus I. In vitro amoebicidal activity of some medicinal plants of Bamun Region (Cameroon). Afr J Trad Complement Alt Med 2005; 2:113-21&#xD;
&#xD;
9. Elujoba A, Ajulo OO, Iweibo GO. Chemical and Biological analyses of Nigerian Cassia species for laxative activity. J Pharm Biomed Anal 1989; 7: 1453-7.&#xD;
&#xD;
10. Palanichamy S, Nagarajan S, Devasagayam M. Effect of Cassia alata leaf extract on hyperglycemic rats. J Ethnopharmacol 1988; 22(1): 81-90.&#xD;
&#xD;
11. Villase&#xF1;or IM, Canlas AP, Pascua MPI, Sabando MN, Soliven LAP. Bioactivity studies on Cassia alata Linn. leaf extracts. Phytother Res 2002; 16 suppl.1: S93-S6.&#xD;
&#xD;
12. Yakubu MT, Adeshina AO, Oladiji AT, Akanji MA, Oloyede OB, Jimoh GA, Olatinwo AWO, Afolayan AJ. Abortifacient potential of aqueous extract of Senna alata leaves in rats. J Reprod and Contraception. 2010; 21(3): 163-77&#xD;
&#xD;
13. Sodipo OA, Effraim KD, Emmagun E. Effects of aqueous leaf extract of Cassia alata on some haematological indices in albino rats. Phytother Res 1998; 12: 431-3.&#xD;
&#xD;
14. Yagi SM, El Tigani S, Adam SEI. Toxicity of Senna obtusifolia fresh and fermented leaves (kawal), Senna alata leaves and some products from Senna alata on rats. Phytother Res 1998; 12: 324-30&#xD;
&#xD;
15. National Institutes of Health. (NIH). Guide for the Care and Use of Laboratory Animals. Washington DC,&#xA0;USA: National Research Council. 1985; NIH Publication No. 83-127.&#xD;
&#xD;
16. Wright PJ, Leathwood PD, Plummer DT. Enzymes in rat urine. Alkaline phosphatase. Enzymologia. 1972; 42(4): 317-27.&#xD;
&#xD;
17. Reitman S, Frankel S. A colourmetric method for the determination of serum glutamate-oxaloacetate and pyruvate transaminase. Am J Clin Path 1957; 28:56 18. Szasz G. Methods of enzymatic analysis. Clin Chem 1974; 2: 715-21.&#xD;
&#xD;
19. Gornall AC, Bardawill CJ, David MM. Determination of serum protein by means of biuret reaction. J Biol Chem 1949; 177: 751-6.&#xD;
&#xD;
20. Evelyn KA, Malloy HT. Micro determination of oxyhaemoglobin, methaemoglobin and sulphaemoglobin in a single sample of blood. J Biol Chem 1938; 126: 655.&#xD;
&#xD;
21. Doumas BT, Watson WA, Biggs HG. Albumin standards and measurement of serum albumin with bromocresol green. Clin Chim Acta 1971; 31: 87- 92.&#xD;
&#xD;
22. Veniamin MP, Varkirtzi C. Chemical basis of the carbamidodi-acetyl micromethod for estimation of ure, citrulline and carbamyl derivatives. Clin. Chem 1970; 16: 3-6.&#xD;
&#xD;
23. Blass KG, Thiebert RJ, Lam LK. Study of mechanism of JAFE reactions. Clin Chem 1974; 12: 336- 43.&#xD;
&#xD;
24. Tietz NW. Clinical Guide to Laboratory Tests. 3rd edn, Philadelphia: W.B. Saunders Company; 1995.&#xD;
&#xD;
25. Fredrickson DS, Levy RI, Lees RS. Fat transport in lipoproteins-An integrated approach to mechanisms and disorders. N Engl J Med 1967; 276(3): 148-56.&#xD;
&#xD;
26. Demacker PN, Hymans AG, Brennink BJ, Jansen BP, Vantlaar A. 5 methods for determining low density lipoprotein cholesterol compared. Clin. Chem 1984; 30(1): 1797-800.&#xD;
&#xD;
27. Albers JJ, Warnick GR, Chenng MC. Quantitative of high density lipoproteins. Lipids. 1978; 13: 926-32.&#xD;
&#xD;
28. Fossati P, Precipe L. Serum triglycerides determined colourimetrically with an Enzyme that produces hydrogen peroxide. Clin Chem 1982; 28(10): 2077-80.&#xD;
&#xD;
29. Panagiotakos BC, Pitsavos J, Skoumas J, Chrysohoou C, Toutouza M, Stganadis CI, Toutouzas PK. Importance of LDL/HDL ratio as a predicator for coronary heart disease events in patients with heterozygous familiar hypercholesterolemia; A is year follow up (1987- 2002). Curr Med Res and Opin 2003; 19(2): 89-94.&#xD;
&#xD;
30. Yakubu MT, Akanji MA, Oladiji AT, Adesokan AA. Androgenic potentials of aqueous extract of Massularia acuminata (G. Don) Bullock ex Hoyl. stem in male Wistar rats. J. Ethnopharmacol .2008; 118(3): 508- 513.&#xD;
&#xD;
31. Dacie JV, Lewis M. Practical haematology, 7th edn, Churchill, Livingstone, Edinburg, London, 1995; 12-7.&#xD;
&#xD;
32. Drury RAB, Wallington EA. Carleton&#x2018;s Histological Technique. 4th edn, New York:NY; Oxford University Press; 1973: 58.&#xD;
&#xD;
33. Krause WJ. The art of examining and interpreting histologic preparations. A student handbook, UK: Partheton Publishing Group; 2001: 9-10.&#xD;
&#xD;
34. Akanji MA, Adegoke OA, Oloyede OB. Effect of chronic comsumption of metabisulphate on the integrity of rat&#xA0;cellular system. Toxicol . 1993; 81:173-9.&#xD;
&#xD;
35. Shahjahan M, Sabitha KE, Mallika J, Shyamala-Devi CS. Effect of Solanum trilobatum against carbon tetrachloride induced hepatic damage in albino rats. Indian J Med Res 2004; 120: 194&#x2013;8.&#xD;
&#xD;
36. Giannini EG, Testa R, Savarino V. Liver enzyme alteration: a guide for clinicians. Canadian Medical Ass J. 2005; 172(3): 367-79.&#xD;
&#xD;
37. Adebayo OJ, Adesokan AA, Olatunji LA, Buoro DO, Soladoye AO. Effect of ethanolic extract of Bougainvillea spectabilis leaves on haematological and serum lipid variables in rats. Biokemistri, 2005; 17: 45-50.&#xD;
&#xD;
38. Lakmichi H, Bakhtaoui FZ, Gadhi CA, Ezoubeiri A, El-Jahiri Y, ElMansouri A, Zrara B, Loutfi K. Toxicity profile of the aqueous ethanol root extract of Corrigiola telephiifolia Pourr. (Caryophyllaceae) in rodents. Evid-Based Compl and Altern Med 2011; e-pub ahead of print (DOI: 10.1155/2011/317090.&#xD;
&#xD;
39. Lamb EJ, Price CP. Creatinine, urea and uric acid. In: Tietz fundamentals of clinical chemistry. Burtis, CA, Ashwood, ER, Bruns, DE and Sawyer BG (eds). WB Saunders (6th edn). 2008; 363-368.&#xD;
&#xD;
40. Scot GM. Electrolytes and blood gases. In: Tietz fundamentals of clinical chemistry. Burtis, CA, Ashwood, ER, Bruns, DE and Sawyer BG (eds). WB Saunders (6th edn) . 2008; 431-440.&#xD;
&#xD;
41. Yakubu MT, Akanji MA, Oladiji AT. Alterations in serum lipid profile of male rats by oral administration of aqueous extract of Fadogia agrestis stem. Res J Med Plant 2008; 2(2): 66- 73.&#xD;
&#xD;
42. Panagiotakos B, Pitsavos C, Skoumas J, Chrysohoou C, Toutouza M, Stefanadis CI, Toutouzas PK. Importance of LDL/HDL ratio as a predicator for coronary heart disease events in patients with heterozygous familial hypercholesterolemia: A 15 year follow-up (1987-2002). Curr Med Res and Opin 2003; 19(2): 89-94.&#xA0;&#xD;
&#xD;
43. Amresh G, Singh PN, Rao CV. Toxicological screening of traditional medicine Laghupatha (Cissampelos pareira) in experimental animals. J Ethnopharmacol 2008; 116: 454&#x2013;60.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>A COMPARATIVE STUDY TO ASSESS THE CHANGES IN THE CONDUCTION OF MEDIAN NERVE AT WRIST JOINT IN APPARENTLY ASYMPTOMATIC COMPUTER USERS WITH THAT IN GENERAL POPULATION&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>110</FirstPage><LastPage>118</LastPage><AuthorList><Author>Dhaval Desai</Author><AuthorLanguage>English</AuthorLanguage><Author> Chintan Shah</Author><AuthorLanguage>English</AuthorLanguage><Author> Harshit Soni</Author><AuthorLanguage>English</AuthorLanguage><Author> Hasmukh Patel</Author><AuthorLanguage>English</AuthorLanguage><Author> Komal Soni</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background: Nerve Conduction Testing is frequently used by the physiotherapist as an investigation procedure for Carpal Tunnel Syndrome. Carpal Tunnel Syndrome may develop in Computer users as well as in General Population those who are using their wrist and finger frequently. Objectives: To compare the Nerve Conduction changes amongst the two groups of people; those working on computer and general&#xA0;population who are involved in cooking, masoning, sweeping etc. Methods: 60 individuals were divided into 2 groups, group A and group B consisting of 30 individuals each. Group A: Individuals without any symptoms of Carpal Tunnel Syndrome working for &gt; 4 hours per day for &gt; 1 year. Group B: Individuals belonging to general population not using computer. Analysis was based on the distal motor latency and&#xD;
sensory nerve action potential taken for the dominant hand. Results: Mean&#xB1;SD for Distal Motor Latency for GROUP A was 4.116&#xB1;0.265ms and for GROUP B was 3.243&#xB1;1.044ms. Mean&#xB1;SD for Digit II to Wrist latency for GROUP A was 2.845&#xB1;0.252ms and for GROUP B was 2.077&#xB1;0.556ms. Mean&#xB1;SD for Transcarpal to Wrist latency for GROUP A was 1.854&#xB1;0.289ms and for GROUP B was 1.414&#xB1;0.252ms. t&#x2018; calculated value for DML, Digit II to wrist and Transcarpal to wrist was 4.43, 6.88 and 6.27 respectively which was statistically significant as it is above the t&#x2018; tabulated value of 1.96.&#xD;
Conclusion: There is a significant difference in both the Groups for all the parameters. GROUP A individuals are having more chances for developing Carpal Tunnel Syndrome when compared to GROUP B individuals.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Carpal Tunnel Syndrome, Nerve Conduction Velocity, Computer users and General Population.</Keywords><Fulltext>INTRODUCTION &#xD;
Computer is an electronic device which is omnipresent in our society; where more than 50% work is carried out by computers (desktops/laptops). Today computers are widely used with its basic unit like keyboard and mouse in different sectors. About 2 of every 5 employed individuals are connected to use of computers while on the job.1 As per a recent World Bank&amp;#39;s Enterprise Survey of 1,948 retail stores in India, 19% of the stores use computers for their business. In some states like Kerala, computer use is as high as 40%.2 Repetitive strain injury (RSI); also known as occupational overuse syndrome, non-specific arm pain or work related upper limb disorder (WRULD); is mainly associated with repeated use of any particular movement like&#xA0;flexion/extension. RSI includes conditions like De-Quervain&#x2018;s disease, tennis elbow, carpal tunnel syndrome, etc. Carpal tunnel syndrome (CTS) is described as the triad of nocturnal pain, sensory disturbance in the distribution of the median nerve and thenar atrophy.3 A study of employees in 21 computer companies in Chennai has revealed that one in eight computer professionals runs the risk of CTS and incidence increases with long hours at computers.4 Innocuous activities such as typing and clicking a mouse button could possibly be harmful. Motor nerve conduction velocity measurement employing muscle action-potential was first carried out by Piper (1909) and Munnich (1916).5 The first usefulness of the median nerve conduction studies in the diagnosis of CTS was done by Simpson in 1956 where he demonstrated slowing of nerve conduction in CTS. NCV studies with a high degree of sensitivity (&gt;85%) and specificity (&gt;95%) constitute an important aspect of the diagnosis of CTS.6 Nerve conduction change occurs before a patient develops clinical symptoms of CTS that are severe enough to seek medical attention. Many asymptomatic employees can in fact be found to have abnormalities in nerve conduction, so by giving early intervention we can avoid later complication and surgery for them. In general population like sweepers, house wives, masoning work and so likewise work where they need to move their wrist and finger in above mentioned direction are prone to develop CTS in early or late stage of their life. A study done on general population of middle part of Italy, having population of 120,000 found that in the 8-year period, 3,142 cases were identified as having CTS. The mean annual crude incidence was 329 cases per 100,000 personyears, and the standardized incidence was 276.7 A repetitive motion of wrist is one of the known causes to develop CTS. Daily high-velocity and high-force manual work is a risk factor for CTS in a working population like Slaughter house worker,8 Grocery store worker,9 Industries,10 Dentist11 etc. Hence the study was conducted to assess the NCV changes in those people who work using computers and amongst the general population with its main objectives to evaluate and compare the median nerve NCV changes at wrist in computer workers who work for &gt; 4 hours per day with those in general population.&#xD;
&#xD;
METHODOLOGY &#xD;
Study Design: Cross Sectional Comparative Study Study Setting: NCV Laboratory of Shree Devi College of Physiotherapy, Mangalore Sample size: 60 individuals Sampling method: The study included a sample of 60 individuals. Out of that 30 individuals were involved in computer work for &gt; 4 hours per day from past 1 year and remaining 30 individuals were from general population involved in work like cooking, sweeping and masoning were selected by using Convenient Sampling.&#xD;
&#xD;
Inclusion criteria: &#xD;
1) Age: between 20 years to 50 years.&#xD;
2) People using laptop, desktop or both.&#xD;
3) Individual working for &gt; 4 hours/day for a year or more.&#xD;
4) Individuals engaged in cooking, sweeping, masoning occupations.&#xD;
5) Right Hand Dominants&#xD;
&#xD;
Exclusion criteria: &#xD;
1) Symptomatic Persons (CTS)&#xD;
2) People with any other neurological disorder.&#xD;
3) People with any orthopedic problem.&#xD;
4) People who have been operated previously for hand.&#xD;
5) Pregnant women.&#xD;
6) People with inflammatory joint disease. i.e. Rheumatoid arthritis and obese individuals.&#xD;
&#xD;
Source of data collection: &#xD;
1) Computer Centers.&#xD;
2) House wife, Sweepers and Masons as General population from Mangalore.&#xD;
&#xD;
Tools used: &#xD;
1. EMG machine (Neuro careTM &#x2013; 2000, computerized EMG with NCV and Evoked potentials, Ser. No. 1023. Manufacture Bio-techTM, India. )&#xD;
&#xD;
Outcome measures: &#xD;
1) Distal Motor Latency of Median Nerve (DML)&#xD;
2) Sensory Latency of Median Nerve, namely II digit to wrist latency (DII to W) and Transcarpal to wrist latency (TC to W). Procedure: Prior to procedure individuals who met the inclusion criteria were assessed and evaluated thoroughly by using the questionnaire (Annexure 1). After signing the consent form they were made to participate in study. Group A: Consists of 30 individuals without any symptoms of CTS working for &gt; 4 hours per day for &gt; 1 year. Group B: Consists of 30 individuals belonging to general population not using computer but engaged in cooking, sweeping, masoning occupations. Following the above procedure the individuals belonging to all the three groups were tested for the NCV changes of the median nerve for dominant hand. The Procedure for measuring NCV was conducted as per that mentioned in Clinical Neurophysiology, 2nd edition, by UK Misra and J Kalita.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
Following the recording of the above parameters, the obtained scores were tabulated and compared among both study groups for NCV changes to check the probability of occurrence of CTS amongst them. Ethical Consideration: Procedures followed were in accordance with the ethical standards of Helsinki Declaration of 1975, as revised in 2000.12 Statistical analysis: All 60 participants of both groups were analyzed for NCV changes. Unpaired t tests were used to find out homogeneity of two groups for all the demographic parameters and to compare the outcome measurement data between two groups. Each calculated t-value is compared with t-table value to test two tailed hypothesis at 0.05 level of significance. Data analysis software SPSS 13.0 version has been used for the data analysis of the present study.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
DISCUSSION &#xD;
The study was conducted to examine the changes of NCV in computer workers and amongst the general population. The study was done on 30 individuals with a mean age of 24.93 &#xB1; 3.10 who used computer on daily basis &gt; 4 hours / day for 1 year or more and remaining 30 individuals with the mean age of 26.63 &#xB1; 4.39 who were involved in cooking, sweeping, masoning, etc. Distal Motor Latency and Sensory Latency (SNAP) from Digit II to Wrist and Transcarpal region to wrist in dominant upper extremity were evaluated. After retrieving the values, data was statistically compared using Unpaired ?t&#x2018; test for comparison of both the groups.&#xD;
&#xD;
Result showed that there is significant difference in both the GROUPS when compared in terms of DML, Digit II to Wrist Latency and Transcarpal to Wrist Latency. In all the three outcome parameters, Group A had significantly higher latencies as compared to group B. So we can conclude that there are more chances to develop CTS in GROUP A (Computer users those who use it for &gt; 4 hours / day from past 1 year) compared to GROUP B. This can be attributed to the repetitive action of fingers and abnormal wrist postures seen during typing and mouse operating leading to abnormal stress on the underlying tissues especially the nerves. One of the hallmarks of compressive neuropathies such as CTS is demyelination, producing the reduction in normal conduction of neural impulses, which appears to result primarily from the mechanical disruption of internodal segments, extensive demyelination and persistent compression eventually resulting in direct axonal damage and wallerian degeneration distal to site of injury. Limitations of the study ? The study was done on a small sample size. ? Only Electro diagnostic tool was used to find out CTS. ? Only Median Nerve value was taken in to consideration. Scope of further studies ? Comparison of Sensory and Motor nerve conduction velocity of median and ulnar nerves can give better result. ? Probabilities of occurrence of CTS based on number of hours spend/day on computer usage can be compared in future. ? Comparison of dominant to nondominant hand can be done to check the probability of occurrence of CTS among them. ? On basis of the acquired results, ergonomic advice can be given to the involved group individuals. CONCLUSION Study was done on Computer users and General population involved in cooking, sweeping etc. for assessing the NCV abnormalities and thereby to identify presence of CTS by using parameters like DML (Distal Motor Latency), Latency from IInd Digit to Wrist and Transcarpal region to Wrist. The result showed that there is a significant difference in both the Groups for all the parameters suggesting that among them, GROUP A individuals i.e. computer operators are having more chances for developing CTS when compared to GROUP B individuals, i.e. general population.&#xD;
&#xD;
ACKNOWLEDGEMENTS&#xD;
First and foremost we would like to thank God to bless us enough courage and ability to pursue this work. We are greatly thankful to all the scholars whose articles are cited and included in references of this manuscript. We are also grateful to authors/ editors/ publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed. We are thankful to all our subjects who participated with full cooperation and showed voluntary interest, without them this study would not have been possible. Finally we are thankful to all those who directly or indirectly contributed to this study.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1851</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1851</Fulltext></URLs><References>1. United States department of labour, Computer use at work in 2003, August 03, 2005, available at www.bls.gov.&#xD;
&#xD;
2. Mohammad Amin. World Bank. Are Labour Regulations Driving Computer Usage in&#xA0;India&#x2018;s Retail Stores World Bank Policy Research Working Paper 4274, July 2007.&#xD;
&#xD;
3. S. Brent Brotzman, Kevin E.Wilk; Clinical orthopaedic rehabilitation, 2nd edition. Mosby. pp 34-39&#xD;
&#xD;
4. Ali KM, Sathiyasekaran BW. Computer professionals and Carpal Tunnel Syndrome (CTS). Int J Occup Saf Ergon 2006; 12: 319-325.&#xD;
&#xD;
5. UK Misra, J Kalita, clinical neurophysiology, 2nd edition, 1st chapter, page: 1-8.&#xD;
&#xD;
6. C. K. Jablecki, M. T. Andary, M. K. Floeter and R. G. Miller. Practice parameter: Electrodiagnostic studies in carpal tunnel syndrome: Report of the American Association of Electrodiagnostic Medicine. Neurology 2002; 58: 1589-1592.&#xD;
&#xD;
7. Mauro Mondelli, Fabio Giannini, and Mariano Giacchi. Carpal tunnel syndrome incidence in a general population. NEUROLOGY 2002; 58: 289-294.&#xD;
&#xD;
8. Frost P, Andersen JH, Nielsen VK. (1998) Occurrence of carpal tunnel syndrome among slaughterhouse workers. Scand J Work Environ Health; 24: 285-292.&#xD;
&#xD;
9. Osorio AM, Ames RG, Jones J, et al. (1994) Carpal tunnel syndrome among grocery store workers. Am J Ind Med; 25: 229&#x2013;245&#xD;
&#xD;
10. Bingham RC, Rosecrance JC, Cook TM. Prevalence of abnormal median nerve conduction in applicants for industrial jobs. Am J Ind Med 1996 Sep; 30(3): 355-61.&#xD;
&#xD;
11. Werner RA, Hamann C, Franzblau A, et al. (2002) Prevalence of carpal tunnel syndrome and upper extremity tendinitis among dental hygienists. J Dent Hyg; 76: 126-132&#xD;
&#xD;
12. WMA Declaration of Helsinki - Ethical Principles for Medical Research Involving Human Subjects. 59th WMA General Assembly Seoul, Korea, Oct 2008. http://www.wma.net/en/30publications/10po licies/b3/&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>DESIGN OF A COMPACT CPW FED HEXAGON SHAPED SLOT ANTENNA FOR WI-MAX APPLICATION&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>119</FirstPage><LastPage>123</LastPage><AuthorList><Author>H. M. Ramesh</Author><AuthorLanguage>English</AuthorLanguage><Author> K. Balaji</Author><AuthorLanguage>English</AuthorLanguage><Author> D.Ujwala</Author><AuthorLanguage>English</AuthorLanguage><Author> B.Harish</Author><AuthorLanguage>English</AuthorLanguage><Author> Ch. Vijay Sekhar Babu</Author><AuthorLanguage>English</AuthorLanguage><Author> K.Naga Mallik</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>A compact Coplanar Waveguide (CPW) fed Hexagon shaped slot antenna is proposed for Wi-Max application. The proposed antenna has a size of 20mm x 16.5mm x1.6mm and it is designed on Rogers RT/Duroid substrate with a dielectric constant of 2.2. The proposed antenna resonates at 7.5 GHz and has a bandwidth of 1.2 GHz, Return Loss (S11) of -51.5dB, Gain 3.7 dBi, VSWR of 1 at 7.5 GHz. The near field and far field radiation patterns are bi-directional and Omni-directional in E and H planes. The&#xA0;proposed antenna is used for Wi-Max applications and the antenna has an impedance bandwidth of 86%. The proposed antenna is simulated using Ansoft High Frequency Structure Simulator (HFSS) version 13&#xD;
which is based on Finite Element Method and the antenna parameters are analyzed.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Co-Planar Waveguide (CPW), Near-Field, Far-Field, Wi-Max, Slot antenna.</Keywords><Fulltext>INTRODUCTION &#xD;
Worldwide Interoperability for Microwave Access (Wi-Max) [1] with IEEE 802.16 standard is an emerging wireless technology for high data rate transfer of approximately 75Mb/s. The design of wideband antenna with compact size, low profile, light weight and obtaining beneficial results for fundamental antenna parameters like Return Loss, VSWR, Gain and Radiation Patterns is a challenge. A slotted patch antenna fed by a CPW structure provides broad bandwidth with low dispersion and less radiation. Among planar UWB antennas, slot antennas are more preferred because of their higher impedance bandwidth, very good radiation efficiency and less dispersion [2-6]. In this paper, a compact hexagonal shaped slot antenna is proposed which is useful for Wi-Max [7-10] application. The proposed antenna is easy to integrate, low profile with less radiation loss and less dissipation. Since CPW feed implemented here is of ungrounded type, there is no need of ground plate and this improves the radiation characteristics. The proposed antenna is excited with 50 ohms CPW feed.&#xD;
&#xD;
ANTENNA DESIGN &#xD;
The geometry of the proposed CPW fed hexagonal slot antenna is as shown in figure 1.&#xD;
&#xD;
The proposed antenna is designed on Rogers RT/duroid 5880 substrate on one layer metallic side. The relative permittivity of the substrate is 2.2 with a dielectric loss tangent of 0.0009. The overall size of the antenna is 20 x 16.5 x 1.6 mm. The optimum design parameters are shown in figure 1. The feed line width is 2mm at the bottom and increasing towards the top and the width at the top is 3.6 mm. The gap from the coplanar ground plane to the patch is 1.2mm. The length and width of the hexagonal slot is 18 x 10.3 mm. The folded slot dimensions are 6 x 1 mm with a gap of 1 mm between them. The simulation process is carried out using Ansoft High Frequency Structure Simulator (HFSS). The excitation given to this antenna is Lumped port excitation. The Return Loss and Resonant frequency will vary with the dimensions of the patch, coplanar ground plane and substrate.&#xD;
&#xD;
RESULTS AND DISCUSSIONS &#xD;
The proposed CPW fed hexagon shaped slot antenna resonates at a single frequency of 7.5 GHz (7 GHz to 8.2 GHz) which has a bandwidth of 1.2GHz. The Frequency vs. Return Loss plot is shown in figure 2 and the return loss at the resonating frequency is -51.5 dB. The VSWR at 7.5 GHz is 1.0 and the plot is shown in figure 3.&#xD;
&#xD;
The maximum Gain at resonant frequency of 7.5 GHz is 3.73 dBi and the 3D gain plot is shown in figure 4. The Impedance Bandwidth is 86%.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
Table 1 represents the output parameters of the antenna like Peak Directivity, Radiated Power, Radiation Efficiency etc. and obtained a Radiation Efficiency of 99.9% which shows that there is less loss of Radiation. Table 2 represents the radiated field data at the resonant frequency 7.5GHz at different Theta and Phi. From the table, Left hand Circular Polarization (LHCP) and Right hand Circular Polarization (RHCP) are approximately equal.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
CONCLUSION &#xD;
A 50 ? CPW fed hexagon shaped folded slot antenna of compact size 20 x 16.5 x 1.6 mm is designed for Wi-Max application with excellent Return Loss of -51.5 dB and desirable peak gain of 3.7 dBi and acceptable VSWR of 1.0 at the resonant frequency 7.5 GHz (7GHz - 8.2GHz). The bandwidth of the designed antenna is 1.2 GHz with an impedance bandwidth of 86%. The E-Plane and H-Plane radiation patterns for different Phi (0 and 90 deg.) and Theta (0 and 90 deg.) values are obtained as quasi Omnidirectional with acceptable Radiation characteristics and desirable Radiation Efficiency.&#xD;
&#xD;
ACKNOWLEDGEMENT &#xD;
The authors would like to acknowledge their gratitude towards the management of Department ECE, K. L. University for their support during the work. Authors acknowledge the immense help received from the scholars&#xA0;whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1852</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1852</Fulltext></URLs><References>1. Rodney B. Water house, "Kin-Lu Wong" Planar antenna for wireless communications? Wiley - Interscience, 2007.&#xD;
&#xD;
2. Jyh-Ying Chiou, Jia-Yi Sze, and Kin-Lu Wong, "A broad-band CPW fed strip-loaded square slot antenna," IEEE Trans. Antennas Propag., vo1.51, pp. 719-721,2003.&#xD;
&#xD;
3. H. D. Chen,"Broadband CPW-fed square slot antennas with a widened tuning stub,? IEEE Trans. Antennas Propagation, vol. 51, pp. 1982-1986, 2003.&#xD;
&#xD;
4. Vi-Cheng Lin, and Kuan-Jung Hung, "Compact ultrawideband rectangular aperture antenna and band-notched designs," IEEE Trans. Antennas Propag., vo1.54, pp.3075-3081, 2006.&#xD;
&#xD;
5. Li Y.S. , Yang X.D., Liu C.Y., and Jiang T., "Compact CPW-fed ultrawideband antenna with band-notched characteristic," Electron.Lett. vo1.46, pp.1533-1534, 2010.&#xD;
&#xD;
6. Chen x., Zhang W. , Ma R., Zhang J., and Gao J., "Ultra-wideband CPW-fed antenna with round comer rectangular slot and partial circular patch," IET Microw. Antennas Propag., vol.1, pp.847-851, 2007.&#xD;
&#xD;
7. Lin Dang and et al, "A compact microstrip slot triple-band antenna for WLAN/WiMAX applications," IEEE Antennas Wireless Propag. Lett., vol. 9, pp. 1178 - 1181,2010.&#xD;
&#xD;
8. Wen-Shan Chen and Kuang-Yuan Ku, "Band-rejected design of the printed open slot antenna for WLAN/WiMAX operation," IEEE Trans. Antennas Propag., vo1.56, pp.l163-1169, 2008.&#xD;
&#xD;
9. Yang Zhang, Xin Sun, Jian-xing Wu, Hongchun, Gang Zeng,"Design of a CPW-Fed Compact Slot Antenna for WIMAX/WLAN Applications?, IEEE 2011.&#xD;
&#xD;
10. Pichet Moeikham and Prayoot Akkaraekthalin, "A Pentagonal Slot Antenna with Two-Circle Stack Patch for WLAN/WiMAX?, ISPACS, Dec. 7-9, 2011.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType/><ArticleTitle>BIOEQUIVALENCE AND HIGHLY VARIABLE DRUGS: AN OVERVIEW&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>124</FirstPage><LastPage>146</LastPage><AuthorList><Author>Vikram Lohar</Author><AuthorLanguage>English</AuthorLanguage><Author> Harsh Patel</Author><AuthorLanguage>English</AuthorLanguage><Author> Arvind Singh Rathore</Author><AuthorLanguage>English</AuthorLanguage><Author> Sandeep Singhal</Author><AuthorLanguage>English</AuthorLanguage><Author> Ashish Kumar Sharma</Author><AuthorLanguage>English</AuthorLanguage><Author> Parul Sharma</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Bioequivalence studies are the preliminary requirement for generic products to enter in the market. The manufacturer (generic) must be in limit with that of innovator (branded) formulation (reference listed drug) within the limits approved by respective governing bodies. As per biopharmaceutical classification system the drugs falls in the category I to IV on the basis of permeability and solubility data. Drugs belonging to the category of poor solubility and poor permeability data uphold bioequivalence issues. Due to this high variability, large sample size may be needed in BE studies to give adequate statistical power to meet FDA BE limits, and thus designing BE studies for HVDs is challenging. Consequently&#xD;
development of generic products for HVDs is a major concern for the generic drugs industry. Major regulatory agencies also considered different approaches for evaluating BE of highly variable drugs. From 2004 onward the FDA started looking for alternative approaches to resolve this issue, and eventually found that replicate crossover design and scaled average BE provides a good approach for evaluating the BE of highly variable drugs and drug products as it would effectively decrease sample size, without increasing patient risk.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Bioequivalence, Highly Variable Drugs, Pharmacokinetic.</Keywords><Fulltext>INTRODUCTION &#xD;
Generic drug According to the U.S. Food and Drug Administration (FDA), generic drugs are identical or within an acceptable bioequivalent range to the brand name counterpart with respect to pharmacokinetic and pharmacodynamic properties. By extension, therefore, generics are considered (by the FDA) identical in dose, strength, route of administration, safety, efficacy, and intended use. The FDA&#x2018;s use of the word identical is very much a legal interpretation, and is not literal. In most cases, generic products are available once the patent protections afforded to the original developer have expired. When generic products become available, the market competition often leads to substantially lower prices for both the original brand name product and the generic forms.&#xD;
&#xD;
Hatch Waxman Act&#xD;
Using bioequivalence as the basis for approving generic copies of drug products was established by the "Drug Price Competition and Patent Term Restoration Act of 1984,? also known as the Waxman-Hatch Act. Under Hatch-Waxman Act, one of the following four certifications has to be made while filing an ANDA: [Food and drug&#xA0;administration, center for drug evaluation and research (CDER)]. 1 Bioavailability (BA) and bioequivalence (BE) studies provide important information in the overall set of data that ensure the availability of safe and effective medicines to patients and practitioners. BA and BE measures are frequently expressed in systemic exposure measures, such as area under the plasma concentration-time curve (AUC) and maximum concentration (Cmax). These measures of systemic exposure are assumed to relate in some way to safety and efficacy outcomes that may be expressed in biomarkers, surrogate endpoints, or clinical benefit end points. 2&#xD;
&#xD;
Bioequivalence (BE) is defined as the absence of a significant difference in the rate and extent to which the active ingredient or active moiety in pharmaceutical equivalents or pharmaceutical alternatives becomes available at the site of drug action when administered at the same molar dose under similar conditions in an appropriately designed study 3 . BE studies of systemically absorbed drug products are generally conducted by determining pharmacokinetic endpoints to compare the in vivo rate and extent of drug absorption of a test and a reference drug product in healthy subjects. A test product is considered bioequivalent to a reference product if the 90% confidence intervals for the geometric mean test/reference ratios of the area under the drug&#x2018;s plasma concentration versus time curve (AUC) and peak plasma concentration (Cmax) both fall within the predefined BE limits of 80&#x2013;125% .4 The width of the 90% confidence interval is proportional to the estimated drug variability (in particular, within-subject variability for a crossover design) and inversely proportional to the number of subjects participating in the study. The BE limits of 80&#x2013;125% are currently applied to almost all drug products regardless of the size of within-subject variability. As a result, the number of subjects required for a study of highly&#xA0;variable drugs or drug products can be much greater than normally needed for a typical BE study. For example, to demonstrate BE with 90% power, it was estimated that 136 subjects would be required for a drug with 60% within subject coefficient of variation even if the test and reference products were identical. 5&#xD;
&#xD;
Traditional Bioequivalence Method &#xD;
For systemically available drug products, FDA generally asks applicants to conduct BE studies with pharmacokinetic endpoints using a single dose, crossover design in healthy subjects. The processes of study design and workflow of BA/BE studies are presented in brief in Figure 1 and Table 1 describes various study designs generally used for BA/BE studies. Subjects receive a single dose of test and reference products on separate occasions with random assignment to the two possible sequences of product administration. Treatments are separated by a washout period of adequate duration such that the drug of interest can no longer be detected in plasma. The FDA generally asks applicants to conduct single dose studies rather than multiple dose studies because single dose studies are generally more sensitive to detecting potential differences between products 4 . For a product with multiple strengths, the highest strength is used in the BE study, unless precluded for reasons of safety. The number of subjects in the study should be sufficient to ensure adequate statistical power;most studies enroll from 24 to 36 subjects. The bioequivalence parameters AUC and Cmax are statistically analyzed using the two one-sided tests procedure to determine whether the average values for the measures estimated after administration of the test and reference products are comparable.6 This approach involves the calculation of a 90% confidence interval for the ratio of the averages of the measures for the test and reference products. 7 The choice of the current 80 to 125% acceptance limits for BE has&#xA0;been based on expert medical judgment and FDA experience with thousands of drug products that a difference of less than 20% in drug exposure was not clinically significant for most drugs.8 The 80% limit indicates that the test product is no less than 80% of the reference, while the 125% limit indicates that the reference product is no less than 80% of the test product (a 4:5 reference to test ratio is a 5:4 test to reference ratio).&#xD;
&#xD;
ASSESSMENT OF BIOEQUIVALENCE &#xD;
The assessment of BE of different drug products is based on the fundamental assumption that two products are equivalent when the rate and extent of absorption of the test/generic drug does not show a significant difference from the rate and extent of absorption of the reference/brand drug under similar experimental conditions as defined. As per the different regulatory authorities, BE studies are generally classified&#xA0;as:&#xD;
&#xD;
1. Pharmacokinetic endpoint studies.&#xD;
2. Pharmacodynamic endpoint studies.&#xD;
3. Clinical endpoint studies.&#xD;
4. In vitro endpoint studies.&#xD;
&#xD;
The general descending order of preference of these studies includes pharmacokinetic, pharmacodynamic, clinical, and in vitro studies.&#xD;
&#xD;
Pharmacokinetic endpoint studies &#xD;
"These studies are most widely preferred to assess BE for drug products, where drug level can be determined in an easily accessible biological fluid (such as plasma, blood, urine) and drug level is correlated with the clinical effect. The statutory definition of BA and BE, expressed in rate and extent of absorption of the active moiety or ingredient to the site of action, emphasizes the use of pharmacokinetic measures to indicate release of the drug substance from the drug product with absorption into the systemic circulation. Regulatory guidance recommends that measures of systemic exposure be used to reflect clinically&#xA0;important differences between test and reference products in BA and BE studies. These measures include i) Total exposure (AUC0&#x2013;t or AUC0&#x2013;&#x221E; for singledose studies and AUC0&#x2013;&#x3C4; for steady-state studies), ii) Peak exposure (Cmax), and iii) Early exposure (partial AUC to peak time of the reference product for an immediate-release drug product). Reliance on systemic exposure measures will reflect comparable rate and extent of absorption, which, in turn, will achieve the underlying goal of assuring comparable therapeutic effects. Single dose studies to document BE were preferred because they are generally more sensitive in assessing in vivo release of the drug substance from the drug product when compared to multiple dose studies. The following are the circumstances that demand multiple-dose study/steady state pharmacokinetics:&#xD;
&#xD;
&#xD;
	Dose- or time-dependent pharmacokinetics.&#xD;
	For modified-release products for which the fluctuation in plasma concentration over a dosage interval at steady state needs to be assessed.&#xD;
	If problems of sensitivity preclude sufficiently precise plasma concentration measurements after single-dose administration.&#xD;
	If the intra-individual variability in the plasma concentration or disposition precludes the possibility of demonstrating BE in a reasonably sized single-dose study and this variability is reduced at steady state.&#xD;
	When a single-dose study cannot be conducted in healthy volunteers due to tolerability reasons and a single-dose study is not feasible in patients.&#xD;
	If the medicine has a long terminal elimination half-life and blood concentrations after a single dose cannot be followed for a sufficient time.&#xD;
	For those medicines that induce their own metabolism or show large intra-individual variability.&#xD;
	For combination products for which the ratio of plasma concentration of the individual substances is important.&#xD;
	If the medicine is likely to accumulate in the body.&#xD;
	For enteric coated preparations in which the coating is innovative.&#xD;
&#xD;
&#xD;
Under normal circumstances, blood should be the biological fluid sampled to measure drug concentrations. Most drugs may be measured in serum or plasma; however, in some drugs, whole blood (e.g., tacrolimus) may be more appropriate for analysis. If the blood concentrations are too minute to be detected and a substantial amount (40%) of the drug is eliminated unchanged in the urine, the urine may serve as the biological fluid to be sampled (e.g., alendronic acid).&#xD;
&#xD;
Pharmacodynamic endpoint studies&#xD;
Pharmacokinetic studies measure systemic exposure but are generally inappropriate to document local delivery BA and BE. In such cases, BA may be measured, and BE may be established, based on a pharmacodynamic study, providing an appropriate pharmacodynamic endpoint is available. Pharmacodynamic evaluation is measurement of the effect on a pathophysiological process, such as a function of time, after administration of two different products to serve as a basis for BE assessment. Regulatory authorities request justification from the applicant for the use of pharmacodynamic effects/parameters for the establishment of BE criteria. These studies generally become necessary fewer than two conditions 1) If the drug and/or metabolite(s) in plasma or urine cannot be analyzed quantitatively with sufficient accuracy and sensitivity; 2) If drug concentration measurement cannot be used as surrogate endpoints for the&#xA0;&#xA0;demonstration of efficacy and safety of the particular pharmaceutical product. The other important specifications for pharmacodynamic studies include:?&#xD;
&#xD;
&#xD;
	A dose-response relationship should be demonstrated;&#xD;
	Sufficient measurements should be taken to provide an appropriate pharmacodynamic response profile;&#xD;
	The complete dose-effect curve should remain below the maximum physiological response;&#xD;
	All pharmacodynamic measurements/methods should be validated for specificity, accuracy, and reproducibility. Examples of these pharmacodynamic studies include locally acting drug products and oral inhalation drug products, such as metered dose inhalers and dry powder inhalers, and topically applied dermatologic drug products, such as creams and ointments.&#xD;
&#xD;
&#xD;
Bronchodilator drug products, such as albuterol metered dose inhalers, produce relaxation of smooth muscle of the airways. For these drug products, a pharmacodynamic endpoint, based either on increase in forced expiratory volume in 1 second (FEV1) or on measurement of PD20 or PC20 (the dose or concentration, respectively, of a challenge agent) is clinically relevant and may be used for BA and BE studies.&#xD;
&#xD;
Clinical endpoint studies or comparative clinical trials &#xD;
In the absence of pharmacokinetic and pharmacodynamic approaches, adequate and well-controlled clinical trials may be used to establish BA/BE. Several international regulatory authorities provide general information about the conduct of clinical studies to establish BE.&#xD;
&#xD;
In vitro endpoint studies &#xD;
More recently, a Biopharmaceutics Classification System (BCS) has categorized&#xA0;drug substances as having either high or low solubility or permeability and drug products as exhibiting rapid dissolution. According to this approach, drug substances may be classified into four primary groups:&#xD;
&#xD;
1) Highly soluble and highly permeable;&#xD;
2) Highly permeable and poorly soluble;&#xD;
3) Highly soluble and poorly permeable;&#xD;
4) Poorly soluble and poorly permeable.&#xD;
&#xD;
Using this BCS approach, a highly permeable, highly soluble drug substance formulated into a rapidly dissolving drug product may need only in vitro dissolution studies to establish BE. In addition, in vitro approaches to document BE for nonbioproblem drugs approved before 1962 remain acceptable as per FDA regulations. Dissolution tests can also be used to reduce the number of in vivo studies in other circumstances, and to i) Assesses batch-to-batch quality and support batch release; ii) Provide process control and quality assurance; and iii) Assess the need for further BE studies relative to minor post-approval changes, where they function as a signal of bioinequivalence. The broad spectrum of BA/BE in vitro studies specifications were provided by each regulatory authority. 9-18&#xD;
&#xD;
Statistical Analysis of Bioequivalence: &#xD;
In the analysis of a bioequivalence study, the measurements of both Cmax and AUC are subject to the following procedure. The measurement for each subject is log transformed and the averages, &#xB5;T and &#xB5;R, of the test and reference products are calculated. The within subject variability of the reference product, &#x3C3; 2 WR, is also calculated. There are two parts to the proposed bioequivalence criteria, a scaled average bioequivalence evaluation and a point estimate constraint. In order to demonstrate bioequivalence both parts must pass. Scaled average bioequivalence for both AUC and Cmax&#xA0;is evaluated by testing the following null hypothesis H0: [(&#xB5;T- &#xB5;R) 2 / &#x3C3;2 WR] &gt; ? (For given ? &gt; 0) versus the alternative hypothesis H1: [(&#xB5;T- &#xB5;R) 2 / &#x3C3;2 WR] &#x2264;? where &#xB5;T and &#xB5;R are the averages of the logtransformed measure (Cmax, AUC ) for the test and reference products, respectively; usually testing is done at level &#x3B1;=0.05; and ? is the scaled average BE limit. Furthermore, ?= (ln?) 2 / &#x3C3;2 Wo Where ? is 1.25, the usual average BE upper limit for the untransformed test/reference ratio of geometric means, and &#x3C3;2 Wo =0.25. Note that rejection of the null hypothesis H0 supports the conclusion of equivalence. A 95% upper confidence bound for [(&#xB5;T- &#xB5;R) 2 / &#x3C3; 2 WR] determined in a BE study must be &#x2264;? or equivalently, a 95% upper confidence bound for (&#xB5;T- &#xB5;R) 2 / ?&#x3C3;2 WR must be &#x2264;0. Additionally, the point estimate (test/reference geometric mean ratio) must fall within [0.80, 1.25]. The test drug must pass both conditions before it is judged bioequivalent to the reference product. 19&#xD;
&#xD;
HIGHLY VARIABLE DRUGS AND DRUG PRODUCTS &#xD;
In bioequivalence evaluation, highly variable drugs are generally defined in the context of within-subject variability in bioequivalence parameters Cmax and AUC. The most oftenused definition of a highly variable drug is a drug which has a within-subject (synonymous with ?intra-subject?) variability of 30% or more in these two bioequivalence parameters. FDA&#x2018;s Office of Generic Drugs (OGD) estimates that approximately 10% of the submitted BE studies from Abbreviated New Drug Applications (ANDAs) showed some evidence of high variability. Examples exist where a highly variable reference product failed&#xA0;to demonstrate BE when compared to itself in a BE study using the standard design/sample size. As illustrated in Figure 2, because of this high variability, larger numbers of subjects may be needed in bioequivalence studies to give adequate statistical power to meet FDA bioequivalence limits. The FDA is currently investigating bioequivalence study design proposals that can reduce the number of subjects needed for a bioequivalence study.19-20 HVDs show variable pharmacokinetics as a result of their inherent properties (e.g. distribution, systemic metabolism and elimination). A drug may have low variability if it is administered intravenously, whereas it can be highly variable after oral administration. In such cases, the source of the high variability can be any of the processes that are involved in the absorption, such as problematic solubility, gastrointestinal instability, active transport or first-pass metabolism in the gut or liver. Davit et al. recently reviewed 1010 bioequivalence studies of 180 drugs, of which 31% (57 of 180) were highly variable.13 About 60% of the surveyed drugs were highly variable as a result of the pharmacokinetic characteristics of the drug substances. Several physicochemical and pharmacokinetic factors were considered that can potentially contribute to the observed high variation, such as low aqueous solubility, acid liability, low bioavailability (F), pronounced food effect and so on. Analysis of the data revealed that extensive first-pass metabolism was probably the most important factor. Eighty-three percent of the HVDs were subject to extensive first-pass metabolism, whereas the corresponding proportion in the non-highly variable group was 21%. In addition, the variability may be caused by the pharmaceutical form in which the drug is contained. In this case, different formulations of the same drug may show different within-subject variabilities (e.g. nadolol). The distinction between HVDs and HVDPs is especially important with modified release dosage forms and in formulations of poorly soluble drugs (Biopharmaceutics Classification System classes II and IV), where the formulation factors are more important. Davit et al. related the variabilities of dissolution performance to those of bioequivalence parameters. The results suggested that in about 20% of the highly variable cases, the performance of drug formulations could contribute to the high variation. 13, 20&#xD;
&#xD;
The factors described above influence bioequivalence parameter variability due to the characteristics of the drug substance, rather than those of the drug product. Drug product formulation can also contribute to high variability in bioequivalence parameters. For example, if the rate of drug release from the dosage form is highly variable, this factor may cause high variability in bioequivalence parameters and may signify a product with lower product quality. Figure 3 diagrams the steps involved in bioequivalence evaluation of oral dosage form performance and illustrate ways in which high within-subject variability in bioequivalence measures can arise from either the drug substance or the drug product.13&#xD;
&#xD;
Identification of Highly Variable Drugs &#xD;
The RMSE (Root Mean Square Error) values of the bioequivalence parameters Cmax and AUC0-t was used as an estimate of within-subject variability. Since most of the studies submitted to the DBE (Division of Bioequivalence) used a two-way crossover design; it was not possible to determine the true within-subject variability. Therefore, the RMSE was used as an estimate of within-subject variability. Since highly variable drugs are defined as drugs with within subject variability of 30% or more in bioequivalence parameters, we considered a drug to have high within-subject variability if the RMSE for either AUC0-t or Cmax was &#x2265;0.3.&#xD;
&#xD;
Although the FDA evaluates AUC&#x221E; in bioequivalence studies, but did not define a highly variable drug as one for which the AUC&#x221E; RMSE&#x2265;0.3 because the calculations necessary to extrapolate to infinity contribute to the variability of this measure. Therefore, we consider AUC0-t to be a better indicator of variability due to drug substance and/or drug product than AUC&#x221E;. Table 2 shows the number of bioequivalence studies, drug products, and drugs reviewed by the DBE in 2003&#x2013;2005. During this time period, the DBE found acceptable 1,010 bioequivalence studies. These 1,010 bioequivalence studies investigated a total of 524 different drug products, for 180 different drugs. Frequently, there are at least several generic versions of any one reference listed drug under review at the OGD during the same time period. Each new generic drug product line is usually the subject of a separate ANDA. Most ANDAs contain at least two bioequivalence studies, one under fasting conditions and one under fed conditions. A minority of ANDAs contains either one fasting bioequivalence study or one fed bioequivalence study. In 111 of these 1,010 acceptable studies, the RMSE was &#x2265;0.3 for either Cmax and/or AUC0-t. As our criteria for classification as a highly variable drug was that the RMSE&#x2265; 0.3 for Cmax and/or AUC0-t, we concluded that 111 or 11% of these studies were of drug products that showed high variability in bioequivalence parameters. These 111 studies of highly variable drugs were of 101 different drug products, representing 57 different drugs. 13 Determination of whether high variability in bioequivalence parameters was consistent We further classified drugs for which the RMSE for Cmax and/or AUC0-t&#x2265;0.3 as consistently highly variable, borderline highly variable, or inconsistently highly variable. Table 3 was subject to extensive first pass metabolism). As these are properties of, or factors influencing, the disposition of the drug substance, we concluded that 61% of the highly variable drugs reviewed in 2003&#x2013;2005 were likely highly variable due to drug substance characteristics. Notably, several drugs in each of the following classes were in the consistent and borderline highly variable groups: angiotensin converting enzyme (ACE) inhibitors, calcium channel blockers, 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) inhibitors, and bisphosphonates. All of the ACE inhibitors reviewed during the 2003&#x2013;2005 period are inactive prodrugs that undergo extensive first-pass metabolism. The calcium channel blockers and HMG-CoA inhibitors reviewed during this period are also known to undergo extensive first pass metabolism. The bisphosphonate drugs reviewed during this period are reported to have absolute oral bioavailability averaging less than 1%. Thus, for some potential generic drug products, it may be possible to predict whether variability in bioequivalence parameters will be high based on what is known about the physicochemical and dispositional characteristics of the drug class in general. 13&#xD;
&#xD;
Significance of the HVD Problem; &#xD;
Although the problem is well known, it is still very difficult to get hard figures about its extent. An overview of FDA submissions showed that about 15% of the applications fell into the category of HVDs. At first sight, the issue of HVDs did not appear to be so serious, because all submitted applications for HVDs passed the 0.80&#x2013;1.25 regulatory criterion. However, this regulatory experience was not shared by other parties involved in generic drug development. An overview of the database of a well known Canadian contract research organization showed a considerably different picture. In a review of 580 studies, 105 fell into the highly variable category. The failure rate was 54%. A very similar figure was reported by another large Canadian contract research&#xA0;organization. It appears that only bioequivalence studies meeting the regulatory expectations were submitted by applicants and, consequently, the regulatory agencies could have underestimated the seriousness of the HVD problem. Some studies are not undertaken at all when the very heavy financial and logistical difficulties are confronted. Diliberti presented a case where the within subject variation was 173%for the Cmax and 157%for the AUC at time t (AUCt). He estimated that at least 598 subjects would be needed to meet the 0.80&#x2013;1.25 criterion with 80% power. The issue of bioequivalence for hvds is not only a problem for the generic industry It has been implicitly assumed until this point that the single role of bioequivalence studies is to gain marketing authorization for generic products. That is not so. For example, it is very common that a drug formulation used in early clinical studies is different from that applied in the late, pivotal investigations. In this case, the innovator company performs a ?bridging&#x2018; bioequivalence study in order to demonstrate that the formulation change does not have a clinically significant impact. These studies are typically powered to meet the 0.80&#x2013;1.25 bioequivalence criterion, partly because of the convention and partly because at that stage of product development, there are no firm clinical safety data. Also, following Hauschke et al. and Steinijans et al. the paradigm of bioequivalence is used to evaluate the drugdrug and drug-food interactions. In the case of drug interactions, the lower and upper limits of the bioequivalence ranges could be different from 0.80 and 1.25, and alternative ?effect boundaries&#x2018; could be allowed on the basis of concentration response relationships, pharmacokineticpharmacodynamic models or other available information. For example, a lack of a food effect is not considered to be established if the CI is outside the 0.80&#x2013;1.25 limits. Altogether, if a new drug has highly variable features, then to establish bioequivalence between formulations used in the product development process or to demonstrate dose linearity can be a difficult and expensive challenge. For these reasons, HVDs are not just a problem for the generic industry but are also a source of substantial concern to the innovators. However, compared with generic producers, regulatory agencies are rather tolerant to the innovators&#x2018; request for post hoc widening based on clinical grounds. Because of this, concerns of innovators about large sample sizes are much less apparent. 21&#xD;
&#xD;
Proposals from the Literature As indicated, the bioequivalence criteria in the U.S. recommend that the 90% confidence interval of the geometric mean ratio between the test and reference products fall within 80-125%. Over the years, various suggestions have been made in an attempt to alleviate the difficulty of meeting the bioequivalence limits for highly variable drugs and drug products. Various authors have explored the use of replicate designs or group-sequential designs. If a subject-by-formulation interaction is negligible, the sample size required for a replicate design study can be reduced up to 50% of that for a non-replicate design study the number of study periods is the same since approximately half the usual number of subjects is used but they are each studied for twice as many periods. Therefore, it takes a longer time to complete a replicate design study, resulting in an increased chance of subject dropout from the trial. A group-sequential design may be useful in cases where there is uncertainty about the estimates of variability. Nonetheless, the total number of subjects employed with this design may be the same as that used for a study without the group-sequential design if the interim&#xA0;analysis does not indicate bioequivalence. Also, to preserve the overall Type I error rate of 5%, a higher level of confidence interval has to be used at each stage of the interim analysis.22 Several proposals are available in the literature to modify the existing bioequivalence criteria for highly variable drugs and drug products. In general, these various criteria are based on either the reduction of the level of the confidence interval or an increase of the width of the equivalence limits, or both. The level of confidence interval reflects the degree of consumer risk (Type I error in statistical terms) that can be tolerated by the regulatory agencies. A reduction in the level of confidence interval, for example, from 90% to 85%, implies a possible increase in the consumer risk, which would not be in the best interests of public health. In contrast, the width of equivalence limits represents the allowable boundary for the ratio (or difference) of the means between products in comparison. Any adjustment of these limits should be based on consideration of the statistical properties of the data as well as on the clinical characteristics of the individual drug. Statistically, widening the bioequivalence limits can be accomplished through expansion of the allowable boundary or by scaling the criteria based on the high variability of the reference product. 23-24&#xD;
&#xD;
PROPOSED SOLUTIONS FOR THE PROBLEM OF HVD &#xD;
Relaxation of the Regulatory Requirement: Health Canada generally expects only that the point estimate of the GMR (Geometric Mean Ratio) for the Cmax, but not its 90% CI, should be between the regulatory limits of 0.80 and 1.25. This relaxed requirement applies generally and is not aimed specifically at HVDs. Nevertheless, it enables satisfactory determination of bioequivalence for several HVDs because the variation of the Cmax is usually higher than that of the AUC, and therefore the determination of bioequivalence can often fail because of the wide CI of the Cmax. 21 Widening of Bioequivalence Limits Based on Reference Variability The bioequivalence limits for these methods are not determined by the sample size. Rather, they will be scaled based on the within-subject variability of the reference product. For both Methods 2 and 3 below, a side condition to constrain the mean difference between the test and reference products has also been proposed&#xD;
&#xD;
Method 1: &#xD;
The rationale for this approach is that a mean difference of 25% is considered small relative to the range of values an individual may experience when the within-subject variability is high, e.g., 40%. Therefore, the acceptable limits may be scaled in relation to the size of within-subject variability as follows: [U, L] = Exp [&#x3C3;WR] Where U and L are the upper and lower limits, respectively; k represents the pth percentile of the standard normal distribution, Zp; and WR is the estimated within-subject standard deviation (obtained from the ANOVA on the log scale) for the reference. When k = 1, ~ 67% of the pharmacokinetic measures (such as AUC) experienced by an individual will be within the range of [U, L]. Table 4 lists the choices of limits at k = 1.&#xD;
&#xD;
Method 2:&#xD;
A scaled average bioequivalence criterion has been proposed [(&#xB5;T- &#xB5;R) 2 / &#x3C3; 2 WR] &#x2264;? Where &#xB5;T and &#xB5;R are the averages of the logtransformed measure for the test and reference products, respectively; and ? is the bioequivalence limit. Comparing Methods 1 and 2, it can be seen that k = ? -1/2 = (ln1.25)/ &#x3C3;2 Wo where W0 is the cutoff within-subject standard deviation for scaling. Relationship of k and &#x3C3;W0 are given in Table 5.&#xD;
&#xD;
Method 3: &#xD;
Derived from the comparison of the distance measure between the test and reference products, the following individual bioequivalence criterion has a reference variance in the denominator, and thus is scaled to the reference variability. [(&#xB5;T- &#xB5;R) 2 + (&#x3C3;2 WT- &#x3C3; 2 WR) + &#x3C3;2D]/ &#x3C3;2 WR &#x2264;? Where WT is the estimated within-subject standard deviation for the test product; 2D is the subject-by-formulation interaction variance component; and I is individual bioequivalence limit. Although theoretically sound, the individual bioequivalence criterion requires replicate designs and inclusion of target population in the study. Because of these resource implications, the FDA has recommended the continued use of an average criterion to compare bioavailability measures.22-27&#xD;
&#xD;
Direct Expansion of Bioequivalence Limits Sample size in bioequivalence studies is determined in large part by the bioavailability parameter with the highest variability. In most cases, Cmax has higher variability than AUC. Thus, widening of the bioequivalence limits for Cmax has been proposed to reduce the sample size needed in the evaluation of bioequivalence for highly variable drugs/products. The greater variability observed with Cmax may result from the fact that this parameter is a single point measurement, which is highly dependent on the sampling time/frequency and elimination rate of the drug. The EMEA currently allows for expanded limits (e.g., 69.84-143.19%) for Cmax in certain cases where no safety or efficacy concern arises, based on the consideration of higher variability for this measure as compared to AUC.15 Expansion of Bioequivalence Limits Based on Fixed Sample Size This method was proposed based on the notion that only a reasonable number of subjects should be required for a bioequivalence study.23, 28 The number of subjects is fixed by a standard two-period, crossover study comparing the reference product with itself where the study fails to meet the 80-125% limit. The confidence interval obtained from the reference product in this study would become the ?goalposts? for the subsequent studies comparing the test with reference product, using the same number of subjects. Expansion of Bioequivalence Limits Based on Sample Size and Scaling In addition to fixing the sample size, this method takes into consideration the producer&#x2018;s risk (Type II error) and reference variability.23 the equation for the allowable limits is: [U, L] = Exp [&#xB1; (t&#x3B1; + t&#x3B2;/2) n -1/2 &#x3C3; WR] &#x2026;&#x2026;. (Eq.1) Where &#x3B1; and &#x3B2; are the consumer and producer risks, respectively; 2n is the number of subjects desired in the study; and t is the percentile of the t-distribution with 2n-2 degrees of freedom. The current regulatory standard has kept the consumer risk at a level of no more than 5% while allowing the drug applicant or sponsor to control its own producer risk. Based on Eq. 1, for example, assuming a 5% consumer risk and 10% producer risk, the proposed bioequivalence limits for a typical sample size of 24 subjects will be (0.74, 1.35) at &#x3C3; WR = 0.3 (0.61, 1.65) at &#x3C3; WR = 0.5 Recent Considerations by Regulatory Agencies Although global harmonization is a general goal, to date, bioequivalence has not been accepted as a topic by the International Conference on Harmonization (ICH). Nonetheless, the resource and ethical concerns for highly variable drugs/products in bioequivalence are generally recognized by international regulatory agencies. It is thus useful to review the differing regulatory approaches before an informed recommendation is made on the topic. The&#xA0;following outlines the bioequivalence standards used in different regions: In Canada, for drugs with uncomplicated characteristics, a 90% confidence limit of 80- 125% is required for AUC. However, a limit is placed only on the means (or point estimate) for Cmax) 11. As a result of random variation or a larger than expected relative difference, the sponsor may add more subjects. If this option is chosen, it must be stated in the study protocol. In addition, two criteria must be met before combining is acceptable: 1) The same protocol must be used; and 2) Consistency tests must be met at an alpha error rate of five percent. The European Agency for the Evaluation of Medicinal Products (EMEA) has similar bioequivalence standards to those in the FDA, i.e., 90% confidence limits of 80-125% on AUC and Cmax, with the qualification that these limits may be expanded in certain cases for Cmax (e.g., 69.84-143.19%) provided that there is no safety or efficacy concerns.15 In Japan, the bioequivalence standards also rely on the 90% confidence limits of 80-125% for both AUC and Cmax, although wider limits are allowed for less potent drugs. Additionally, if the confidence limits are outside of 80-125%, bioequivalence may be claimed on the grounds that the study meets. 10 All three conditions listed below: 1) The total number of subjects in the initial bioequivalence study is no less than 20 (n=10/group), or pooled sample size of the initial, 2) The differences in average values of logarithmic AUC and Cmax between two products are between log (0.9) &#x2013; log (1.11); and 3) Dissolution rates of test and reference products are determined to be equivalent under all dissolution testing conditions specified. Japan allows the addition of subjects to increase the power of a failed bioequivalence study. However, the add-on subjects cannot be less than half the number in the original study. South Africa accepts an acceptance interval of 75-133% for Cmax, except for narrow therapeutic range drugs, when an acceptance interval of 80-125% applies. For highly variable drugs, a wider interval or other appropriate measure may be acceptable, but should be stated a priori and justified in the protocol.25&#xD;
&#xD;
Evaluation of Bioequivalence with SABE &#xD;
Regulatory authorities appear to move towards adopting the approach of scaled average bioequivalence (SABE) as a tool for dealing with the problem of bioequivalence for HV drugs. Therefore, a brief background of the procedure will be summarized. The two one-sided tests procedure is generally applied for determinations of bioequivalence. In practice, BE is evaluated by calculating logarithmic quantities. Thus, means and standard deviations of the logarithmic data (&#xB5; and &#x3C3;) are estimated. Bioequivalence is declared if the difference between the logarithmic averages is between limits (BELA) which are preset by regulatory authorities. Therefore, average bioequivalence (ABE) is accepted if the following criterion is satisfied:&#xD;
- BELA &#x2264; &#x3BC;T - &#x3BC;R &#x2264; BELA The most usually applied regulatory limit is: BELA = ln (1.25) (1A) This assures the earlier stated expectation that the regulatory limits for the ratio of geometric means of metrics are 0.80 and 1.25. In practice, the 90% confidence interval around the difference between the estimated logarithmic averages should be between the regulatory limits. Thus, regulators need to define, in the case of average BE, a single criterion for declaring bioequivalence such as that given in Eq. (1A). For highly-variable drugs, evaluated by scaled&#xA0;average BE, two quantities must be defined. They will be discussed below: The regulatory criterion suggested for the application of scaled average BE is: -BELS &#x2264; (&#x3BC;T-&#x3BC;R)/&#x3C3;W &#x2264; BELS (2) Here a scaling standard deviation (&#x3C3;W) is related to the within-subject standard deviation of the reference formulation (&#x3C3;WR) or, in other views, is identical to it. This distinction will be discussed later. Tothfalusi et al. suggested that the scaled BE limits (BELS) should be set in the following form: BELS = ln (1.25)/&#x3C3;0 (2A) Here &#x3C3;0 is the first measure which should be defined by regulators. It will be referred to as the regulatory standardized variation. It defines the proportionality factor between the logarithmic BE limits and &#x3C3;W in the highly-variable region (see Figure 4A). &#x3C3;0 uniquely determines BELs and vice versa. For example, when &#x3C3;0 = 0.294 then BELs is 0.759, and when &#x3C3;0 = 0.246 then BELs is 0.907. Rearranging equation (2), an alternative form is obtained: -BELs &#x3C3;W &#x2264; &#x3BC;T-&#x3BC;R &#x2264; BELs &#x3C3; This form represents average bioequivalence with expanding limits (ABEL). Consequently, Eq. 2 and Eq. 2B, i.e. the approaches of SABE and ABEL, are (almost) identical. Using the limits of ABEL helps to understand the properties of SABE from the perspective of ABE. In this context, the regulatory standardized variation (&#x3C3;0) defines the proportionality factor between the logarithmic ABEL limits and &#x3C3;W (Figure 1A). A representation of ABEL conveniently illustrates a mixed regulatory strategy that was proposed for applying the unscaled and scaled approaches to the determination of BE (Figure 4). According to the mixed regulatory strategy, a second regulatory term, the so-called switching variation (CVS), separates regions of low and high variabilities. If the variation of the drug is low, i.e., when it does not exceed the switching variation (CVW &#x2264; CVS) then, following the present practice, unscaled average BE should be evaluated. However, for HV drugs when the variability is higher than the switching variation (CVW &gt; CVS), scaled average BE is applied. The mixed regulatory strategy is depicted in Figure 4 where, for illustrative purposes, SABE equivalent ABEL limits (BELE* &#x3C3; ) are plotted. Two different SABE-equivalent ABEL limits are shown which correspond to two different values of &#x3C3;0. How to set &#x3C3;0 is the main focus of this communication. The standard deviations (&#x3C3;) can be converted, approximately, to the corresponding coefficients of variation: CV = 100[exp (&#x3C3;2 )-1)] 1/2 (3) Therefore, for unified and convenient treatment, the regulatory constants are expressed in terms of coefficients of variation. As an alternative notation, CV0 will be used instead of &#x3C3;0 and the transformation rule between CV0 and &#x3C3;0, given by Eq. 3, will be applied. For example, if &#x3C3;0 = 0.294 then CV0 = 30%, and when &#x3C3;0 = 0.246 then CV0 = 25%. The advantage of this unified notation is that an additional GMR restriction rule also can be expressed in relative terms. The&#xA0;0.80-1.25 GMR restriction criterion becomes a regulatory constraint of 25%. Thus, in our notation, the proposed mixed approach depends on three regulatory constants, CVs, CV0 and CVGMR, with typical values of 30%, 30% and 25%.19-29 Considerations on the implementation of scaled average bioequivalence: the recommendations of FDA As noted earlier, the Advisory Committee for Pharmaceutical Sciences discussed the topic repeatedly. At its meeting, on October 6, 2006, important presentations were offered on behalf of the FDA Working Group on Highly Variable Drugs (16-18). The interim recommendations of&#xA0;FDA were further clarified on May 22, 2007 at an AAPS/FDA workshop. The current proposals of FDA and their quantitative characteristics were published very recently. FDA has proposed to apply the approach of reference-scaled average BE for determining the BE of HV drugs. This means that &#x3C3;W = &#x3C3;WR would be adopted for scaling. FDA suggests also that the acceptance criteria include a constraint on the point estimate for the ratio of geometric means (GMR). It recommends that GMR be limited to the range of 0.80 to 1.25. The Advisory Committee concurred with this proposal but some members actually favoured a narrower range. FDA proposes that both AUC and Cmax should satisfy the BE acceptance criteria. FDA recommends that three-period BE studies be performed in which the reference product (R] is provided twice and the test product (T) is given once. Consequently, the possible sequences of drug administration are TRR, RRT, and RTR. The FDA Working Group performed simulations in order to ascertain the features of the above proposals. The current FDA recommendations include a value of &#x3C3;0 = 0.25. FDA suggests also that unscaled average BE used if the within-subject variability is less than 30%, and that reference-scaled average BE applied if the within-subject variability is at least 30%. These suggestions correspond to a switching coefficient of variation of CVS = 30%.19-29 Proposed Study Design For drugs with an expected within-subject variability of 30% or greater, a BE study with three-period, reference- replicated, crossover design with sequences of TRR, RTR, and RRT is proposed. Specifically, subjects receive a single dose of the test product once and reference product twice on separate occasions with random assignment to the three possible sequences of product administration. This partial replicate design allows for the estimation of within subject variability for the reference product. Treatments should be separated by a washout period of adequate duration such that the drug of interest can no longer be detected in plasma. Subjects recruited for in vivo BE studies should be 18 years of age or older and capable of giving informed consent unless otherwise indicated by a specific guidance. It is the sponsor&#x2018;s responsibility to determine the sample size needed to achieve the desired power in a study; however, the minimum number of subjects that would be acceptable is 24. The three-period design was selected over a four-period design because of efficiency. The only advantage of the four period designs is that it allows the calculation of the variability of the test product. The test product variability is not used in the proposed statistical method. Some concern has been raised that an ANDA sponsor may produce a product that has higher variability than the reference product. However, under the recommended design, ANDA&#xA0;sponsors that design a product of lower variability than the reference product will need a smaller number of subjects to pass. A disadvantage of the four-period design is that the dropout rate for studies increases with the length of the study. Nevertheless, sponsors may use the four-period design to demonstrate the BE for their highly variable drug products.&#xD;
&#xD;
DISCUSSION AND CONCLUSION &#xD;
The impact of Cmax variability on the determination of bioequivalence, as well as the possible approaches to resolving this issue has been discussed extensively in the published literature. Major regulatory agencies have provisions in their regulations which can accommodate the effect of higher variability associated with cmax on the design of bioequivalence studies. For example, health&#xA0;canada does not require any limits on the confidence interval for cmax, although limits are placed on the point estimates for this parameter. the EMEA and Medicines Control Council of South Africa both allow for expanded limits for cmax in certain cases provided that there are no safeties or efficacy concerns. Similarly, the Japanese division of drugs accepts limits greater than 80 &#x2013; 125%, ?for drugs with pharmacologically mild actions?. Additionally, a failed bioequivalence study can utilize additional subjects to increase power and the likelihood of meeting be criteria, provided other conditions are met. This report presents a proposal for the BE evaluation of highly variable drugs and drug products. This new approach addresses many of the concerns about the BE of highly variable drugs/products that have been raised for the past several years. The proposed approach adjusts the BE limits of highly variable drugs/products by scaling to the within subject variability of the reference product in the study. The recommendation for the use of reference-scaling is based on the general concept that reference variability should be used as an index for setting the public standard expressed in the BE limit. Furthermore, for drugs and products that are highly variable, reference-scaling effectively decreases the sample size needed for demonstrating BE. The additional requirement of a point-estimate constraint will impose a limit on the difference between the test and reference means, thereby eliminating the potential that a test product would enter the market based on a bioequivalence study with a large mean difference. The use of the reference-scaling approach necessitates a study design that evaluates the reference variability, via multiple administration of the reference treatment to each subject. The recommended 3-period design is the most efficient way to obtain this information. The proposed approach will resolve a number of issues in the BE evaluation of highly variable drugs while achieving the FDA&#x2018;s mission of ensuring that all the drugs approved for use in U.S. are both safe and effective.&#xD;
&#xD;
ACKNOWLEDGMENTS &#xD;
I am indebted to my esteemed guide Dr. Anil Bhandari (Dean, Faculty of Pharmaceutical Sciences, Jodhpur National University) for his excellent guidance, export suggestions, encouragement, support, lively discussion, constructive criticism, insightful corrections and everlasting interest in pharmacology and.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1853</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1853</Fulltext></URLs><References>1. Asif M. Tamboli, Pavan Todkar, Priti Zope, Sayyad FJ. An Overview on Bioequivalence: Regulatory Consideration for Generic Drug Products. J Bioequiv Availab 2010; 2(4): 086-092.&#xD;
&#xD;
2. Biomarkers and Surrogate Endpoints: Advancing Clinical Research and Applications. National Institutes of Health and the Food and Drug Administration Conference. April 15&#x2013;16, 1999, Bethesda, Maryland.&#xD;
&#xD;
3. US Code of Federal Regulations Title 21, Section 320.1(e). US Government Printing Office, Washington, DC, 2006.&#xD;
&#xD;
4. US Food and Drug Administration. Guidance for Industry: Bioavailability and Bioequivalence Studies for Orally Administered Drug Products&#x2014;General Considerations, March 2003.&#xD;
&#xD;
5. Patterson SD, Zariffa NMD, Montague TH, Howland K. Non-traditional study designs to demonstrate average bioequivalence for highly variable drug products. Eur J Pharm Sci 2001; 57:663-670&#xA0;&#xD;
&#xD;
6. Schuirmann DJ. A comparison of the two one-sided tests procedure and the power approach for assessing the equivalence of&#xA0;average bioavailability. J Pharmacokinet Biopharm 1987; 15:657-680.&#xD;
&#xD;
7. U. S. Food and Drug Administration. Guidance for Industry: Statistical Approaches to Establishing Bioequivalence, January 2001.&#xD;
&#xD;
8. FDA Orange Book, Preface p. viii. http://www.fda.gov/cder/ob/ default.htm. Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
9. Therapeutic Goods Administration. CPMP Guideline "As adapted in Australia by the TGA" With Amendment - Note for Guidance on the Investigation of Bioavailability and Bioequivalence (CPMP/EWP/QWP/1401/98). Effective 10 April 2002. http:// www.tga.gov.au/docs/pdf/euguide/ewp/1401 98entga.pdf. Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
10. Guideline for Bioequivalence Studies of Generic Products (December, 2006). National Institute of Health Sciences. Japan NIHS. http://www. nihs.go.jp/drug/be-guide (e)/be2006e.pdf. Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
11. Canadian Health Protection Branch (HPB), Health Canada. Guidance for Industry Conduct and Analysis of Bioavailability and Bioequivalence Studies &#x2013; Part A: Oral Dosage Formulations Used for Systemic Effects. Published by authority of the Minister of Health. 1992. Health Products and Food Branch Guidance Document. http://www.hc-sc.gc.ca/dhpmps/alt_formats/hpfbdgpsa/pdf/prodpharma/bio-a-eng.pdf. Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
12. Asean Guidelines for the Conduct of Bioavailability and Bioequivalence Studies. http://www.suregmp.com/forum/file_down_ ok.asp?Folder=PDSandDownFile=Bioavailabi lty_Bioequivalence%20Stdies.pdf. Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
13. Davit BM, Conner DP, Fabian-Fritsch B, et al. Highly Variable Drugs: Observations from Bioequivalence Data Submitted to the FDA for New Generic Drug Applications. AAPS J 2008; 10(1):148-156.&#xD;
&#xD;
14. Medicines Control Council. Biostudies. June 2007. http://www.mccza.com/generic Documents/2.06_Biostudies_Jun07_v2.zip. Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
15. European Medicines Agency. London, 24 May 2007. Doc. Ref. EMEA/ CHMP/EWP/200943/2007. Committee for Medicinal Products for Human Use (CHMP). Recommendation on the Need for Revision of (CHMP).Note For Guidance on the Investigation of Bioavailability and Bioequivalence. CPMP/EWP/QWP/1401/98. http://www.ema.europa.eu/docs/en_GB/doc ument_library/Scientific_guideline/2009/09/ WC500003009.pdf Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
16. European Medicines Agency. PreAuthorisation Evaluation of Medicines for Human Use London, 24 July 2008. Doc. Ref. CPMP/EWP/ QWP/1401/98 Rev. 1. Committee for Medicinal Products for Human Use (CHMP). Draft. Guideline on the Investigation of Bioequivalence. http://www.ema.europa.eu/docs/en_GB/doc ument_library/Scientific_guideline/2009/09/ WC500003011.pdf Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
17. Kingdom of Saudi Arabia Saudi Food and Drug Authority Drug Sector. Bioequivalence Requirements Guidelines. Draft. May 2005. http://www.sfda.gov.sa/NR/rdonlyres/6A11 4B70-4201-46EF-B4C7- 127FD66D3314/ 0/BioequivalenceRequirementGuidelines.pd f. Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
18. Guidance Document for Bioequivalence Study of Korea Food and Drug&#xA0;Administration Notification #2008&#x2013;22 (May 07, 2008). http:// betest.kfda.go.kr/country/GUIDANCE%20F OR%20INDUSTRY%20 (KFDA_2005).pdf. Accessed on dated Nov. 8, 2011.&#xD;
&#xD;
19. Haidar SH, Barbara D, Chen ML, Conner D. Bioequivalence Approaches for Highly Variable Drugs and Drug Products. Pharm Res 2008; 25(1):237-241.&#xD;
&#xD;
20. Midha KK, Rawson MJ, Hubbard JW. The bioequivalence of highly variable drugs and drug products. Int J Clin Pharmacol Ther 2005; 43 (10): 485-98.&#xD;
&#xD;
21. Tothfalusi L, Endrenyi L, Arieta AG. Evaluation of Bioequivalence for Highly Variable Drugs with Scaled Average Bioequivalence. Clin Pharmacokinet 2009; 48 (11): 725-743.&#xD;
&#xD;
22. Patterson, SD, Zariffa NMD, Montague TH, Howland K. Non-traditional study designs to demonstrate average bioequivalence for highly variable drug products. Eur J Clin Pharmacol 2001; 57:663-670.&#xD;
&#xD;
23. Boddy AW, Snikeris FC, Kringle RO, Wei GCG. Oppermann JA, Midha KK. An approach for widening the bioequivalence acceptance limits in the case of highly variable drugs. Pharm Res 1995; 12:1865- 1868.&#xD;
&#xD;
24. Tothfalus L, Endrenyi, L, Midha, KK, Rawson MJ, Hubbard. JW. Evaluation of the bioequivalence of highly variable drugs and drug products. Pharm Res 2001; 18:728- 733.&#xD;
&#xD;
25. Medicines Control Council, Department of Health, Republic of South Africa. Registration of Medicines: Biostudies. 2003&#xD;
&#xD;
26. Tothfalus L, Endrenyi L, Midha KK. Scaling or wider bioequivalence limits for highly variable drugs and for the special case of Cmax. Int J Clin Pharmacol Ther 2003; 41:217-225.&#xD;
&#xD;
27. Tothfalus L, Endrenyi L. Limits for the scaled average bioequivalence of highly variable drugs and drug products. Pharm Res 2003; 20:382-389.&#xD;
&#xD;
28. Blume H, Midha, KK. Report of Consensus Meeting: Bio-international &#x2018;92. Conference on Bioavailability, Bioequivalence and Pharmacokinetic Studies. Eur J Pharm Sci 1992; 1:165-171.&#xD;
&#xD;
29. Endrenyi L, Tothfalusi L. Regulatory Conditions for the Determination of Bioequivalence of Highly Variable Drugs. J Pharm Pharmaceut Sci 2009; 12 (1): 138 &#x2013; 149.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Figure 2: A visual representation of some possible results of the statistical analyses of bioequivalence studies. The three bars represent the widths of hypothetical 90% confidence intervals from bioequivalence studies of drugs with normal variability (green bar), low variability (blue bar), and high variability (red bar). A bell-shaped curve is superimposed over green bar, representing the 90% confidence interval, distributed around the geometric mean test/ reference ratio (?point estimate?), for the normal variability drug. For simplification, blue and red bars, respectively, are used in this diagram to represent confidence interval widths of low variability and highly variable drugs. The blue and red bars also actually represent the 90% confidence intervals of the bioequivalence study Cmax or AUC test/reference ratios normally distributed about the point estimate. The FDA concludes that a test and reference product are bioequivalent if the 90% confidence intervals (expressed as a percent) of the geometric mean Cmax and AUC test/reference ratios fall within the bioequivalence limits of 80&#x2013;125%. In this illustration, the 90% confidence interval of the normal variability drug (green bar) meets bioequivalence limits. The 90% confidence interval of the drug with low variability meets bioequivalence limits although the point estimate deviates from 1.00. For a highly variable drug, the 90% confidence interval can exceed bioequivalence limits solely because of the variability. Using more subjects in the bioequivalence study will cause the 90% confidence interval of a highly variable drug to become narrower.20&#xD;
&#xD;
&#xD;
&#xD;
Figure 3: A diagram relating solid oral dosage form performance to the in vivo system in a bioequivalence study. Once ingested, a solid oral dosage form disintegrates, then dissolves into solution (formulation stage). The dissolved drug is absorbed through the gut wall, enters the liver through the portal vein, and from the liver goes into the systemic circulation, where pharmacokinetic measurement is possible. From the systemic circulation, the drug reaches the site of activity from which one observes a clinical response, where pharmacodynamic or therapeutic measurement is possible. Although the most accurate way of determining bioequivalence would be to compare test and reference product performance at the formulation stage, this is nearly always not possible. Consequently, most bioequivalence studies of systemically absorbed drugs rely on pharmacokinetic measures, as drug blood concentrations are thought to directly relate to the amount of drug released from the dosage form. Therefore, a properly designed in vivo study with pharmacokinetic endpoints can accurately determine whether a test and reference product is bioequivalent. As the drug moves from the formulation to the systemic circulation to the site of activity, the pharmacokinetic or pharmacodynamic response becomes increasingly variable with increasing numbers of steps between the formulation, pharmacokinetic measurement stage, and pharmacodynamic measurement stage. For example, for drugs that undergo extensive presystemic metabolism, the effects of the various biotransformation(s) brought about by various gut wall and/or hepatic metabolism steps contribute to the variability observed in drug pharmacodynamic measurements. This figure also illustrates the two sources of variability in bioequivalence measures&#x2014;variability due to drug substance pharmacokinetics versus variability due to drug product performance. If high variability exists due to drug substance pharmacokinetics, it may be necessary to use large numbers of subjects to achieve an acceptable bioequivalence study. However, if the high variability is due to the formulation or dosage form performance, this may reflect either a poor quality test or reference product.13&#xD;
&#xD;
&#xD;
Figure 4: Mixed regul atory model for the determination of bioequivalence. The logarithmic BE limits, for determinations of average BE with constant and expanding limits, are shown by thick lines. If the within-subject variation (CVW) does not exceed the switching variation (CVS) then unscaled average BE is applied, and the BE limits have a constant level of &#xB1;log(1.25). When the within-subject variation is higher than the switching variations then the limits widen with increasing within-subject variation, and scaled average BE can be applied. The slope (in the logarithmic scale) of the expansion is determined by the regulatory standardized variation (CV0). The logarithmic average and the SABE-equivalent BE limits are shown by thick lines. (A) The regulatory standardized variation equals the switching variation, CV0=CVS=30% (B) the regulatory standardized&#xA0;variation is lower than the&#xA0;switching variation, CV0 = 25% and CVS = 30%. The BE limits have a discontinuity at the switching variation.19-29&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType/><ArticleTitle>AN ECONOMIC ANALYSIS OF CROP DIVERSIFICATION IN TAMIL NADU&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>147</FirstPage><LastPage>154</LastPage><AuthorList><Author>V. Kalaiselvi</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Crop diversification is considered as a resilience mechanism followed by farmers in different regions. In the present study, it is shown that there exists crop diversification of crops in various districts of Tamil Nadu State, India. This is done by constructing a crop diversification index which provides a basis for ranking the different districts. So in those regions which are more vulnerable for climatic change, more diversification of crops must be diversified in order to avoid risk of crop failure and loss of income and employment to the rural people.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords/><Fulltext>INTRODUCTION&#xD;
A society faced with diminishing natural resources and every increasing demand for food consumption and food security due to increase in population growth, agricultural intensification is the only course of action for future growth of agriculture. Agricultural intensification can be achieved by changes in cropping pattern or crop diversification. It is certainly an important component of the overall strategy for small farm development. It is usually viewed as a risk management strategy. It also provides for self provisioning in the context of nonmonetized traditional system. As market opportunities develop and or risks are somehow reduced, the enterprise mix begins to respond to market forces and it was this perspective which was more relevant in the context of altered economic environment. Agricultural diversification really started in the early eighties in India and it has picked up momentum over the recent past and farmers were always quick to diversify into higher value crops as market opportunities developed. To improve the incomes, to provide gainful employment and to stabilize the income flow, diversification of crops emerges as a major strategy. In several instances cropping systems have been diversified or new cropping systems have been introduced to retain or to enhance the value of natural resources principally land and water. There is also the claim that diversification tends to stabilize farm income at a higher and higher level. This happens when the pattern of diversification is such as to accommodate more and more rewarding crops. This is particularly important for the small farmers who strive to make their farms, viable (saleth, 1995). The study suggested the establishment of agro processing industries and infrastructural facilities, arrangement for crop protection, construction, maintenance&#xA0;and management of irrigation works, research prioritization, distribution of quality seeds and seed materials of the specific crops in the specific zone on the basis of cropping pattern and need of the people of the region. The study suggested that for achieving the gains of diversification of farming, there is an urgent need for further strengthening the required infrastructure pertaining to input supply system, marketing system and the existing research and extension programmes to increase the adoption of advanced production technologies. Saini et al., (1996) in their study on the impact of diversification on small farms economy in Kangra district of Himachal Pradesh observed that the diversification of arable farming systems with commercial enterprises such as high yielding milk animals, poultry birds, beekeeping, floriculture etc, resulted in a marked increase in the farm income from 6 to 138 per cent. Similarly the capital and credit requirement showed an increasing trend with the extent of diversification implying thereby that to diversify the existing farming systems with the most systematically, remunerative and technically feasible enterprises, adequate facilities should be made available by the financial institutions. Given the importance of crop diversification under the changing scenarios a study was undertaken to examine the crop diversification in Villupuram District, and to suggest suitable policy options for furthering the diversification towards the sustainability of agriculture in the region. A main objective of this paper is to examine the patterns of crop diversification at the district level in Tamil Nadu since 1970-71. There were several studies relating to the crop diversification towards commercial crops and most of these were carried out during mid 1990s in different states of the country. Few studies on crop diversification were also conducted in selected district of Tamil Nadu (Ajjan and Selvaraj, 1996 and Sunderasan et al., 2002). These evidences showed that there has been a significant change in the cropping pattern and a shift from low value subsistence crop to high value market oriented crops in Tamil Nadu. Since the study results reveal the district wise crop diversification, it will be useful for district level land use planning and effective implementation. This study relied on secondary data, which were collected from various issues of Season and Crop Report of Tamil Nadu. Information on area under 40 crops at district level for the period between 1970- 71 and 2005-06 were used to analyze the growth in area, level of diversification and ranking the districts based on the diversification.&#xD;
&#xD;
METHODOLOGY &#xD;
Measuring Crop Diversification There are several indices, which explain either concentration or diversification of activities in a given time and space by a single quantitative indicator. Important indices used to study the corp diversification are Herfindal Indiex, (HI), Simpson Index (SI), Ogive Index (OI), Entropy Index (EI), Modified Entropy Index (MEI) and Composite Entropy Index (CEI). Shiyani and Pandya (1998) and Sundaresan et al., (2002) had applied more than one of the above indices to study the diversification of agriculture in Gujarat and coastal districts of Tamil Nadu respectively. Joshi et al., (2004) used Simpson Index of Diversification to study the patterns of agricultural diversification in South Asia. Due to the simplicity in computation and direct interpretation, the Herfindal index was&#xA0;employed in this study to examine the level of diversification. Modified Entropy index was used to rank the districts based on the degree of diversification. The Herfindal Index is a measure of concentration. It is bounded by Zero and one: takes a value one when complete specialization and approaches to zero when there is diversification of crops. It was computed as given in equation (1); sum of squares of the acreage proportion of each crop in the total cropped area.&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
Area under 40 major crops under different categories (cereals, pulses, oilseeds, commercial crops, vegetables, fruits, spices and plantations), total cropped area in 14 composite districts (Kancheepuram, South Arcot, North Arcot, Salem, Dharmapuri, Coimbatore, Trichy, Thanjavur, Pudukottai, Madurai, Ramnad, Tirunelveli, Nilgris and Kanyakumari) and state level from 1970-71 to 2005-06 were used in this study.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Crop Diversification and Ranking the Districts &#xD;
Herfindai index is sensitive to the number of crops grown in the year and their share to the total cultivated area in the district. Hence, diversification will not be demonstrated unless the change in number of crops cultivated in the year and their share to total cultivated area in the region is adequately strong to drive the crop diversification. It is also important to note that changes in individual crop acreage as well as in total- cultivated area are taking place simultaneously, which determine the varying level of crop diversification for different regions at different points of time. Crop agriculture was found highly diversified at the state level. It was understood from Table 4 the calculated Herfinidal Index coefficient at State level, showed that the crop diversification was high (0.16) during 1970-71 and slowly moving towards diversification (0.13) during the recent period (2005-06). However, the diversification level showed variations at the districts level (Table 2). Among the districts in Tamil Nadu, Thanjavur, Kancheepuram, Pudukottai, Kanyakumari and North Arcot districts exhibited less diversification with the index coefficients of 0.54, 0.53, 0.31, 0.29 and 0.28 respectively, during the period 1970-71. Agriculture in Kancheepuram, Kanyakumari and North Arcot districts became more diversified as the Herfindal coefficients declined to 0.48, 0.13 and 0.15 respectively for the above districts during the year 2005-06. Similar trend was reported by an earlier study conducted by Sundaresan et al., (2002). But Pudukottai district has become less diversified which was indicated by the measure of diversification varying between 0.24 and 0.38 during the above periods. Area under minor millets, onion, paddy and sorghum has declined and there was a significant growth in area under green gram, sugarcane, mango and coconut in Kancheerputam distict. Similar pattern was also observed in North Arcot district. In Kanyakumari district, millets, pulses, cotton, mango and tapioca witnessed a decline in area under these crops while coconut and banana gained their acreage significantly. These changes were adequately strong to diversify the crop activities in these districts after the period 1990-91.&#xD;
&#xD;
Crop activity in Dharmapuri, tirunelveli, Madurai, Coimbatore, Salem and Trichy districts was highly diversified and this fact was supported with the coefficients of 0.08, 0.10, 0.11, 0.12, 0.13 and 0.13 respectively, for the five years interval starting from 1970-71. Among the highly diversified districts, Dharmapuri, Madurai and Salem were moving towards diversification over the years, while Coimbatore and Ramanathapuram became less diversified. Crop diversification was moderate in south Arcot presently Cuddalore and Villupuram Districts and Nilgris districts during 1970-71. Nilgris district become less diversified (specialization), which was indicated by increasing measure of diversification. However, agriculture in South Arcot has been slowly diversified over the years. Diversification pattern in South Arcot was almost similar to that of Dharmapuri district but the change was almost similar to that of Dharmapuri district but the change was adequate to diversify the crop activities slowly in the district over the years. Diversification pattern in Nilgris district was found unique in the State.&#xD;
&#xD;
Districts like Trichy, Thanjavur and Tirunelveli were diversified at the same rate over the period of three decades. Herfindal Index has shown the pattern and the level of crop diversification at the district level.&#xD;
&#xD;
CONCLUSION &#xD;
Diversification level showed inter- district variations. For effective planning and implementation, agricultural development plans may be designed appropriately for each district based on the nature and extent of crop diversification Though diversifications reduce the risk at farm level, it would discourage the specialization. Hence, promotional measures to encourage the commodity clutters and production efficiency and necessary. Specialization for instance, grapes in Theni district, turmeric in Erode district, mango in (Krishnagiri) Dharmapuri and Salem districts, maize in Perambalur and Dindigul districts, Chillies in Ramanathapuram district, banana in Tiruchirappalli and Tutcorin, tomato in Dharmapuri district, pepper, tea and coffee in Nilgris can be promoted.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1854</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1854</Fulltext></URLs><References>1. Ajjan, N. and Selvaraj, K.N. (1996). Crop Diversification and its Impact in Tamil Nadu- A Micro Analysis. Indian Journal of Agricultural Economics, 51 (4):695&#xD;
&#xD;
2. Arora, V.P.S., Srivastava.S.K (1996). Divesification of cropping Pattern and Foodgrain Mix in India: Pace, Magnitude and Implications. Indian Journal of Agricultural Economics, 51(4): 699-700.&#xD;
&#xD;
3. Dhawan K.C., singh, B., Prihar,R.S., Brars.S.S., and Arora.B.S (1996). Diversification of Indian Agricultural Vis-&#xE0;- vis Food Security. Indian Journal of Agricultural Economics, 51(4):683-684.&#xD;
&#xD;
4. IFPRI. (2005) toward High-value Agriculture and Vertical Coordination Implications for Agribusiness and Smallholders: Summary of the New Delhi Symposium, Indian, 5. Joshi, P.K. Ashok Gulati, Pratap S Birthal and Laxmi Tewari, (2004). Agriculture Diversification in South Asia. Patterns, Deteminants and Policy Implciations. Economic and Political Weekly, 12:2457- 2467.&#xD;
&#xD;
6. Naik, G. and Jain S.K., (2010). Growth, Stability and Acreage response of Agricultural Crops: Likely Impact of WTO Regime. CMA Monograph No. 191 Oxford and IBH Publishing Co. Pvt. Ltd., New Delhi.&#xD;
&#xD;
7. Shiyani, R.L. and Pandya. H.L. (1998). Diversification of Agriculture in Gujarat: A Spatio-Temporal Analysis. Indian Journal of Agricultural Economics, 53(4): 624-639.&#xD;
&#xD;
8. Singh, A.J., Jain K.K and Inder Sain. (1986). Diversification of Punjab Agriculture: An Econometrical Analysis, Indian Journal of Agricultural Economics, 41(4): 529-535.&#xD;
&#xD;
9. Saini, A.S., Sharma K.D., and B.K. Singh (1996). - Impact of Diversification on Small Farms Economy in Himachal Pradesh?, Indian Journal of Agricultural Economics, Vol.51, No.4, pp 697-698.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType/><ArticleTitle>OIL-WATER SEPARATION USING FLY ASH ZEOLITE TREATMENT&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>155</FirstPage><LastPage>167</LastPage><AuthorList><Author>Chintan Pathak</Author><AuthorLanguage>English</AuthorLanguage><Author> V. K. Srivastava</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: A large amount of water is used in the Upstream, Downstream, Petroleum and Automobile industrial processes and a huge fraction of it comes out as waste after getting polluted by oil and other toxic substances. Liquid wastes from the Petroleum Industries are relatively less toxic in nature and can be easily treated by conventional processes. However, solid wastes, especially oily Waste still remains as major environmental hazards, demanding safer disposal practices. Methodology: Oil contaminated wastewater is an extremely complex and variable waste of organic compounds ranging up to high molecular weight tars and bitumen&#x2018;s. Oily waste disposal is a major threat to the environment since they ultimately deplete the natural capital and degrade the prisnity of the eco system. This is the challenging area for petroleum scientist to establish the method by means of which maximum proportion of oil from&#xD;
the waste can be recovered. Experimental Set-up: There are different Chemical and Biological Treatment methods available. The Need is to optimize different treatment technologies in a cost effective method. The purpose of this work is to increase the oil-water separation by using zeolite treatment along heat treatment. Result and Conclusion: Results show the oil-water phase separation with zeolite treatment, as compared to fly ash. Heat treatment may be effectively used to treat oily waste as it gives more separation in shorter duration of time without creating any environmental as well as human health hazard. Increase in temperature and duration of heating gives more separation and more reduction in&#xD;
phase separation.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Oil, Oily Waste, Oil Spill, Phase Separation, Environmental Pollution control</Keywords><Fulltext>INTRODUCTION &#xD;
The increasing requirements in the sphere of environmental protection have induced search for more effective, inexpensive and ecologically safe solutions. Given that, the zeolite is aluminosilicate members of the family - microporous solids known as ?molecular sieves? and have sorptive and ion-exchange properties; the most important pollution of hydrocarbon (HC) (viz. petrochemical spills), may find applications in the removal of oil spill, using hydrophobic &#x2013; oleophilic - high-silica content - hydro thermally stable &#x2013; zeolite; particularly those, prepared cheaply from fly ash; while, simultaneously providing a solution to other environmental problems. The research will be applicable in wide variety of environmental pollution control applications. Since cleanup after an oil spill is so ineffective and so difficult, and does not always fully rehabilitate affected areas. As a challenging task, the author has experimentally investigated the strategy for synthesis and application of flyash zeolite for oil spill cleanup. When we think of oil spills, we habitually think of oil tankers spilling their cargo in oceans or seas. However, oil spilled on land often reaches lakes, rivers, and wetlands, where it can also cause damage. Oceans and other saltwater bodies are referred to as marine environments. Lakes, rivers, and other inland bodies of water are called freshwater environments. The term aquatic refers to both marine and freshwater environments. When oil is spilled into an aquatic environment, it can harm organisms that live on or around the water surface and those that live under water. Spilled oil can also damage parts of the food chain, including human food resources. The severity of the impact of an oil spill depends on a variety of factors, including characteristics of the oil itself. Natural conditions, such as water temperature and weather, also influence the behavior of oil in aquatic environments. Various types of habitats have differing sensitivities to oil spills as well. The most interesting results among those described in literature [1-5] on the development and application of the materials for adsorption purification of petroleum and oil products from water are considered and generalized [6].The purpose of this work is to provide a logical overview of fly ash synthesized zeolite for oil spill cleanup. Oily waste disposal is a major threat to the environment since they ultimately deplete the natural capital and degrade the prisnity of the eco system.&#xD;
&#xD;
&#xD;
	Presence of oily waste in water bodies affects the potability of water and also its use for agricultural as well as recreational purposes. Even traces of oily waste can form a thin film on the surface of water body and render it unfit aesthetically. This can also prevent the natural oxygenation of water bodies and in turn affect the ecosystem associated with it.&#xD;
	Layer of oil on aquatic living bodies affects the metabolic activities.&#xD;
	Oily waste provides a hostile environment to the soil bacteria and prevents the natural nutrient transformation cycle in plants and microorganisms.&#xD;
	Oily waste, when exposed to open atmosphere will disintegrate due to UV rays and will release volatile organic compounds into atmosphere which are carcinogenic compounds in nature. These obnoxious gases create odour nuisance to the nearby habitat.&#xD;
&#xD;
&#xD;
There are some treatments given to waste oily water, shown in Table-1. Sorbents are materials that soak up liquids. They can be used to recover oil through the mechanisms of absorption, adsorption, or both. Absorbents allow oil to penetrate into pore spaces in the material they are made of, while adsorbents attract oil to their surfaces but do not allow it to penetrate into the material. To be useful in combating oil spills, sorbent need to be both oleophilic and hydrophobic (water-repellant). Although they may be used as the sole cleanup method in small spills, sorbent are most often used to remove final traces of oil, or in areas that cannot be reached by skimmers. Once sorbent have been used to recover oil, they must be removed from the&#xA0;water and properly disposed of on land or cleaned for re-use. Any oil that is removed from sorbent materials must also be properly disposed of or recycled. Sorbents can be divided into three basic categories: natural organic, natural inorganic, and synthetic. Natural organic sorbent include peat moss, straw, hay, sawdust, ground corncobs, feathers, and other carbon-based products. They are relatively inexpensive and usually readily available. Organic sorbent can soak up from 3 to 15 times their weight in oil, but they do present some disadvantages [6]. Some organic sorbent tend to soak up water as well as oil, causing them to sink. Many organic sorbent are loose particles, such as sawdust, and are difficult to collect after they are spread on the water. Adding flotation devices, such as empty drums attached to sorbent bales of hay, can help to overcome the sinking problem, and wrapping loose particles in mesh will aid in collection. Natural inorganic sorbent include clay, vermiculite, glass, wool, sand, and volcanic ash. They can absorb from 4 to 20 times their weight in oil [7]. Inorganic substances, like organic substances, are inexpensive and readily available in large quantities. Synthetic sorbent include man-made materials that are similar to plastics, such as polyurethane, polyethylene, and nylon fibers. Most synthetic sorbent can absorb as much as 70 times their weight in oil, and some types can be cleaned and reused several times [8]. Synthetic sorbent that cannot be cleaned after they are used can present difficulties because they must be stored temporarily until they can be disposed of properly. Adsorbent materials are attractive for some applications because of the possibility of collection and complete removal of the oil from the oilspill site. The further advantage is, it can be, in some case, be recycled. Some important propertise of good adsorbent includes, hydrophobicity and oleophilicity, high updatake capacity, high rate of uptake, retention over time, oil recovery from it and reusability. It is interesting to mention that high-quality zeolite with high water- and oiladsorpotion and CEC may be readily produced from inexpensive flyash (a by-product of thermal power stations) and other solid waste materials containing silica and alumina [9-14], thus providing a solution to other environmental problems in addition to application in the removal of oil spills. Zeolite, which are synthesized, show some of these above mentioned properties. It has been suggested [10] that zeolite can be useful for oil spill cleanup due to their oleophilic and hydrophobic characteristics. In addition, there are 3 properties of zeolite that make them technologically important: they are selective and strong adsorbents, they are selective ion exchangers and they are catalytically active [7]. Researches are increasingly focusing on hydrophobic pure-silica (or high silica) zeolite as alternative sorbents for activated charcoal for sorpotion of organic pollutants (such as volatile organic compounds) [14].&#xD;
&#xD;
Hydrophobic zeolite have a small percentage of aluminum atoms in their crystal structure thereby shifting their adsorption affinity away from polar molecules, like water, towards non-polar substances, like organic solvents (i.e. they are highly organophillic). These zeolite are thermally and hydrothermally stable (upto about 1300 oC) and like other aluminosilicates, they have a unit structure with a defined pore size of 0.2-0.9 nm, resulting in a high specific surface ares. Hydrophobic zeolite also have the advantages like, little need for safety with regards to fire risk (since zeolite are inflammable), co-adsorption with water possible only when the relative humidity is higher than 70 %, can be regenerated with steam [15-16] or by calcination at high temperature [17-18]. Thus the possibility of application of flyash synthesised zeolite with desired shapes and sizes of are of great technological value in the oil spill clean-up.&#xD;
&#xD;
MATERIAL AND METHODS &#xD;
In order to insure the maximum digestion of silica from fly ash, it has been opined by the previous researchers that the microwave can be employed for complete heating of fly ash samples as compared to conventional hydrothermal method. Based on this, the main objectives (viz., less activation and digestion time, maximum silica digestion, more nucleation and better crystal&#xA0;growth of zeolite) of the present research has been planned. Fly ash samples from Bhusaval Thermal Power Station (BTPS), Bhusaval, Maharashtra, India; were collected for the present study. The ash sampling was done from hoppers and representative samples were prepared for three different fields or hoppers. The 40% pure hydrofluoric acid (HF) from Merck Ltd. was used for digestion of fly ash by employing microwave. The most general physical properties of zeolite are its bulk density and specific gravity (i.e., somewhere in between 2 to 2.4) which can correlate with its porosity (i.e., the measure of the pore volume in zeolite) and its most dependent parameter i.e., cation exchange capacity. The type of zeolite formed is a function of the temperature, pressure, concentration of the reagent solutions, pH, process of activation and ageing period, SiO2 and Al2O3 contents of the raw materials.&#xD;
&#xD;
EXPERIMENTAL SET UP &#xD;
The samples were collected from the 2 major sources: [1] Petrol from Petrol Pump (HP) and [2] Crude Oil from Exploration site. The density which we have used for sample-1, is 737 kg/m3 and for sample-2, is 825 kg/m3 . Fly Ash samples were collected from Thermal Power Station, Bhusaval having Density 2-2.3 gm/cc. The Pore size and surface area of collected fly ash was well characterized, which is 400 m2 /g, respectively. Fly Ash was then treated with 40 % pure Hydrofluoric Acid (HF) along with Microwave Irradiation. The range of temperature was from 45-110 oC. The time range was 5-15 min. The physical characteristics of these synthesized fly ash zeolites are as follows: Density: 0.2 to 2.3 gm/cc Pore sizes: 0.2 to 0.8 nm Pore volumes: 0.10 to 0.35 cm3 /g Surface areas: 300&#x2013;700 m2 /g Oil-Water Emulsion was prepared by addition 90 ml of D/W water into 10 ml of Petrol and Crude Oil samples. It was then kept for 24 hrs. for formulation of micro-emulsion. The microemulsion which was formed between oil and water phase, is separated with the help of Seperatory funnel. After obtaining the micro-emulsion, 5 gm of fly ash was added and treated with the heat treatment at different temperature ranges from 25- 45 oC (Fig.- 1,2,3,4; Table-4) for Petrol and Crude Oil, simultaneously. Similarly, 5 gm of Fly Ash Synthesized Zeolite were also added into the micro-emulsion and heat treatment was given at different ranges from 25-45 oC (Fig.-1,2,3,4; Table-2 and 3) for Petrol and Crude Oil. Following parameters were set-up for taking getting result of Oil-Water Phase Separation using Microwave Assisted Zeolite Treatment: Isobaric Specific Heat (kJ/kg.k) Kinematic Viscosity (cP) Surface Tension (N/m) Density (kg/m3 ) Separated study of oil and water were also taken on volume basis and weight basis, after every 5 min.&#xD;
&#xD;
RESULT &#xD;
Separation study shows that the fly ash and zeolite, being the porous material, adsorbing the oil. It is resulted into the increasing density, from which, it can be determined that an Emulsion after zeolite treatment gives increasing in the viscosity and decreasing surface tension. From this it can be predicted that as the density increases more towards water density, the oil-water separation may take place. From this study of oil-water separation with the help of fly ash and zeolite, it has been observed that the separation rate between oil and water increases with increases in temperature. After the treatment of flyash with microwave irradiation into the HF acid, the adsorption capacity increases because of increase in pore size. At 25 oC, the emulsion density is around 829 kg/m3 , after zeolite separation the density is 891 kg/m3 and with flyash separation the density is 857 kg/m3 . The kinematic viscosity, at 25 oC, of emulsion is 2.37 cP, with zeolite separation is 12.7 cP and with flyash separation, 5.5 cP. From the graph-3,4,5,6; it is very clear that almost all the parameters (viz.,Kinamatic viscosity and Density), shows the oil-water separation is more favorable for zeolite as compared to flyash.&#xD;
&#xD;
From the graph-1 and 2, it can be seen that the wt. % up-take of Petrol and Crude Oil, is more using zeolite compare to flyash. As temperature increases, it can also be concluded that the Total Wt. % up-take increases.&#xD;
&#xD;
CONCLUSION &#xD;
The microwave-assisted digestion method for fly ash provided comparable or better results to that of conventional hydrothermal digestion method. The variations in weight of sample, temperature, and time resulted in improved recoveries of several elements, but generally. In addition, preparation and time needed for digestion was significantly reduced with this method. The microwave-assisted method for fly ash did work better than hydrothermal digestion method. There is, however, scope for more improvement in future research. The use of hydrofluoric acid was absolutely necessary for digestion of fly ash because fly ash primarily consists of silicates and oxides. Most of the elements in ash were successfully extracted with hydrofluoric acid. The materials prepared by the method have a pore structure consisting of micropores as well as mesopores and macropores. The shape, composition, pore structure and mechanical properties of the zeolite microspheres make them interesting for application in areas such as adsorption for oil-spill cleanup.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1855</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1855</Fulltext></URLs><References>1. Metcalf and Eddy, Inc. (1999) ?WasteWater Engineering, 3 rd Edition. 765-915, TATA McGraw-Hill publishing company Limited, New Delhi.&#xD;
&#xD;
2. Bhatia, S.C. (2002) ?Handbook of Industrial Pollution and Control?. 2:312, CBS publishers.&#xD;
&#xD;
3. Cormack, d. (1983) Responses to oil and chemical Marine Pollution. Applied science publishers, New York.&#xD;
&#xD;
4. Noyes, Robert (2005) ?Unit operations in Environmental Engineering.&#xA0;307, Jaico publishing house.&#xD;
&#xD;
5. Kiely uwe (2006) Environmental Engineering. 718, Irwin McGraw-hill.&#xD;
&#xD;
6. Noyes, Robert (1993) Pollution Prevention Technology Handbook. 30, 39,105,206,502, Noyes publications, U.S.A.&#xD;
&#xD;
7. Sharma, B. K. (2004) ?Industrial Chemistry, 14 th edition. Goel publishing house.&#xD;
&#xD;
8. Willard, H. H. (1986)Industrial Methods of Analysis, 6 th edition. CBS publishers.&#xD;
&#xD;
9. Gupta, v. (2006) Break through in oil-water separation. Environment science and Engineering, 57-58.&#xD;
&#xD;
10. Rao, M. N. and Datta, A. K. (1978) ?Wastewater Treatment?, 2 nd edition. Oxford and IBP publishing Co. Pvt. Ltd.&#xD;
&#xD;
11. Punmia, B. C. and Jain, A. K. (2005) Wastewater Engineering. Laxmi publications.&#xD;
&#xD;
12. Gidde, M. R. and Lad, R. K. (2005) ?Environmental Engineering, 2nd volume. Nirali publication.&#xD;
&#xD;
13. Chakravarty, R. N. and Bhaskaran, T. R. (1973) Treatment and Disposal of oil refinery wastes, IAWPC volume 10. 137- 153.&#xD;
&#xD;
14. Haruna, J. and Meguro, M. (1992). JP Patent 04012015.&#xD;
&#xD;
15. Kuntzel, J.; Ham, R. and Melin, T. (1999). Chem. Eng. Tech. 22(12), 991.&#xD;
&#xD;
16. Kuntzel, J.; Ham, R. and Melin, T. (1999). Chem. Eng. Tech. 71, 508.&#xD;
&#xD;
17. Otten, W.; Gail, E. and Frey, T. (1992). Chem. Ing. Tech. 64, 915.&#xD;
&#xD;
18. Ruthven, D.M. (1988). Chem. Eng. Prog. 84, 42.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>-0001</Year><Month>November</Month><Day>30</Day></PubDate></Journal><ArticleType/><ArticleTitle>WIRELESS TECHNOLOGY IN SERVICE OF SOCIETY- A CASE STUDY OF SNAKEBITE&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>168</FirstPage><LastPage>174</LastPage><AuthorList><Author>P.P.Patil</Author><AuthorLanguage>English</AuthorLanguage><Author> Abhijit A.Patil</Author><AuthorLanguage>English</AuthorLanguage><Author> B T Jadhav</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Information communication System plays an important role in the lives of affected Patients of snakebites. The information systems can be developed which may help to the mankind in emergency by transferring&#xA0; data. The paper explains the present scenario of Snake bite patients status in the selected sensitive area in&#xA0;the rural Maharashtra. Survey shows that, the unsatisfactory picture of lack of communication system for assistance to the affected patients and their further treatment by the hospitals. The paper suggests the Global Positioning System (GPS) Enabled computing model and the usage of Wireless Technology. The literature survey shows that, such model may be the need in snake bite affected areas. The Computing model based on the wireless technology is also useful for making awareness by sharing the information about the prevention of snake bites and the treatments as first Aid to the community and how does the data about the victim can be made available and communicated to the further centers such as hospitals. We mentioned here the advantages and the limitations of the proposed computing model. The Objective behind the paper is to make use of Information Communication Technology (ICT) to inculcate the awareness and provide services about prevention of snakebite and treatment directly through&#xA0;mobile communication system. Method: A prospective analytical study method is used to assess various risk factors associated with snakebite. Outcome of the study: The paper shows the communication delays between snakebite patient and hospitals that can be overcome by using wireless technology.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>GPS, Information System, Wireless Communication, Computing Model, ICT, Prevention of Snakebite, Community.</Keywords><Fulltext>INTRODUCTION &#xD;
Snakebite is an important and serious problem in rural Maharashtra. India having 216 species of snakes out of that only 52 species of snakes are poisonous [3,5]. The time interval between snakebite and initiation of treatment is more than 6 hrs. Public Health Care centers limits the communication and information tools of IT Infrastructure. It is found that there is no proper reporting system due to underutilization of information and communication facility to report about the snakebite victim for immediate treatment. It has been observed that the snakebite patients death has been occurred even in the presence of advanced communication technology. It is due to absence of emergency treatment to the patients. Whenever any patient has suffered by the snakebite in the rural area, it has been seen that most of the cases are dead due to lack of communication between patient and treatment system i.e. hospitals. This paper&#xA0;focus on the use of ICT in snakebite cases in rural Maharashtra [1]. We observed that the snakebite cases admitted [2] and referred for higher hospitals due to the unavailability of antisnake venom (ASV) that would increase the chances of uncertainty. The paper suggests a proposed computing model to help and report the location and the instant availability of the antisnake venom.&#xD;
&#xD;
RESEARCH METHODOLOGY &#xD;
Snakebite sample cases were collected and studied from the Department of the Dr Shankarrao Chavan Government Medical College and Hospital, Vazirabad, Nanded District, Maharashtra State, India are shown in Table 1.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
WIRELESS COMPUTING MODEL HELPS IN TREATMENT OF SNAKE BITES&#xD;
Internal Mechanism of RAC(Rural Assistance Center) Computing System: Incoming call (toll free call) coming from GPS enabled handset [6,11] to RAC computing system is handled by GPS Tracking system to track the location otherwise handled by auto response machine to capture the name ,address, query information and store into the database . A software based knowledge management accept the general description of snakebite to find out the type of snakebite and then after further processing it, display the data about the antisnake venom [4] and nearest location of the hospital to get the immediate treatment. This data is forwarded to the caller, District Health Office (DHO) and Tahsil Health Office (THO)&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
Rural Assistance Center (RAC) is one of the GPS and Web based information cell which shares the information about snakebite prevention programmes and awareness amongst the local users about snakebites and its adverse&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
impact communicated through using ICT based Wireless Computing Model.&#xD;
RAC interact with the following Units :&#xD;
i) Local Self Help Group&#xD;
ii) Farmers&#xD;
iii) GramPanchayat&#xD;
iv) Emergency Services and Ambulance&#xD;
v) Victims: Affected Users vi) Local Teachers and Volunteers&#xD;
vii) District and Tahsil Administration viii) Research Institutions&#xD;
&#xD;
GPS Enabled RAC comprises a web based Computing Information Systems which is a combination of two heterogeneous technologies viz. Information Communication Technology (ICT) [8] and Medical Technology (MT). RAC must work under the control of Regional Healthcare Center in association with the above mentioned components.&#xD;
&#xD;
Roles and Responsibilities of RAC Units&#xD;
i) Local Self Help Group:&#xD;
The Local self help group must be trained with the primary treatment (First Aid) given after the snakebite immediately. The Local self help group should contain two senior women members, two farmers and a snake friend as a young farmer. The Regional Health Center in association with research institution and district and Tahsil administration should provide the training of this computing system and give the updated information to the local self help group through RAC. When any snakebite incident happens then a member of Local Self Help Group should be use this system and informed so that in emergency&#xD;
&#xD;
ii) Farmers &#xD;
The farmers should be aware by the RAC with the help of Gramapanchyat Authority and Trained Teacher through Awareness Programme about Prevention of Snake bite and First Aid Treatment through Web application of RAC. These trained farmers should convey and share these information and precautions amongst the&#xA0;community. The RAC should display the important and Emergency mobile [7] numbers of close by and local hospitals which provide treatment of Snake bite affected patients. In emergency the farmer should contact the above said emergency numbers and follow their instructions.&#xD;
&#xD;
iii) Grampanchyat &#xD;
The Grampanchyat authority (GRamsevek &#x2013; Govt. Officio) should display the pictorial information prevention and types of snakes and basic First Aid Treatments through posters. Conduct awareness Programmes with the help of School and High Trained Teachers to the students as well as farmers in the village through interacting with the RAC system&#xD;
&#xD;
iv) Emergency Services and Ambulance (ESA) &#xD;
Emergency Services and Ambulance (ESA) should be made available by Civil Surgeon and Medical Officer through closest Primary Health Centers. They should display about various types of Snakes and their Symptoms. They should have 24x7x366 emergency ambulance service which will work with RAC computing system through Wireless Technology [9]. The Ambulance should be wireless technology based well equipped with few support of Antisnake venom. When the Emergency cell receive any phone call or instruction from RAC computing system about snakebite patient then it is their responsibility to follow the case through GPS tracking system and support to the victim so as to save the life.&#xD;
&#xD;
v) Victims: Affected Person &#xD;
Victims or Relatives should just dial the toll free number of RAC Computing system and follow the instruction and use the data and information given by the RAC Computing System.&#xD;
&#xD;
vi) District and Tahsil Health Administration &#xD;
District Health Administration has to establish the Emergency Cell regarding the Snake bite treatments through Tahsil in association with the Medical Research Institutions and Private Hospitals. It is now the Tahsil Health Administration who should also plan and execute the instructions received from the District for the prevention and treatment of snakebite patients in the villages. RAC computing system should be controlled by the Regional Health and District Health Administration by providing the updating medical information related to antisnake venom.&#xD;
&#xD;
vii) Research Institutions &#xD;
The Research institutions has to share the Innovative information about prevention and First aid treatments, post medical treatments by making the use of locally available resources and advanced technology. Research Institutions must provide the information about advanced medicines (Antisnake venom) to the RAC and update it regularly.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
RESULT &#xD;
Implementation of RAC Computing will shows the following results&#xD;
&#xD;
&#xD;
	Immediate reporting of snakebite victim Quick and accurate information available about antisnake venom stock and the location of nearest hospital for treatment&#xD;
	Emergency ambulance and services are available through this system&#xD;
	Required report generated and Easy to use&#xD;
	Helps to aware about prevention of snakebite and its treatment&#xD;
	Highly useful to the rural community The study shows some limitations:&#xD;
	Regular data updating is required High bandwidth will gives better and faster results.&#xD;
&#xD;
&#xD;
DISCUSSION AND CONCLUSION RAC &#xD;
Computing model is helps to create the awareness among the rural villagers for prevention and services for snakebite. It has been found that present manpower in the govt. hospital studied in this paper is comparatively less due to which communication gap between the snakebite victims and hospitals is large. This deficiency is removed by making use of this RAC computing model for the needs of rural society in emergency. It has been concluded that the RAC computing model based on wireless technology [10] will be useful to the snakebite victims and society to save the life by providing the accurate and faster information of antisnake venom and nearest location of the hospital.&#xD;
&#xD;
ACKNOWLEDGEMENT &#xD;
We are thankful to the Department of the Dr.Shankarrao Chavan Government Medical College and Hospital, Vazirabad, Nanded District, Maharashtra State, India&#xD;
&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors /publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1856</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1856</Fulltext></URLs><References>1. D. P. Punde [2005] : ?Management of snake bite in Rural Maharashtra?, National Medical Journal of India, Vol. 18 No.2.&#xD;
&#xD;
2. I.F.Inamdar, N. R. Aswar, M. Ubaidula, S. D. Dalvi [2010]: ? Snake bite : Admissions at a Teritary healthcare center in Maharrashtra, India?, SAMJ, Vol. 100 No. 7&#xD;
&#xD;
3. Bawaskar H S, Bawaskar P H.? Profile of snakebite envenoming in western Maharashtra, India?. Trans R Soc Trop Med Hyg 2002; 96: 79-84.&#xD;
&#xD;
4. David A Warrell,? Guidelines for the Clinical Management of Snake Bite in the South-East Asia Region SEAMEOTROPMED, WHO, Southeast Asian Journal of Tropical Medicine and Public Health, Vol 30, Supplement 1, 1999&#xD;
&#xD;
5. Virendra C. Patil , Harsha V. Patil , Avinash Patil, Vaibhav Agrawal ?Clinical Profile and outcome of envenomous snake-bite at tertiary care centre in western Maharashtra? , International Journal of Medicine and Public Health, Vol. 1, Issue 4, Oct-Dec, 2011, 28-38&#xD;
&#xD;
6. Ruchika Gupta and BVR Reddy, ?GPS and GPRS Based cost effective human tracking system using mobile phones?, VIEWPOINT, January-June 2011, volume 2 No.1&#xD;
&#xD;
7. Khondker Shajadul Hasan, Mashiur Rahman, ?Cost Effective GPS-GPRS Based Object Tracking System?IMECS 2009, VolI,March 18-20,2009,Hong Kong&#xD;
&#xD;
8. Yusn,G,Zhang,Z. and Wei Shang Guan,?Research and Design of GIS in vehicle monitoring system? Proceedings of IEEE 2006&#xD;
&#xD;
9. Brahim G, and Luigi L. (2000) ? Understanding GPRS : The GSM Packet Radio Service?, Computer Networks Journal,34.5, pg.763-779&#xD;
&#xD;
10. ?Mobile Phone GPS Tracking-GPS Spy Cam&#x201D; www.gpsspying.com , Last accessed on 12th feb.2012 11. ?Real time GPS Tracking Solutions? , www.gpsgate.com , Last accessed on 10th feb.2012&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType/><ArticleTitle>PRODUCTION AND OPTIMIZATION OF SINGLE CELL OIL BY OLEAGINOUS BACTERIA ISOLATED FROM OIL CONTAMINATED ENVIRONMENTS&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>175</FirstPage><LastPage>184</LastPage><AuthorList><Author>T. Murugan</Author><AuthorLanguage>English</AuthorLanguage><Author> D. Saravanan</Author><AuthorLanguage>English</AuthorLanguage><Author> R.Balagurunathan</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Natural sources of oils and fatty acids are derived from plants, animals and microorganism. The oils or lipids, thus produced from microorganisms are known as ?Single Cell Oil?. This present study aimed to isolate lipid accumulating bacteria for the production and optimization of single cell oil. In this preliminary investigation three soil samples were collected in around Kanchipuram District, 37 different bacterial strains were isolated and screened by Sudan black stain of that 3 strains (AOM13, AOM17 &amp; MEW3) showed maximum lipid accumulation. They were used for lipid production of by shake flask method. The lipid was extracted by Folch method using cell dry matters. Among 3 strains AOM17 was identified as the efficient producers which produce about 23% of lipid content. It was confirmed as lipid by solubility, saponification test. Further the lipid was subjected to antimicrobial activity against human pathogens by well diffusion method, the strain MEW3 showed good activity against Bacillus sp., Staphylococcus aureus and Proteus sp. In optimization, all three strains showed maximum lipid accumulation at 15.5 g/L of glucose, 0.4 g/L of ammonium sulphate, pH 8 and 96 hours incubation time. The three potential strains AOM13, AOM17 and MEW3 were identified as Cellulomanas sp., Arthrobacter sp., Acromicrobium sp., respectively.&#xD;
&#xD;
&#xA0;&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Single cell oil, Oil production, oleaginous microbes</Keywords><Fulltext>INTRODUCTION&#xD;
Oils, fats and lipids from the natural compounds are serves as sources of energy and are considered an important component of our food3 .The demand for oils and fats is largely met form plant and animal sources 19. Natural sources of oils and fatty acids are derived from plants, animals and microorganism9, 19. The demand for oils and fats in general is largely met from plants and animals sources3 . The main drawback is, these sources alone cannot be able to meet the total requirement of lipids. The drawback behind from these sources, a complex mixture of fatty acids with varying lengths (Docosahexaenoic acid) and degree of unsaturation were obtained and it needs expensive lipid purification. Furthermore, the fish or animals oil gets contaminated by environmental factors, which leads to typical smell and unpleasant taste 19 . Microorganisms will be the suitable alternatives, as they have the ability to convert a number of waste materials into a series of valuable-added products 3 . The oils or lipids, thus produced from microorganisms are known as ?Single cell oil?&#xA0;and the microbes are called ?Oleaginous microbes&#x2018;, since they accumulate more than 20% of their biomass as lipids 9 . The lipid which accumulates in oleaginous microorganisms is mainly triacylglycerols16. Oleaginous microorganism could provide an economically feasible source of poly unsaturated fatty acids 15 . Some essential fatty acids (EPA) produced by microorganism are a direct precursor for a number of biologically active compounds 19 such as prostaglandins, leukotrienes, thromboxanes and other related metabolites. It exhibits regulatory effects on lipoprotein metabolism, blood rheology, vascular tone, leukocyte function, plate activation and cell growth 21 . The exploitation of oleaginous microorganism for the production of single cell oil is value added products that has relevance and importance to our nation&#x2018;s economy. Most of the work has so far been, produced single cell oil mainly from yeasts. Prokaryotic microorganism should now also consider as a lipids with potential application in the oil industry. In this view, the present study was aimed for isolation and screening for SCO producing bacteria from different soil samples and to produce single cell oils in maximum quantity using different carbon sources based on the optimization of various factors. MATERIALS AND METHODS Collection of Samples For this study, soil samples were collected from three different oil contaminated places in around Kanchipuram District and aseptically transferred to laboratories for processing. Isolation and Purification of Bacterial Strains The samples were serially diluted using sterile distilled water blanks. Spread plated was made on Mineral salt agar medium9 and incubated for 24-48 hours at room temperature. Morphologically different bacterial isolates were selected and purified on Nutrient agar slants and subsequently analysed for micro morphological characteristics. Screening Methods for Single Cell Oil production Sudan black B staining: The isolated strains were stained with Sudan Black B staining 15; 2 . the smear was fixed in the slide and was flooded with Sudan Black B stain for 15 minutes and rinsed twice in xylene, followed by counter stained with diluted safranin for 15 seconds. Then it was washed with distilled water. The air dried slide was observed under a phase contrast microscope on oil immersion for presence of blue or grayish coloured fat globules within the cell. Production of single cell oil All the Sudan black positive isolates were studied for the production of lipids. About 2ml of 24 hours bacterial culture were inoculated in 100 ml of sterilized Supplemented Nutrient Broth (SNB) medium and placed in a shaker at 200 rpm for 3 to 5 days at 30&#xBA; C 20 . Cell dry matter After three days of incubation, the broth was centrifuged at 5000 rpm for 15 minutes for separation of pellet. The pellet was washed three times with sterile distilled water and dried overnight at 80&#xBA;C 8, 9. Then the biomass was weighed for the determination of cell dry matter 15 Total lipid extraction Total lipid content of cell dry weight was extracted by Folch methods 9 . The cell dry matter was extracted with chloroform and methanol mixture solution (2:1), twice at room temperature by mixing it for 15-20 minutes in a shaker and centrifuged at 2000 rpm for 10 minutes. 0.9% Nacl solution was added to the pellet and vortexed for few seconds, again it was centrifuged at 2000 rpm for 10 minute.&#xD;
&#xD;
The&#xA0;lower chloroform layer containing lipid was obtained and allowed for solvents evaporation to determine the lipid weight 9 . Based on the percentage of the lipid accumulation from the total cell dry matter 15, different potential isolates were selected as mentioned in the (Table 2), and the extracted lipids were stored for further studies. Confirmation analysis of lipids Solubility test: A small amount of extracted lipid from all bacterial isolated were taken in three test tubes and each of three tubes was added with water, alcohol, chloroform and vortexed well to detect the solubility nature. Saponification test: about 2 ml of 2% NaoH solution was added to all the small amount of lipid extracted from potential isolated and mixed well to emulsify the lipid. Positive result observed by the formation of soapy solution.&#xD;
&#xD;
Antibacterial activity of lipids &#xD;
The single cell oil (lipid) extracted from the potential isolates were tested for antimicrobial activity against human bacterial pathogens by well diffusion method. The 18 hours culture of Bacillus sp., Staphylococcus sp., Escherichia coli and Proteus sp., were swabbed on MHA plates. In each well, the crude lipid (50&#xB5;l) was added and incubated at 30&#xBA; C for 24 hours 7 . Selection of potential strains Based on the dry weight percentage of total lipid extracted from the cell dry matter of isolates, the potential isolates were selected. The isolated strain was further used for maximum production of single cell oil and optimization studies. Optimization of single cell oil production To enhance production of single cell oil, the potential strains AOM13, AOM17 and MEW3 were subjected to optimization studies. Production of SCO was optimized by studying various nutritional factors (such as carbon and nitrogen) and environmental (such as pH and incubation time) was incorporated in Minimal unbalanced agar media 12, 13, 18 . To identify the maximum lipid accumulation in potential strains, the incubated plates were flooded with Sudan black staining solution (0.02 % of Sudan black + 96 % Ethanol) for 30 &#x2013; 60 minutes and washed with 96 % ethanol and observed for the maximum stain absorption 18 . Biosurfactant activity Hemolysis tests: To observe the hemolytic activity, the potential isolates were inoculated on blood agar plates and incubated at 30&#xBA; C for 72 hours 20 . Emulsification tests: The pure cultures of potential strains were suspended in test tubes containing 2ml of Mineral salt solution. After 48 of incubation, 2 ml of kerosene (hydrocarbon) was added to each tube and the mixtures were vortexed at high speed for 1 minute and were allowed to stand for 24 hours to observe emulsification activity 20 . Characterization of potential isolates Micro morphological test such as Gram staining, Motility, Spore staining, Metachromatic granule staining and biochemical test such as starch hydrolysis, Gelatin liquifization, Nitrate reduction and sugar fermentation tests, etc., were performed to identify the potential bacterial strains.&#xD;
&#xD;
RESULTS&#xD;
Isolation and purification of bacterial strains &#xD;
A total of 37 morphologically different strains were isolated from three samples. Among 37 isolates, 17 isolates from soil sample-I, 8 isolates from soil sample-II and 12 isolates from soil sample-III were isolated and subcultured. Among the 37 isolates 35 strains were showed Gram positive and only 2 strains were showed Gram negative (Table 1).&#xD;
&#xD;
&#xD;
&#xD;
Screening methods for Single Cell Oil production Sudan black B staining: Out of 37 isolates, 6 strains were showed positive. 3 strains from soil sample-I isolate (AOM2, AOM13 and AOM17), 2 strains from soil sample-II isolate (MEW3 and MEW8) and 1 strain from soil sample-III isolates (VOM12).&#xD;
&#xD;
Production of single cell oil &#xD;
The six positive strains namely, AOM2, AOM13, AOM17, MEW3, MEW8 and VOM12 were used for the production single cell oil. The&#xA0;percentage of total lipid content was calculated from total cell dry matter and they showed 10%, 18%, 23%, 21%, 16% and 8% respectively (Table 2).&#xD;
&#xD;
&#xD;
&#xD;
Confirmation for lipids analysis&#xD;
Solubility test:&#xD;
The extracted lipids were insoluble in water but soluble in alcohol and chloroform.&#xD;
&#xD;
Saponification test: The NaOH solution saponifies the lipids presented in the extracted compound by the formation of soapy solution indicating the presence of lipids. Antibacterial activity of lipids The crude lipids extracted from potential strain MEW3 showed antibacterial activity against Bacillus sp., Staphylococcus sp., and Proteus sp. (Table 3).&#xD;
&#xD;
&#xD;
&#xD;
Optimization of single cell oil production Effect of Nutritional sources Effect of carbon sources: Growth of all strains was observed in 4 different concentration of glucose. All strains showed maximum lipid accumulation at 1.55 g/L concentration. Strain AOM13 and MEW3 showed maximum lipid accumulation at increased concentration of glucose (1.6g/L).&#xD;
&#xD;
Effect of Nitrogen sources: In 4 different concentration of nitrogen source, maximum lipid accumulation was found at low concentration of nitrogen souce (0.4g/L). The results were given in table 5.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Biosurfactant activity Hemolysis tests: Among 3 potential isolates, 2 strains AOM17 and MEW3 were showed hemolytic activity. Emulsification tests: All the three strains studied for emulsification activity, which doesn&#x2018;t show any positive result. Characterization of potential isolates Based on the cultural characteristics, microscopic, and biochemical characteristics (mentioned in Table-8) the three potential organisms- AOM13, AOM17 and MEW3 were identified as Cellulomanas sp., Arthrobacter sp., Acromicrobium sp., respectively.&#xD;
&#xD;
&#xD;
&#xD;
DISCUSSION&#xD;
Microbial lipophilic compounds called single cell oils (SCO), has been the object of research and industrial interest for many years, due to their specific characteristics. Such SCO products are potential for using as alternative sources of animal or plant oils. According to Gouda et al., and Patnayak and Sree 2005 single cell oil is mainly produced by Fungi and Yeasts, Bacteria for single cell oil production are not well explored. In this concern, the present study has aimed to isolate and identify single cell oil producing bacteria from different oil contaminated sites and to optimize for maximum production. For the collection of sample, three different oil contaminated sites were taken and analysed for isolation of bacteria from oil reservoirs20. In their present study also totally 37 strains were isolated from three different oil contaminated sites. Of this sample-I contained large amount of microbial load when compared with sample-II and sample-III. The SCO producers were screened by sudan black staining and by determination of total lipid content on cell dry matter15. In their study also all the 37 strains were screened by Sudan black stain of that 6 isolates showed positive result for lipid accumulation. The production of bacterial SCO was done by shake flask method according to Gouda et al., 2002. The lipids were extracted by Foltch method which is an efficient method to extract the total lipid content from cell dry matter1, 9, 15. After extraction, based on the percentage of total lipid content, 3 isolates were selected. Among 3 strains AOM17 was identified as the efficient producers which produce about 23% of lipid content. For the confirmation of extracted compounds as lipids, lipid analyzing tests were done and confirmed the presence of lipids. All the 3 strains were taken up for further optimization studies and application studies. The lipids extracted from cell dry matter were analyzed for their antimicrobial properties. In previous work, Gram positive and yeast only showed higher sensitivity to the lipid compounds11 in the present study, the strain MEW3 showed activity against Gram positive bacteria and Gram negative bacteria. The potential strains were optimized for maximum lipid production and tested qualitatively by absorption ability of Sudan black stain. The nutritional factors such as carbon source and nitrogen source and environmental factors such as pH and incubation time were optimized for maximum production of lipid. This study showed the mild increased concentration of glucose enhances the production of lipid. At 15.5 g/L concentration all three strains AOM13, AOM17 and MEW3 showed maximum lipid accumulation when glucose (carbon source) used. Papanikolaou et al. reported 0.5g/L of ammonium sulphate had produced high lipid. In this study, 0.4 g/L had showed maximum lipid accumulation when ammonium sulphate (nitrogen source) used. Hall and Ratledge, reported that pH had little influence on lipid accumulation. In this study pH had influence the accumulation of lipid. Strain AOM17 and MEW3 showed maximum lipid accumulation at pH 8 and strain AOM 13 showed maximum lipid accumulation at pH 7. The effect of incubation time was previously reported by Papanikolaou et al. In this study, all the potential strains showed maximum lipid accumulation at an increased time of incubation. After 96 hours of incubation, the lipid accumulation remains constant. The three potential Single cell oil producers, AOM13, AOM17 and MEW3 were identified as Cellulomanas sp., Arthrobacter sp., Acromicrobium sp., respectively.&#xD;
&#xD;
CONCLUSION&#xD;
The present study can be further analyzed by thin layer chromatography and Gas chromatography. In future, many unknown bacteria may result in the strains that are even better source of SCO producers than the ones we know. Efficient production techniques with detailed knowledge of lipid mechanism should be developed. This study offers an insight into exploring the possibility of producing such valuable added single cell oil at an high amount and to use it as a supplementary to other edible fats or to synthesis lipid based products such as biosurfactant, bioplastics, etc.,&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1857</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1857</Fulltext></URLs><References>1. Aggelis G and Komaitis M. Enhancement of single cell oil production by Yarrowia lipolytica growing in the presence of Teucrium polium L. aqueous extract. Biotechnology Letters 1999; 21: 747- 9.&#xD;
&#xD;
2. Arshad M.U, Jamil N, Naheed N and Hasnain S. Analysis of bacterial strains from contaminated and non-contaminated sites for the production of biopolymers. Afr. J. Biotechnol 2007; 6(9): 1115- 21.&#xD;
&#xD;
3. Azeem A, Neelagund Y.F and Rathod V. Biotechnological production of oil: fatty acid composition of microbial oil. Plant foods for human nutrition 1999; 53: 381- 6.&#xD;
&#xD;
4. Bhalla, T.C, Sharma M and Sharma N. Microbial production of flavours and fragrances; fats and oils; dyes; bioplastics (PHAs); polysaccharides; pharmacologically active substances from marine microbes; anti-cancer agents and microbial biotransformation 2007; 1-34.&#xD;
&#xD;
5. Cooper D.G, Zajic J.E and Gerson D.F. Production of surface-Active Lipids by corynebacterium lepus. Appl. Environ. Microbiol. 1979; 37(1): 4-10.&#xD;
&#xD;
6. Desai, J. D and. Banat I M. Microbial production of surfactants and their commercial potential. Microbiol. Mol. Biol. Rev 1997; 61(1):47-64.&#xD;
&#xD;
7. Fernandes P A V, De Arruda I. R, Santos A F, De Arauj A A, Maior A M S and Ximenes E A. Antimicrobial activity of surfactants produced by Bacillus subtilis R14 against Multidrug-resistant bacteria. Brazilian Journal of Microbiology 2007; 38:704 - 9.&#xD;
&#xD;
8. Gill C, Hall M J and Ratledge C. Lipid accumulation in an oleaginous yeast (Candida 107) growing on glucose in singlestage continuous culture. Appl. Environ Microbiol 1977; 33:231- 9.&#xD;
&#xD;
9. Gouda M K, Omar S H and Aouad L M. Single cell oil production by Gordonia sp. DG using agro-industrial wastes. World. J. Microbiol. Biotechnol 2008, 24:1703-11.&#xD;
&#xD;
10. Hall M J and Ratledge C. Lipid accumulation in an oleaginous yeast (Candida 107) growing on glucose under various conditions in a one- and two- stage continuous culture. Appl. Environ. Microbiol 1977; 33:577-84.&#xD;
&#xD;
11. Kabara J J, Vrable R and JIE M S F L. Antimicrobial lipids natural and synthetic fatty acids and Monoglycerides. Lipids 1977; 12(9):753- 9.&#xD;
&#xD;
12. Lima T C S, Grisi B M and Bonato M C M. Bacteria isolated from a sugarcane agro ecosystem: their potential production of polyhydroxyalcanoates and resistance to antibiotics. Revista de Microbiologia 1999; 30:214-24.&#xD;
&#xD;
13. Papanikolaou S, Chevalot I, Komaitis M, Mare I and Aggelis G. Single cell oil production by Yarrowia lipolytica growing on an industrial derivative of animal fat in batch cultures. Appl. Microbial. Biotechnol 2002; 58: 308-12.&#xA0;&#xD;
&#xD;
14. Papanikolaou S, Komaitis M and Aggelis G. Single cell oil (SCO) production by Mortierella isabellina grown on high-sugar content media. Bioresource Technology 2004; 95: 287-91.&#xD;
&#xD;
15. Patnayak S and Sree A. Screening of bacterial isolates of marine sponges for single cell oil and PUFA. Letters in Appl. Microbial 2004; 40: 358-63.&#xD;
&#xD;
16. Ratledge C. Fatty acid biosynthesis in microorganisms being used for single cell Oil production. Biochine 2004; 86: 807-15.&#xD;
&#xD;
17. Ribera R G, Sanchez M M and Ramos A. Production of polyhydroxyalkanoates by Pseudomonas putida KT2442 harboring pSK2665 in wastewater from olive mills (alpechin), Electronic Journal of Biotechnology 2001; 4:0717-34658.&#xD;
&#xD;
18. Sabry S A, Ghanem K M and Yusef H H. Production of microbial lipids from beet molasses. Journal of Islamic academy of sciences 1990; 34: 310-13.&#xD;
&#xD;
19. Sijtsma L, and De Swaaf M E. Biotechnological production and applications of the -3 polyunsaturated fatty acid docosahexaenoic acid. Appl. Microbiol. Biotechnol 2004; 64: 146-53.&#xD;
&#xD;
20. Tabatabaee A, Assadi M M, Noohi A A and Sajadian V A. Isolation of biosurfactant producing bacteria from oil reservoirs. Iranian J. Env. Health Sci. Eng 2005; 2 (1):6-12.&#xD;
&#xD;
21. Vali S R, Sheng H Y and Ju Y H. An efficient method for the purification of Arachidonic acid from fungal single cell oil (ARASCO). JAOCS 2003; 80 (7):725 - 30.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>4</Volume><Issue>8</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2012</Year><Month>April</Month><Day>25</Day></PubDate></Journal><ArticleType/><ArticleTitle>STUDY OF THE REASONS OF THE RADIOGRAPHIC IMAGES REPETITION IN SISTAN AND BALUCHESTAN&amp;#39;S TREATMENT CENTERS&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>185</FirstPage><LastPage>188</LastPage><AuthorList><Author>Mohammad Javad Keikhai Farzaneh</Author><AuthorLanguage>English</AuthorLanguage><Author> Reza Afzalipour</Author><AuthorLanguage>English</AuthorLanguage><Author> Mojtaba Vardian</Author><AuthorLanguage>English</AuthorLanguage><Author> Mahdi Shirin Shandiz</Author><AuthorLanguage>English</AuthorLanguage><Author> Mohammad zarei</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background and Objective: the repetition of radiographic images causes increased dose of the patients and personnel, reduced life of the equipment and wasting the national capitals away. By identifying the percentage of the repetition of radiographic images and the factors associated with it, we can significantly make help to reducing the dose of patients, increase the useful life of the equipment, increase the efficiency of personnel, reduce the dose of personnel and make economy in national costs. Materials and Methods: in this descriptive study, the radiographic images had been collected for 3 months from nine governmental hospitals in the province of Sistan and Baluchestan and also the reasons why the radiographic images were not accepted by the experts resident in that center was studied. In this study, the reasons of the repetition of radiographic images were studied as follows: error in exposure conditions, error in positioning the patient, lack of adoption between radiation center and cast center, inappropriate choosing of the film size, movement of the patient, the error resulted from radiography equipment, error in the process of fixation and emergence, lack of appropriate choosing of the radiation point on the limb and other cases. Findings: Of the 34287 films used in nine treatment center, 4434 films were repeated and the overall percentages of the repetition of radiographic images were 12.9% which the maximum percentage of the repetition of radiographic images was in Amiralmomenin Hospital in Zabol&#xD;
(26.9%) and the minimum percentage was related to Nabiakram Hospital in Zahedan (6.7%). Of the factors related to the repetition of radiographic images, the maximum percentage of repetition was related to the high radiation condition (3.22%) and the minimum amount was related to inappropriate choosing of the film size (0.21%). The percentage of other factors comprised of choosing the radiation condition (2.38%), error in radiation center (1.88%), error in equipment performance (0.61%), error in the patient&#x2018;s positioning (0.61%), movement of the patient (0.33%), darkroom (1.57%) and other factors (2.08%).&#xA0;Conclusion : The percentage of the repetition of radiographic images in governmental hospitals in Sistan and Baluchestan province are in acceptable level in comparison with the statistics issued in other centers,&#xD;
the percentage of the repetition of radiographic images can be significantly reduced and the national capitals can be prevented to be wasted away through taking the measures such as regular quality control of X-ray equipments , training the less experienced personnel and designing the methods of appropriate choosing of radiation condition.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>radiography, film, darkroom, radiation condition, radiographic images, Sistan and Baluchestan</Keywords><Fulltext>INTRODUCTION&#xD;
Due to the fact that X-ray is frequently applied to diagnose diseases and to reduce the patient&#x2018;s dose and prevent from wasting the national capitals away, studying the amount and factors resulted in the repetition of radiographic images are an unavoidable necessity so that inappropriate using of X-ray generators causes the over-exposure of patients and personnel in radiology department which is contrary to the ALARA (As Low As Reasonably Achievable) principle (1). On the other hand, the repetition of radiographic images causes increased amount of time in giving services to patients, the patient&#x2018;s dissatisfaction, reduced useful life of the equipment and wasting the national capitals away. Therefore, the factors which are led to the repetition of radiographic images in treatment centers should be taken into consideration and the re-exposure of the patient should be prevented as much as possible. The significant factors of the repetition radiographic images are as follows: the inappropriate radiation factors, the error in the apparatus&#x2018;s performance, movement of the patient, error in the film size, lack of adoption of the radiation center and cast center, lack of appropriate adoption of radiation point on the limb, etc. (2,3). It has been attempted in this study that the amount of the repetition of radiographic images are taken into consideration as well as the most significant factors affecting on the repetition of images be identified in order to the appropriate guidelines be presented to reduce the repetition of radiographic images, and consequently reduce the costs imposed on the treatment center.&#xD;
&#xD;
MATERIALS AND METHODS&#xD;
In this descriptive design, the radiographic images were collected for three months and have been studied by observation as such as according to the overall number of the accepted patients and the number of applied films, repetition fraction was calculated according to the equation below:&#xD;
&#xD;
Ri=Ai/(Ai+Bi) Which in this equation:&#xD;
Ri: fraction of repetition in radiographic center Ai: total number of repeated films&#xD;
Bi: total number of accepted films&#xD;
&#xD;
In the next stage, to determine the factors related to the repetition of radiographic images, the form of data collection was designed and some of the most common factors in the repetition of radiographic images have been written down as below:&#xD;
&#xD;
1- Error in radiation condition which is led to creating a complete dark or white image and this error can be investigated having seen the image.&#xD;
&#xD;
2- Error in patient&#x2018;s positioning which can be investigated by observing the image with asymmetrical zooming or lack of complete seeing of the concerned limb.&#xD;
&#xD;
3- Lack of appropriate choosing of the radiation point on the limb and lack of adoption of radiation center with cast center which this error can be investigated with seeing the image.&#xD;
&#xD;
4- Inappropriate choosing of the film size.&#xD;
&#xD;
5- Patient movement, which this error causes the fading and lack of clarity of the image&#xD;
&#xD;
6- Error resulted from the equipment which can be investigated by studying an image with two projections in a film and seeing the image of the patient in the experiments which several radiography are performed to follow up the performance of the limb.&#xD;
&#xD;
7- The changes in the appearance of the image in darkroom which this error can be studied by observing the image, because it can be clearly seen by inappropriate washing of the film or dislodging the film&#x2018;s emulsion due to the roller&#x2018;s failure. 8- Other factors which can be involved such as artifact, error in performing the demanded radiography, etc. In the next stage radiographic images are investigated by the experts in radiology in each hospital and will be involved in the special form according to the above definition. Finally, after complete the related forms, the repetition of radiography images, absolute frequency, relative frequency and frequency percentage for the factors related with according to the mentioned cases are determined and the objectives of the plan have been realized.&#xD;
&#xD;
FINDINGS AND DISCUSSION&#xD;
During performing this design, 34287 films were used in the concerned hospital. Table 1 shows the percentage of repetition of radiographic images in the concerned hospitals.&#xD;
&#xD;
&#xD;
&#xD;
Due to the fact that the range of the percentage of radiography images repetition in several studies has been indicated between 0.9% to 27.6% (4-9), it can be said that the percentage of the repetition in governmental hospitals of Sistan and Baluchestan province are in an acceptable range. This study indicated that high radiation condition and inappropriate choosing of film size are the most and least possible causes for repetition, respectively. Amiralmomenin hospital of zabol and Nabi -Akram Hospital of Zahedan have the most and least percentage of repetition, respectively. In the studies performed by Nixon (7) and Morgan (9), error in positioning has been indicated as the most significant cause in the repetition of radiographic images, while in the current study, patent positioning and performance error of the equipment are both in sixth grade. The admission statistics in Imamkhomeyni of Zabol and Khatam of iranshahr Hospitals are higher than other treatment centers and due to the high lifetime of the equipment of Zabol&#x2018;s Imamkhomeyni Hospital, providing a new equipment for this hospital is necessary. On the other hand, inappropriate filtration of the equipment in Taminejtemai Hospital of Zahedan causes the percentage of the repetition of radiography images is high in this center. Therefore, the filtration function of this equipment should be corrected. Finally, due to the results obtained in this study, the following measures can be effective in reducing the repetition of radiographic images in governmental hospitals of Sistan and Baluchestan Hospitals: Providing the auxiliary equipment to make limit the regarded limb of the patient, proving the special charts of choosing the radiation condition for the employees who are less experienced, replacing some of the radiography equipments, regular quality control of the equipments and the processors and continuous training of the personnel. The Amiralmomenin Hospital of Zabol also have a high percentage of exposure repetition which talking with the patients before being exposed and the precision of radiologists are necessary to improve the condition.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1858</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1858</Fulltext></URLs><References>1. Clark PA, Hogg P. Reject/repeat analysis and the effect prior film viewing has on a department&#x2018;s reject/repeat rate. Radiography 2003; 9: 127-137.&#xD;
&#xD;
2. Ali asgharzadeh A, Mohseni M. Evaluation of repeated radiographic films and its causes in Kashan hospital in 2003. J Feiz 2005; 33(9): 50-56 (Persian).&#xD;
&#xD;
3. URL:http://www.srp_uk.org/srpcdrom/p4- 7.doc. Accessed Feb 21, 2009.&#xD;
&#xD;
4. Jadidi M. Quality assessment of the radiography films. J Iran Univ Med Sci 2002; 30(9): 317- 326 (Persian).&#xD;
&#xD;
5. Peer S, Peer R, Giacomuzzi S.M, Jaschke W. Comparative Reject Analysis in Conventional Film-screen and Digital Storage Phosphor Radiography. Radiat Prot Dosim 2001; 94 (1- 2): 69-71.&#xD;
&#xD;
6. Lewentant G, Bohndorf K. Analisis of reject X-ray films as a quality assurance element in diagnostic radiology. Rofo 1997; 166: 376- 381.&#xD;
&#xD;
7. Nixon PP, Thorogood J, Holloway J, Smith NJ. An audit of film rejects and repeats in a department of dental radiology. Br J Radiol 1995; 68: 1304-1307.&#xD;
&#xD;
8. Al-Malki MA, Abulfaraj W.H, Bhuiyan S.I, Kinsara AA. A study on radiographic repeat rate data of several hospitals in Jeddah. Radiat Prot Dosim 2003; 103: 323-330.&#xD;
&#xD;
9. Morgan TL, Banks DA, Kagan AR. Radiation therapy port film, a quality assurance study. Int J Radiat Oncol Biol Physics 1998; 42(1):223-227.&#xD;
</References></Article></ArticleSet></xml>
