<?xml version="1.0"?>
<xml><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>Graphical Processing Unit Accelerated Face Resolution Enhancement using Pixels - Homogeneity and Relative- Ratios&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>01</FirstPage><LastPage>05</LastPage><AuthorList><Author>Vikram Mutneja</Author><AuthorLanguage>English</AuthorLanguage><Author> Satvir Singh</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>This work presents a GPU (Graphical Processing Unit) accelerated spatial domain oriented face resolution enhancement algorithm based on the homogeneity levels and relative-ratios of the pixels with respect to its surrounding pixels. The algorithm has been developed, implemented as well as tested in the MATLAB environment. MATLAB is slow in processing but at the same time a resourceful environment for the development in the area of image processing owing to its extremely rich set of functions and programmer-friendly integrated development environment. However, to compensate for the speed loss in testing and implementation phase, we have made use of GPU computing i.e. done parallelization of the algorithm on NVIDIA GPU using CUDA (Compute Unified Device Architecture) interface in the MATLAB environment. It is a simple but efficient algorithm in which kernel matrices are created encoding the homogeneity levels and relative-ratios of all pixels in surrounding four quadrants. Kernel matrices are subsequently applied to reconstruct the HR (High-Resolution) version from input LR (Low-Resolution) facial image.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Image processing, GPU computing, Face resolution enhancement, Surveillance videos, Spatial domain processing</Keywords><Fulltext>Introduction&#xD;
The processing of the facial images is an essential task in the smart video surveillance systems. The resolution of the facial images from surveillance videos is usually very less owing to the various factors such as hardware constraints, distance between the subjects and camera. Therefore enhancement concerning resolution is a major step for the purpose of overall improvement in the task of face detection and recognition. As the task of video processing demaLiterature Survey nds of fast computational processing, the parallelization of proposed algorithm has been done on the NVIDIA Graphical Processing Unit (GPU) in CUDA (Compute Unified Device Architecture) under MATLAB environment.&#xD;
&#xD;
The facial image processing systems can be classified based on different attributes, such as the number of input facial images, face angle, quality and source of images etc. Some of the techniques use single input LR (Low-Resolution) image, while some use multiple LR images which are captured generally from consecutive frames of video. The latter technique reconstructs the HR image from multiple LR images, therefore called as reconstruction based techniques. The other type of techniques which have attracted large amount of research work in past one decade are the learning based techniques. The relationship between single or multiple LR images and corresponding HR image is learned via a machine learning or intelligent technique. Further, the optimization techniques may be applied for tuning of weights to improve the results. Most of the learning based methods are based on the single facial image as input and use the trained system or dictionary to estimate the missing HR details. Reconstruction based models are based on the generalized smoothness priors while the learning based techniques use recognition based priors.&#xD;
&#xD;
Based upon the region of interest, the human facial image processing systems can be classified in two major categories. The methods which use the positions of facial landmarks such as left eye, right eye, nose tip and other facial regions are called as local methods ( Yang et al. (2010), Liu and Yang (2014) ), while another type of technique is based on template matching, called as global methods. Supposedly the local methods require the input facial images of reasonable high quality so that facial landmarks can be extracted, which also depends on the facial image resolution. It is easier to localize the facial landmarks in the high-resolution facial images as compared to the low-resoultion facial image, which necessitates the task of face resolution enhancement.&#xD;
&#xD;
The development techniques for image processing have certain barriers such as the computational load of handling huge amount of graphics data of images which may involve computation on pixels or their extracted features. At the same time, support from the development environment largely affects the development time. MATLAB is an ideal environment for doing research in the area of image processing because of rich set of functions available in its Image Processing, Computer Vision and related toolboxes. However, MATLAB suffers severely in computational performance as applications written in MATLAB do not run directly on CPU or operating system but the MATLAB engine. On the other hand, developing CUDA (Compute Unified Device Architecture) kernels to harness the power of GPU directly into C or FORTRAN requires writing a lot of glue code for tasks such as communicating data between GPU and CPU, managing GPU memory, initializing and launching CUDA kernels and visualizing their output, which makes It difficult to evaluate and test CUDA kernels for whole of input data space and visualizing their corresponding output. To overcome this limitation, MATLAB&amp;#39;s parallel processing toolbox comes to rescue as its GPU computing libraries facilitate to quickly develop, evaluate, visualize and analyze CUDA kernels. &#xD;
&#xD;
In this work, we have done improvements and GPU acceleration of our previous work on face resolution enhancement Mutneja and Singh (2017). This paper is structured as follows: Section 2 provides &#xD;
&#xD;
Literature Survey. &#xD;
The proposed technique based on pixels-homogeneity and relative-ratios has been explained in Section 3, Section 4 describes experimental setup, Sections 5 and 6 elaborates Results and Discussion respectively, and finally, Sections 7 and 8 gives Conclusions and Future Scope respectively.&#xD;
&#xD;
Literature Survey&#xD;
Many researchers have worked in the area of reconstruction based face super-resolution such as by Baker and Kanade (2002), Jiang et al. (2016a), Yang et al. (2010). A lot of work has been done in the learning based face resolution enhancement known as face hallucination such as by Yin et al. (2016), Tu et al. (2017). Some of the works have done hybridization of reconstruction and learning, such as by Yeganli et al. (2016). Many spatial domain based techniques are based on neighbor embedding such as by Chang et al. (2004), Huang et al. (2016), Jiang et al. (2016b).&#xD;
&#xD;
Some researchers have worked in the field of sparse representation based face super resolution. Yang et al. (2010) presented a single image super-resolution by estimating sparse representation for each patch of the low-resolution input to be applied with the high-resolution image patch dictionary. Zhang et al. (2016) proposed a noise robust method based on information entropy and regression, to weight facial patches for estimating high frequency details from input low-resolution facial images. Huang et al. (2017) Proposed a novel sparse coding-based face hallucination method, by incorporating the intrinsic geometric structure of training samples for dictionary learning. Authors worked to minimize artificial effects using graph construction in HR manifold, and K-selection mean constraints for finding optimal weight HR face reconstruction. Rahiman and George (2017) worked on single image super-resolution using neighbor embedding and sparse representation based learning using partitioned feature space and statistical prediction model. Mao et al. (2016) proposed a new weighted-patch super-resolution method using AdaBoost iteratively to focus more on the patches (face regions) with richer information for improving the reconstruction power.&#xD;
&#xD;
Dahl et al. (2017) presented a pixel recursive super resolution model using convolutional neural networks to synthesize realistic details into images while enhancing their resolution, represented a multi-modal conditional distribution by accurately modeling the statistical dependencies among the high-resolution image pixels, conditioned on a low-resolution input.&#xD;
&#xD;
Chen et al. (2017) proposed noisy facial images super-resolution using the contour features to handle noise and standard deviation prior as statistical measure to enhance the low quality contour feature. Jiang et al. (2017) developed facial image super-resolution method based on missing image interpolation information using &amp;#39;Smooth Regression and a novel Local Structure Prior&amp;#39; (SRLSP). Tu et al. (2017) proposed face hallucination method using direct combined approach, independent of size and number of training samples . Hui et al. (2017) developed appearance, geometrical features, and optical flow model single LR based face resolution enhancement technique. Gong and Wang (2017) developed face hallucination based on similarity measurements between single LR and corresponding multiple HR training images.&#xD;
&#xD;
Proposed Technique&#xD;
In this work, GPU acceleration of face resolution enhancement technique has been proposed based on hybridization of homogeneity levels and relative-ratios of pixels in LR patches, by using window based scanning of whole input facial image. Kernel matrices are generated for encoding homogeneity levels as well as relative-ratios to construct resultant HR image. LR patches are slid to the nucleus of HR patches and remaining pixels in HR patch are computed by application of kernel matrices. The size of LR patch has been selected as 3&#xD7;3 which is swelled to make the HR patch of size 5&#xD7;5. For generating the homogeneity kernel matrix, LR window is slid over whole input LR image and checks the homogeneity levels of pixels in the surrounding four quadrants. To check for the homogeneity levels, the summation of pixel intensities is done in the respective quadrant and if found less than the set threshold, is marked as homogeneous otherwise non-homogenous. Figure 1 shows the division of LR patch into four surrounding quadrants. Algorithm 1 shows the working of GPU CUDA Kernel for generating the homogeneity matrix.&#xD;
&#xD;
&#xD;
&#xD;
To generate the kernel matrix for the relative-ratios, the ratio of intensity levels of all the pixel is computed with respect to the central pixel in LR patch. The process of iterating the pixels is same as depicted in the Algorithm 1. After generation of kernel matrices, they are applied to the input image to create the corresponding HR image. Algorithm 2 shows the flow chart of proposed technique to generate the HR image by applying the homogeneity and relative-ratios kernel matrices. The GPU kernel thread block size has been set as 1&#xD7;1&#xD7;1 while the grid size has been set as NR&#xD7;NC&#xD7;1.&#xD;
&#xD;
&#xD;
&#xD;
Experimental Setup&#xD;
The machine running Windows 7 (64 Bit) on Intel Core i3 1.9 GHz and having NVIDIA graphics processing unit GeForce GT 740M has been used to develop and test the proposed method. &#xD;
&#xD;
Results&#xD;
Figure 2 shows the results of application of proposed algorithm (shown in column 4) on some of the test LR images (shown in first column) along with the existing techniques (&#x2018;Bicubic&#x2019; and &#x2018;Box&#x2019;).&#xD;
&#xD;
&#xD;
&#xD;
Table 1 and Table 2 shows the results of application of proposed algorithm on the Gray-scale and Color test images respectively, for different values of scaling factors.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Discussion&#xD;
The quality metrics Structural Similarity Index Measure (SSIM), Peak Signal To Noise Ratio (PSNR), Signal To Noise Ratio (SNR) and Mean Square Error (MSE) have been measured from the generated HR image with respect to the original HR image, along with the measurement of GPU acceleration achieved with respect to the CPU (Central Processing Unit) code (refer Table 1 and 2). As the work has been done in MATLAB, the comparison of results of proposed algorithm has been done with some methods (&#x2018;Bicubic&#x2019; and &#x2018;Box&#x2019;) available in MATLAB (refer Figure 3). &#xD;
&#xD;
The proposed method has been tested on color as well as gray-scale images. Two folders have been created for testing, each containing 20 test images. One of the folders contains gray-scale images and second constitutes color facial images from database color FERET (Phillips et al. (2000, 1998)). Portions of the research in this paper use the FERET database of facial images collected under the FERET program, sponsored by the DOD Counterdrug Technology Development Program Office FERET Phillips et al. (1998), Phillips et al. (2000). Table 1 and Table 2 shows the mean values of measured quality metrics and time taken for gray-scale and color images respectively. The term SF refers to the scaling factor i.e. face resolution enhancement factor. By comparison, it is inferred that application of proposed technique using color based processing (i.e. of channels&#xA0; R,G and B) gives better results as compared to gray-scale based only processing on color images.&#xA0; &#xD;
&#xD;
Further, the efficiency of the proposed algorithm has been tested on different resolution factors. For this, the test images from FERET are down-scaled to the factors 0.6000, 0.3600, 0.2160, 0.1296 and 0.0778. The percentage reduction in the time cost has been calculated in each case. Figure 3 shows the comparison of time cost of proposed algorithm using GPU Computing with respect to the CPU code. The maximum percentage time cost reduction of the order of 28.38% has been achieved corresponding to the scaling factor 1.67 and 22.39% at scaling factor of 12.86.&#xD;
&#xD;
Conclusion&#xD;
We have successfully developed and tested the GPU accelerated face resolution enhancement algorithm based on pixels-homogeneity and relative-ratios in MATLAB environment using CUDA based parallel computing. The testing of the proposed algorithm has been done on test facial images from web and FERET database (Phillips et al. (2000, 1998)) and comparison done with some of the existing techniques in terms of quality metrics SSIM, PSNR, SNR and MSE. It has been observed that considerable speedup was achieved by the parallel execution of proposed face resolution enhancement algorithm as compared to its serial version.&#xD;
&#xD;
As MATLAB interprets the code, and it is the interpreter that slows down the processing, therefore by using GPU computing, we have tried to compensate for this time efficiency loss and at the same time benefitting user friendly environment of MATLAB for efficient development of GPU computing based algorithm. From the results of quality metrics and time efficiency improvement achieved by parallelization, we conclude that proposed system is very effective and efficient in resolution enhancement of facial images.&#xD;
&#xD;
&#xD;
&#xD;
Future Scope&#xD;
In the near future, we intend to make improvements in the proposed technique by making use of shared memory in GPU, increasing the extent of parallelization for further time acceleration, introducing adaptability in terms of selection of size of LR and HR patches for achieving the desired resolution enhancement factors. Further, we intend to hybridize the proposed technique with boosting based analysis for improvement in the quality of resultant HR facial image.&#xD;
&#xD;
AcknowledgementAuthors gratefully acknowledge the support provided by I.K.G. Punjab Technical University, Kapurthala, Punjab, India. Authors deeply acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1638</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1638</Fulltext></URLs><References>&#xD;
	Baker, S. and Kanade, T. (2002). Limits on super - resolution and how to break them. IEEE Transactions on Pattern Analysis and Machine Intelligence, 24(9):1167 - 1183.&#xD;
	&#xA0;&#xD;
	Chang, H., Yeung, D.-Y., and Xiong, Y. (2004). Super-resolution through neighbor embedding. In Computer Vision and Pattern Recognition, 2004. CVPR 2004. Proceedings of the 2004 IEEE Computer Society Conference on, volume&#xA0;1, pages I - I. IEEE.&#xD;
	&#xA0;&#xD;
	Chen, L., Hu, R., Liang, C., Li, Q., and Han, Z. (2017). A novel face super resolution approach for noisy images using contour feature and standard deviation prior. Multimedia Tools and Applications, 76(2):2467 - 2493.&#xD;
	&#xA0;&#xD;
	Dahl, R., Norouzi, M., and Shlens, J. (2017). Pixel recursive super resolution. arXiv preprint arXiv:1702.00783.&#xD;
	&#xA0;&#xD;
	Gong, M. and Wang, K. (2017). Single face hallucination via local neighbor patches. AEU-International Journal of Electronics and Communications, 74:88 - 93.&#xD;
	&#xA0;&#xD;
	Huang, K., Hu, R., Jiang, J., Han, Z., and Wang, F. (2016). Face image super-resolution through improved neighbor embedding. In International Conference on Multimedia Modeling, pages 409 - 420. Springer.&#xD;
	&#xA0;&#xD;
	Huang, K., Hu, R., Jiang, J., Han, Z., and Wang, F. (2017). Hrm graph constrained dictionary learning for face image super-resolution. Multimedia Tools and Applications, 76(2):3139 - 3162.&#xD;
	&#xA0;&#xD;
	Hui, Z., Liu, W., and Lam, K.-M. (2017). A novel correspondence-based face-hallucination method. Image and Vision Computing.&#xD;
	&#xA0;&#xD;
	Jiang, J., Chen, C., Huang, K., Cai, Z., and Hu, R. (2016a). Noise robust position-patch based face super-resolution via tikhonov regularized neighbor representation. Information Sciences, 367:354 - 372.&#xD;
	&#xA0;&#xD;
	Jiang, J., Chen, C., Ma, J., Wang, Z., Wang, Z., and Hu, R. (2017). Srlsp: A face image super-resolution algorithm using smooth regression with local structure prior. IEEE Transactions on Multimedia, 19(1):27 - 40.&#xD;
	&#xA0;&#xD;
	Jiang, J., Hu, R., Wang, Z., Han, Z., and Ma, J. (2016b). Facial image hallucination through coupled-layer neighbor embedding. IEEE Transactions on Circuits and Systems for Video Technology, 26(9):1674 - 1684.&#xD;
	&#xA0;&#xD;
	Liu, S. and Yang, M.-H. (2014). Compressed face hallucination. In Image Processing (ICIP), 2014 IEEE International Conference on, pages 4032 - 4036. IEEE.&#xD;
	&#xA0;&#xD;
	Mao, S., Zhou, D., Zhang, Y., and Zhang, Z. (2016). A boosting method to face image super-resolution. arXiv preprint arXiv:1609.01805.&#xD;
	&#xA0;&#xD;
	Mutneja, V. and Singh, S. (2017). A novel facial image resolution enhancement algorithm using pixels homogeneity. International Journal, 8(3).&#xD;
	&#xA0;&#xD;
	Phillips, P.&#xA0;J., Moon, H., Rizvi, S.&#xA0;A., and Rauss, P.&#xA0;J. (2000). The feret evaluation methodology for face-recognition algorithms. IEEE Transactions on pattern analysis and machine intelligence, 22(10):1090 - 1104.&#xD;
	&#xA0;&#xD;
	Phillips, P.&#xA0;J., Wechsler, H., Huang, J., and Rauss, P.&#xA0;J. (1998). The feret database and evaluation procedure for face-recognition algorithms. Image and vision computing, 16(5):295 - 306.&#xD;
	&#xA0;&#xD;
	Rahiman, V.&#xA0;A. and George, S.&#xA0;N. (2017). Single image super resolution using neighbor embedding and statistical prediction model. Computers and Electrical Engineering.&#xD;
	&#xA0;&#xD;
	Tu, C.-T., Ho, M.-C., and Lin, M.-Y. (2017). A new approach for face hallucination based on a two - dimensional direct combined model. Pattern Recognition, 62:1 - 20.&#xD;
	&#xA0;&#xD;
	Yang, J., Wright, J., Huang, T.&#xA0;S., and Ma, Y. (2010). Image super - resolution via sparse representation. IEEE transactions on image processing, 19(11):2861 - 2873.&#xD;
	&#xA0;&#xD;
	Yeganli, F, Nazzal, M., Unal, M., and Ozkaramanli, H. (2016). Image super-resolution via sparse representation over multiple learned dictionaries based on edge sharpness. Signal, Image and Video Processing, 10(3):535 - 542.&#xD;
	&#xA0;&#xD;
	Yin, Q, Cao, Z., and Zhou, E. (2016). Face hallucination using convolutional neural networks. US Patent 9,405,960.&#xD;
	&#xA0;&#xD;
	Zhang, Y, Zhang, Z, Hu, G, and Hancock, E.&#xA0;R. (2016). Face image super - resolution via weighted patches regression. In Pattern Recognition (ICPR), 2016 23rd International Conference on, pages 3892 - 3897. IEEE.&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>A Study on the Significance of Education of Women in the Self Help Group in Hooghly&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>06</FirstPage><LastPage>10</LastPage><AuthorList><Author>Bhattacharya Soma</Author><AuthorLanguage>English</AuthorLanguage><Author> Goswami A.</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>The present study was conducted in purposively selected Hooghly district in West Bengal with the objective of finding the significance of education of women engaged in self-help groups (SHG). Data collection was done by personal interview with structured schedule applied on randomly selected 164 women who engaged in self help groups.&#xD;
&#xD;
The most of the respondents under study in the districts of Hooghly were also Hindus by religion. Most of them were married having high school education and used to reside in katcha house. They had nuclear type of family and were dependent on business for source of income. Most of them belonged to schedule caste and schedule tribe having no land at all. Majority of them hold cycle and radio and they thought that additional income can help partially in economic improvement of the family. They consider training as most important of their self-employment. They mostly utilized land for firm to generate income. They also maintain good relation with the other members of the family. They had exposure to SHG for 0-2 years for which they thought that the experience of SGSY was hardly helpful for better employment. They had moderate attitudes towards the co-members of the groups. They have moderately accepted the activities assigned by the groups time to time.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Self help group, Swaranajayanti Gram Swarozgar Yojana (SGSY), Women empowerment, Education, Training</Keywords><Fulltext>INTRODUCTION &#xD;
Illiteracy is the second most important problem of poverty in independent India. Female literacy rates are lower than male in India. According to the statistics relating to female literacy reveals a grim picture. Though the female literacy rate has progressively increased from 8.86% in 1951 to 15.34% in 1961 to 21.97% in 1971 to 29.75% in 1981 to 39.42% in 1991, it is still below the desired level (Maitr and Sinha, 1993). Comparing these rates to male literacy is 63.68%, it is clear that female literacy is neglected. Among the literate women only a handful of women obtain their education in order to acquire economic independence; for the majority, literate women receive an education only to become more eligible in for marriage (Johnson and Johnson, 2001). The low level of literacy has a negative impact on women&#x2019;s lives and their families&#x2019; lives and on their country&#x2019;s economic development. Many studies indicate that illiterate women have high levels of fertility and mortality, poor nutritional status, low earning potential, and little autonomy within the household. There are large gap between the literacy levels of men and of women. Since 1981, the gender gap in literacy has been decreasing in India. In 1991, the urban female literacy rate was more than twice that of the rural rate, 64 and 31 percent, respectively (RGCC, 1993). There havebeen substantial increases in literacy rates in both urban and rural areas though the gap between the two sectors has not narrowed appreciably. 79 percent women are literate in the state Mizoram and this is the second highest literacy rate in India. Beside that there are several states including Bihar and Uttar Pradesh the literacy rates are less than 30 percent. Many states of India have large rural-urban differences in female literacy. The state with highest female literacy is Kerala, where nearby 86 percent women are literate in 1991. In west Bengal 50 percent or less of the women are literate.&#xD;
&#xD;
Self-help Groups (SHGs) are playing a major responsibility in rural India today. Self-help as a strategy for social development places prominence on self-reliance, human agency and action. It aims to mobilize people, to give them voice and build people&#x2019;s organizations that will overcome barriers to participation and empowerment. Development involves changes in the awareness, motivation and behavior of individuals, in the relations between individuals as well as between groups within a society (Burkey, 1993:48). These changes can come from within individuals and groups through self-help, and not necessarily from outside. The experiences of self-reliance have led to attempt to build local level organizations like, cooperatives, credit societies, neighborhood or community development associations, water sharing associations or women&#x2019;s groups. The Neo-liberal paradigm has also included self reliance as a strategy for building people&#x2019;s entrepreneurial spirits and absorption into the capital market (Fernando 2006:17). The SHGs in India are small, informal and homogenous groups of not more than twenty members each. The groups are kept informal to minimise their association with bureaucracy and corruption, unnecessary administrative expenditure and profit constraints. The size of twenty is devise as any group larger than that would need to be registered under the Indian legal system and that brings a whole range of regulatory constraints (Harper, 2002a:179).&#xD;
&#xD;
The well-known formation of the SHGs means that it has also taken the form of a movement for women&amp;#39;s social development in India. Self-help groups, as a strategy for women&#x2019;s development, have arisen out of the perceived problem of women&#x2019;s lack of access to resources at both the household and the village level. Women&amp;#39;s development has to go outside the economic and place importance on issues connecting to equal opportunity, autonomy and self reliance at the individual level and on solidarity of the community (of women) at the group level (Hardiman and Midgley 1982, Dube 1988, Pieterse 2001). SHG is a mechanism for women&#x2019;s development to bring in individual and collective empowerment through improvement in both &#x2018;condition&#x2019; and &#x2018;position&#x2019; of women. &amp;#39;Condition&#x2019; is the material state in which poor women live; and&#xA0;&amp;#39;Position&#x2019; is the social status of women relative to men. The programme covers all aspects of self employment such as organization of the rural poor into self help groups (SHGs) and their capacity building, infrastructural support, technology, planning of activity clusters, credit and marketing. The expenditure to be borne by the Government will be shared between the State and the Centre in the ratio of 75:25. It should be met out of SGSY funds but should not be included in the individual subsidy ceiling applicable to the beneficiary. The SGSY will particularly focus on the vulnerable groups among the rural poor. Accordingly, the SC/STs will&#xA0;account for a minimum of 50%, women for 40% and disabled for 3% of the total swarozgaris assisted during the year. Financial assistance to Swarozgaris under SGSY comprises of two components viz. loan and subsidy. SGSY is a creditlinked scheme and credit is the key component. Subsidy is only a minor and enabling component. The group also undertakes liability to closely monitor the asset management and income generation. SGSY Govt. Guide line reported that 50% of the groups formed in each block should be exclusively for the women. In the case of disabled persons, the groups formed should ideally be disability-specific wherever possible, however, in case sufficient number of people for formation of disability-specific groups are not available, a group may comprise of persons with diverse disabilities or a group may comprise of both disabled and non-disabled persons below the poverty line. In our society, members are linked by various common bonds like caste, sub-caste, community, blood relation, place of origin, activity etc.&#xD;
&#xD;
Relevance of the Study &#xD;
Self Help group (SHG) is a self-governed, peer-controlled small and informal association of the poor, usually from socio-economically homogeneous families who are organized around savings and credit activitiesfor improving the present status of Indian women specially for the below poverty line (BPL) women. In this study the researcher is attempt to find out the status of education of women, how much education helps to get this activities, how much training is essential.&#xD;
&#xD;
Objectives &#xD;
1. To find the source of income of the respondent&#xD;
2. To find out the caste of the respondent&#xD;
3. To find out the status of education of women in involving in SHG.&#xD;
4. To find out the effectiveness of education.&#xD;
5. To find out the essentiality of training.&#xD;
&#xD;
Review of literature &#xD;
Reddy and Rao (1995) analysed the various issues and components of empowerment and reported that there was marginal difference in self perception of women&#x2019;s role. While, there was absolutely no difference between the beneficiaries and non beneficiaries on socio-cultural aspect. The area of education and training was second lowest among the five components of empowerment for both beneficiaries and nonbeneficiaries. The economic aspect was one of the strongest among the five components of empowerment followed by public co-operation with considerable difference between the scores of beneficiaries and non-beneficiaries. Stromquist (1995) in her article on educational empowerment for women, interpreted empowerment as a "socio-political concept that goes beyond formal political participation and consciousness raising&#x201D;. She argues that a "full definition of empowerment must include cognitive, psychological, po-litical and economic components Ranjitha (2003) revealed that rural women under SHG were under full control of their own lives and became a productive member of their family. The training was an added advantage to develop entrepreneurship among the farm women through improved practices. Handy and Kassam(2004) described that woman&#x2019;s behavior varies across the stages in the life cycle. As a woman grows older, understanding can instruct her to stand up for her own rights. As her children grow older and are less dependent on her she can stress herself better without the threat to her children&#x2019;s well being. Also within the conventional family structure, as a woman gets older and her sons get married and her own in-laws grow older and die, the Indian woman is promoted from the comparatively obedient daughter-in-law to the role of a mother-in-law, the one &#x2018;who must be obeyed&#x2019;&#xD;
&#xD;
METHODOLOGY &#xD;
Conventionally West Bengal is divided in to two parts i.e. North Bengal and South Bengal . Hooghly represent in South Bengal. Hooghly represents the lowest number of Women SHGs (WSHG).Therefore, Hooghly districts was purposively selected on the basis of the number of WSHG. Khanakul-II block of Arambagh Sub-division in Hooghly District was selected on the basis of highest population of B.P.L household as well as rural exposure. Sreerampur&#xA0; - Utterparablock under Sreerampur&#xA0; - Utterpara Sub-division was selected on the basis of lowest population of B.P.L household as well as urban exposure. Rishra Gram Panchayet in Sreerampur &#x2013;Utterparablock under Sreerampur&#xA0; - Utterpara Sub-division in Hooghly district was selected on the basis of highest number of WSHG and Nabagram Gram Panchayet in Sreerampur &#x2013;Utterpara block under Sreerampur &#x2013;Utterpara Sub-division in Hooghly district was selected on the basis of lowest. number of WSHG. Rajhat Gram Panchayetin Khanakul-II block of Arambagh Sub-division in Hooghly District was selected on the basis of lowest number of WSHG. Dhanyaghori Gram Panchayetin Khanakul-II block of Arambagh Sub-division in Hooghly District was having selected on the basis of Highest no. of WSHG.&#xD;
&#xD;
Total number of respondents in Hooghly District were 100 from Sreerampur &#x2013;Utterpara Sub-division and 64 of Arambagh Sub-division . Total 100 + 64 =164 respondents were selected from Hooghly District.&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
RESULT&#xD;
Some Demographic indicators and Socio-Personal characteristics of Sample respondents (SHG ) Hooghly district of W.B. are being shown in table:1 in terms of frequency and percentage (%) distribution The analytical study of the table- 1 have shown that maximum respondents were hindus by religion 81.0% and 19.0% respondents belong to muslim community. Lalitha (1997) in her study on rural women empowerment and development banking reported the profile of the effective women borrowers. Where majority of them belonged to backward caste of hindu religion and were agricultural labourers. The cursory looks at table- 1 revealed that majority (95.1%) of the respondents were married followed by unmarried (3.7%), widow (0.6%) and divorce (0.6%). Most of the family&#x2019;s source of income is business (43.9%) and agriculture (35.9%), other source of family income is animal husbandry (1.8%), service (16%), and others (1.8%). Agarwal (1994) observed that in rural India in 1993-94, 86 per cent of women workers were in agriculture, compared with 74 per cent of men.&#xD;
&#xD;
Majority of respondents belongs to scheduled caste and schedule tribe (49.4%). There was 0.6%respondents belonging to OBC and 30.7% respondents belong to general caste. It is clear from the table that majority of respondents were having high school (34.7%) education, followed by primary (21.9%), and read and write only (14%), can read only (5.5%), graduate(8.0%) among the respondent. Prasad (2000) reported that 90 per cent of women in the SHG federation have learnt to sign their names. Many have come forward to learn how to read and write and some have shown a keen interest in computers The table- 1 reported that most of families are nuclear type (71.9%) and 28.1% families are joint type. According to Femida Handy And MeenazKassam(2004)&#xA0;We expect that in a joint family she will have less autonomy than in a nuclearfamily structure. As reported in this table-1that 44.5% respondent resided in mixed house, 40.8% respondents lived at pucca house,3.1% respondents lived in kucca house, 1.2% respondents were lived in hut and no respondents had multistoried house. A detail look in the table indicated that maximum number of respondents (34.2%) had land up to 10 bigha and 65.2% respondents have no land and no respondents having above 2 hectors land, only 0.6% respondents were having 1 to 2 hectors land&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
DISCUSSION &#xD;
The analytical study has shown that maximum respondents were hindus by religion and majority of the respondents were married Most of the family&amp;#39;s source of income is business and agriculture, other source of family income is animal husbandry, service .Most of respondent belongs to Sc and ST. The objective of the study is to find out the status of education of women in involving in SHG It is clear from the table that majority of respondents were having high school (34.7%) education, followed by primary (21.9%), and read and write only (14%), can read only (5.5%), graduate(8.0%) among the respondent. Another objective is to find out the essentiality of training. The result shows that maximum numbers of respondent strongly agree with that.&#xA0;&#xD;
&#xD;
CONCLUSION &#xD;
The most of the respondents under study in Hooghly districts were hindu by religion and most of them were married. Most of the family&amp;#39;s source of income is business and agriculture.&#xD;
&#xD;
ACKNOWLEDGEMENT &#xD;
Sincere thanks are attributed to all teachers and Scholars for their suggestion and timely help during my work. I am also grateful to D.R.D.C Hooghly and SIPRD at Kalyani, Nadia, for their valuable help during the study&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1639</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1639</Fulltext></URLs><References>1. Agarwal, B. (1994), A field of one&#x2019;s own : Gender and land rights in South Asia, New York, Cambridge University Press.&#xD;
&#xD;
2. Burkey, S. (1993) People First: A Guide to Self-Reliant Participatory Rural Development. Zed Books, London.&#xD;
&#xD;
3. Fernando, J. L. (2006) Microfinance: Perils and Prospects. Routledge, London.&#xD;
&#xD;
4. Harper, M. (2002a) &amp;#39;Self - help Groups and Grameen Bank Groups: What are the Differences&amp;#39; in Fisher, T. and Sriram. M.S. Beyond Micro-Credit: Putting Development Back into MicroFinance. Vistaar Publications, New Delhi, pp. 169 - 198.&#xD;
&#xD;
5. HandyaFemidAndMeenazKassam, Women&#x2019;s empowerment in rural India, Paper presented as the ISTR conference, Toronto Canada July, 2004&#xD;
&#xD;
6. Hardiman, M. and Midgley, J. (1982) The Social Dimensions of Development: Social Policy and Planning in the Third World. J. Wiley, New York.&#xD;
&#xD;
7. Johnson, Pamela S. and Johnson, Jennifer A. (2001). The oppression of women in India. Violence against women, 7(9): 1051- 1068.&#xD;
&#xD;
8. Lalitha, N., (1997), Rural women empowerment and development banking, Kaniskha Publishers and Distributors, New Delhi.&#xD;
&#xD;
9. Maitra-Sinha, Anjana.(1993).Women in a Changing Society. New Delhi: Ashish.&#xD;
&#xD;
10. Prasad, U., (2000), Self-empowerment women set to change face of Kolar. The Indian Express, May, 21, pp. 9.&#xD;
&#xD;
11. Renjitha, R. (2003).&#x201C;Empowerment of rural women through SHG: M.Sc. Thesis, submitted to Indian Agriculcutral Research Institute, New Delhi.&#xD;
&#xD;
12. Reddy and Rao, (1995), Women organization and power structure, Chugh Publications, Allahabad, India.&#xD;
&#xD;
13. Stromquist, Nelly P. (1995). "The Theoretical and Practical Bases for Empowerment", in Carolyn Medel - Anonuevo ed. Women, Education and Empowerment: Pathways Towards Autonomy. Report of the International Seminar held at UIE, Hamburg, 27 January&#xA0; - 2 February 1993. Paris: UNESCO.&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>Determination of Sex Through Handwriting Characteristics&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>11</FirstPage><LastPage>18</LastPage><AuthorList><Author>Sushma Upadhyay</Author><AuthorLanguage>English</AuthorLanguage><Author> Jyoti Singh</Author><AuthorLanguage>English</AuthorLanguage><Author> S.K. Shukla</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Aim: The aim of this study is to determine the gender of an individual by handwriting Methodology: In this study total 130 handwriting samples were collected and analyzed. In whichF&#xA0;65 males and 65 female volunteers of age group 18 to 30 years were selected. Handwriting samples are taken on A - 4 Size paper of London Letter. Exclusive factors in this study are only literate, young and healthy persons are included.&#xD;
&#xD;
Result: Macro features and micro features were examined in all the 130 handwriting samples in both male and females by using feature extraction method and z- tests. In the second method which is Hypothesis testing done by z-test, Null hypothesis was taken that there is no significant difference in male and female handwriting and on the basis of value of z in table - 2 at 5% level of significance with critical value of 1.96, out of 27 features for which z-test was performed, Seven features could said to be gender identifying features and may help in identifying the gender of the writer.&#xD;
&#xD;
Conclusion: On the basis of above result, feature extraction and z- test may said to be the two methods which may explain about the utility of these tests for examination of hand writing for gender identifying feature. It can be said that there is a significant differences between hand writing of male and female and hence a handwriting sample can also be examined for gender identification purpose.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Handwriting, Gender, Natural variation, Macro features, Question document</Keywords><Fulltext>INTRODUCTION &#xD;
Documents play important role in human life. A document is material, having a symbol or writing on it, which conveys some meaning to one or persons. It may be stone, a wall, a wooden piece, a glass, a metal sheet a skin, a piece of cloth, a parchment or a paper. We daily write and sign a number of documents, like a person letter, a receipt, a cheque, or an order affecting the lives of many individual 1. With the increasing use of documents in day to day life its misuse has also increased to the utmost level people due to its falsification which has now been grow to a big economical source whether it is beyond the laws and illegal. When it comes to the criminal justice system the false or forged document becomes a questioned. Questioned documents defined as &#x201C;Any Document about which some issue has been raised or that is the subject of an investigation2 . Handwriting is one of the important evidence which is examined in the questioned document for its authentication handwriting may be defined as written speech of individual with characteristic peculiar to himself intending to difference from all other. By studying and examining the handwriting in suspected and the victim. A person&#x2019;s handwriting changes over the course or his or her life time.3 Apart from above explained characteristics, handwriting may be differentiated in the basis of various natural variations such as illness, age writing materials, writing position, physical disturbance, lack of concentration during the writing period, influence of alcohol or drug3 .Research shows a consistent relationship with handwriting is the determination of sex of handwriting .4 Western reports of handwriting shows that female handwriting has greater circularity.4,5,6,7,8 One contender for conceivable impact is the impact of androgens that &#x201C;&#x201D;masculine&#x201D;&#x201D; behavior and possibly neural substrates during the critical pre-birth period. A particularly sensitive period when there is an expansion in androgens is from 7 to 24 weeks with an ideal level in the eighteenth week .9 21 segregating components in handwriting are distinguished. Analyzing shape variations of each letter (called allographs) can be valuable, however word development is similarly if not more critical for investigations, for example, gendering a writer based on handwriting: specifically, word arrangement in cursive written work tends to "convey" more independence and examples than individual letter shapes. 3,10 A characteristic specimen contains just habits and natural variations .Factors in penmanship vary as far as the recurrence of natural variations (or the level of characteristic variety as on account of proportion factors) 11,12,13.can be valuable, however word development is similarly if not more critical for investigations, for example, gendering a writer based on handwriting : specifically, word arrangement in cursive written work tends to &#x201C;convey&#x201D; more independence and examples than individual letter shapes. 3,10 A characteristic specimen contains just habits and natural variations .Factors in penmanship vary as far as the recurrence of natural variations (or the level of characteristic variety as on account of proportion factors) 11,12,13.&#xD;
&#xD;
Area of Study &#xD;
The study was conducted in the area of Bilaspur district of Chhattisgarh. and sampl collection was done within the area of Guru Ghasidas Vishwavidyalaya, Bilaspur.&#xA0;&#xD;
&#xD;
Methodology&#xD;
Sampling:&#xD;
Total 130 handwriting samples were collected. 65 from males and 65 from female volunteers, from the higher secondary, graduated or post graduated working individuals between the age group of 18 to 30 years. All the personal details of volunteers is firstly noted down in the white sheet of paper which contains Name, Sex, Date of birth ,Education ,Occupation, Handedness and Local address. Handwriting samples are taken on A-4 Size paper of London Letter. Exclusive factors in this study are only literate, young and healthy persons are included. Volunteers were asked to sit straight and copy the given London Letter and everyone is asked with their normal speed neither too slow nor too fast on a stable flat table and chair in adequate amount of light. Two methods were employed for the examination of gender identifying features in handwriting samples of male and female volunteers.&#xD;
&#xD;
Feature Extraction: &#xD;
1. Each sample was analyzed for presence of total 27 features of handwriting which were divided in two groups Macro features and Micro features. These features were studied for identifying any discrimination on the basis of their presence and absence in both males and females handwriting.4 Macro feature: Macro features are those which can be observed superficially without any thorough search in the handwriting. Slant Word spacing Dispersive writing.&#xD;
&#xD;
Cursive writing &#xD;
Micro feature: Micro features are those which are needed to be examined carefully for their presence in the sample, Micro feature&#xA0; - Dot over "i"&#xD;
Hook at the start of "c"&#xD;
Hook at the end of "c"&#xD;
Hook at the end of &#x201C;d&#x201D;&#xD;
Hook at the end of &#x201C;e&#x201D;&#xD;
Hook at the end of &#x201C;h&#x201D;&#xD;
Hook at the end of &#x201C;u&#x201D;&#xD;
Loop formation in stem letter &#x201C;b&#x201D;&#xD;
Loop formation in stem letter &#x201C;d&#x201D;&#xD;
Loop formation in stem letter &#x201C;h&#x201D;&#xD;
Flourish at the start of &#x201C;a&#x201D;&#xD;
Flourish at the start of &#x201C;c&#x201D;&#xD;
Flourish at the start of &#x201C;d&#x201D;&#xD;
Flourish at the start of &#x201C;o&#x201D;&#xD;
Flourish at the start of &#x201C;u&#x201D;&#xD;
Consistency in angle of crossbar on &#x201C;t&#x201D;&#xD;
Consistency in angle of crossbar on &#x201C;f&#x201D;&#xA0;&#xD;
Consistency in &#x201C;X&#x201D; Shape of &#x201C;r&#x201D;(acrade)&#xD;
Shape of &#x201C;r&#x201D; (parochial) Knot formation n the&#xD;
End of &#x201C;w&#x201D;&#xD;
Straight down stroke formation in &#x201C;y&#x201D;&#xD;
Angular base of letter &#x201C;w&#x201D;&#xD;
Point base of &#x201C;w&#x201D;&#xD;
Upward flourish letter &#x201C;s&#x201D;&#xD;
&#xD;
Apart from above explained characteristics, handwriting may be differentiated on the basis of variation due to age, illness, education ,fatigue, physical and emotional disturbance, disease, or drug intoxication3 .&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
2. Slant of the writing were observed keeping the handwriting sample at 90o angle to the eye, it was either leaned to the right or left hand side or simply be vertical.&#xD;
&#xD;
3. Spacing between words was calculated by using plastic ruler in centimetre unit of length. Overall 49 spaces were present in the given standard text and hence mean value of all the spacing was calculated . It may vary in each sample of handwriting. Mean=Total length of all the spacing between the words in (cm) / Total no. of spaces present.&#xD;
&#xD;
4. Type of handwriting was observed , whether it was distributed or scattered form called as Dispersive writing. In this, usually letters are separated apart from each other in each word lacking connecting strokes and flourishes.&#xD;
&#xD;
5. Next macro feature which was observed was the Cursive type of handwriting. It was the most beautiful and presentable form of writing in which lots of flourishes and connecting stroke are seen . It also tells the skill and education level of its writer.&#xD;
&#xD;
6. Then micro features were observed in which first comes the dot over letter &#x201C;i&#x201D; which may be either circular in shape or pointed. When both type of dot was present then the type which was present more in number in overall writing was considered.&#xD;
&#xD;
7. Hook like formation was then observed and counted in start and end of letter c,d,e,h and u&#xA0;8. Loop in the letter b,d and h was observed.&#xD;
&#xD;
9. Then flourishness at the start of letters a,c,d,o and u was observed and counted. 10. Overall consistency in the crossbar in the letter &#x201C;t and f was observed. Then consistency in the shape of letter x was noted down. 11. Shape of letter r in small was observed and counted for being arcade or parochial&#xD;
&#xD;
12. In some handwriting a small circular or little oblong knot was found in the end of letter &#x201C;w&#x201D; which was observed and noted down.&#xD;
&#xD;
13. Letter &#x201C;y&#x201D; may be straight in its lower stem or slanted&#xA0;hence it was observed in both the male. 14. Base of the letter &#x201C;w&#x201D; was observed for being angular or pointed in appearance.&#xD;
&#xD;
15. Last micro feature observed was the presence of upward flourish in letter &#x201C;s&#x201D;.&#xD;
&#xD;
16. After observation and counting of each feature their overall percentage were calculated in 65 samples of male handwriting and 65 samples of female handwriting.&#xD;
&#xD;
17. Based on all the observations and values obtained a table and graph were formed.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
Hypothesis Testing and Z- Test &#xD;
Hypothesis may be defined as a proposition or a set of proposition set forth as an explanation for the occurrence of some specified group of phenomena either asserted merely as a provisional conjecture to guide some investigation or accepted as highly probable in the light of established facts. Hypothesis testing enables us to make probability statements about population parameter . The hypothesis may not be proved absolutely, but in practice it is accepted if it has withstood a critical testing . Alternative hypothesis is usually the one which one wishes to prove and null hypothesis is the one which one wishes to disprove . Thus, a null hypothesis represents the hypothesis we are trying to reject , and alternative hypothesis represents all other possibilities. Generally, in hypothesis testing we proceed on the basis of null hypothesis, keeping the alternative hypothesis in view , on the assumption that null hypothesis is true, one can assign the probabilities to different possible sample results , but this cannot be done if we proceed with the alternative hypothesis. Hence the use of null hypothesis is quite frequent. The level of Significance : This is a very important concept in the context of hypothesis testing. It is always some percentage(usually 5%) which should be chosen with great care thought and reason. In case we take the significance level al 5 percent, then this implies that null hypothesis will be rejected . z- test is based on the normal probability probability distribution and is used for judging the significance of several statistical measures, particularly the mean. This is a most frequently used test in research studies(5). p1 = X1/n1 p1-proportion of male handwriting samples where the features occurs samples w here the feature p2= X2/n2 p2 &#x2013; proportion of female handwriting samples where the features occurs X1, X2 - frequencies of feature in males and females respectively n1, n2- no. of samples of male and females handwriting respectively z = 1.96(10) 1. Null hypothesis was stated that &#x201C;there is no significant difference in handwriting of male and female&#x201D; . 2. p1 and p2 value were calculated separately for each of the feature in male and female handwriting. 3. By keeping all the obtained values in the formula, z-test was performed and thus values obtained were noted down. 4. Thus all the obtained values were tabulated.&#xD;
&#xD;
RESULT AND DISCUSSION &#xD;
Data was obtained from 130 handwriting samples of male and females. Macro features and micro features were examined in all the 130 handwriting samples in both male and females by using feature extraction method and z-tests. Two macro features that are slant and word spacing were also observed. Slant was observed to be either right sided , left sided or vertical in which 17 samples were in Right, 20 in left and 43 in vertical positions in males whereas in female 25 were in right 11 in left and 31 in vertical position out of 65 . In case of word spacing both male and female samples were having Mean of word spacing, O. 35cm-0.96cm and 0.34- 0.92cm hence there was no significant difference was observed in the case of word spacing as range was near about similar in both. Whereas in the case of slant (macro feature) males were observed to be possessing slant in their writing in left and vertical position more than females on the other hand females were observed to be possessing slant in right hand side as compared to males . This could be used as one of the point in discriminating the handwriting samples on the basis of slant. On the basis of the study of table-1, out of 27 characteristics feature of handwriting 11 feature i.e. Dot over &#x201C;i&#x201D; Straight down stroke formation of letter &#x201C;s&#x201D;, angle of crossbar on &#x201C;f&#x2019;,&#x201D;t&#x201D;, flourish at letter &#x201C;o&#x201D;, loop in stem of letter&#x201D;d&#x201D;, hook at end of &#x201C;u&#x201D;, &#x201C; h&#x201D;, and hook at start and end of letter &#x201C;c&#x201D; and cursive type of writing were observed to be showing significant role in discrimination of male and female handwriting on the basis of their occurrence which was half in one sample and double on the other. In the second method which is Hypothesis testing by z-test, Null hypothesis was taken that &#x201C;there is no significant difference in male and female handwriting &#x201C; and on the basis of value of z in table-2 at 5% level of significance with critical value of 1.96, out of 27 features for which z-test was performed, 7 showed value of z more than the critical value 1.96 i.e. cursive writing Dot over letter &#x201C;i&#x201D; , Hook at the end of letter &#x201C;c&#x201D;, Loop formation in stem of letter &#x201C;d&#x201D;, Flourish at start of letter &#x201C;d&#x201D;, Consistency of angle of crossbar on &#x201C;t&#x201D; and Straight down stroke formation in &#x201C;y&#x201D;. Hence in these 7 features null hypothesis was rejected and alternate hypothesis was accepted that there is a significant difference in handwriting of male and female . These seven features could said to be gender identifying features and may help in identifying the gender of the writer.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
CONCLUSION &#xD;
On the basis of above result, feature extraction and z-test may said to be the two methods which may explain about the utility of these tests for examination of hand writing for gender identifying feature. Those characteristics feature which showed positive result in the examination of 65 samples of male and female may be considered as gender identifying features. It can be said that there is a significant differences between hand writing of male and female and hence a handwriting sample can also be examined for gender identification purpose. So it can be considered as a corroborative evidence in the field of questioned document examination .14&#xD;
&#xD;
Significance in forensic science &#xD;
Examination of handwriting and graphology has always been of great utility in forensic science not only as a source of physical evidence in criminal investigation but also for evolving new techniques and idea related to the purpose of personal identification if it becomes possible to predict the gender of the writer or forger along with his age so the innocent could be protected and hence it may speed up the investigation process.&#xD;
&#xD;
Future aspects &#xD;
Examination of handwriting for gender identifying feature for gender discrimination may be evolved as a great area for research studies in future. With the growth of new ideas and technologies the methods of examination has been evolved from manual to computerized automatic methods of examination has been evolved from manual to computerized automatic methods involving use of various software which may easily identify the gender identifying features in the handwriting and predict the gender within a minute or seconds.. This will not only reduce the human labor, cost and risk of error but also increase the chances of positive and best outcome in every large population size.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1640</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1640</Fulltext></URLs><References>1. Sharma B.R., Forensic Science in Criminal Investigation and Trials, Universal Law Publishing Co, Pvt. Ltd, 2013, vol. 4, p. 562.&#xD;
&#xD;
2. Saferstein Richard Criminalities &#x2013;Introduction to Forensic Science tenth edition fearson Education.&#xD;
&#xD;
3. Kopoenhaver M. Katherine., forensic Document Examination, Humana Press. 2007.&#xD;
&#xD;
4. Goodenough, F. L., Sex differences in judging the sex of handwriting, Journal of Social Psychology. 1945, vol. 22, Pp; 61&#x2013;68.&#xD;
&#xD;
5. Hamid, S., Loewenthal, K. M., Inferring gender from handwriting in Urdu and English, Journal of Social Psychology. 1996, vol.136, Pp; 778&#x2013;782.&#xD;
&#xD;
6. Hartley, J., Sex differences in handwriting: A comment on Spear, British Educational Research Journal. 1991, vol. 17, Pp; 141 - 145.&#xD;
&#xD;
7. Hayes, W. N., Identifying sex from handwriting. Perceptual and Motor Skills. 1996, vol. 83, Pp; 791 - 800.&#xD;
&#xD;
8. Lester, D., McLaughlin, S., Cohen, R., and Dunn, L., Sex -deviant handwriting, femininity, and homosexuality. Perceptual and Motor Skills. 1977, vol.45, p.1156.&#xD;
&#xD;
9. Wilson, J. D., The role of androgens in male gender role behaviour. Endocrine Reviews. 1999, vol.20, Pp; 726 - 737.&#xD;
&#xD;
10. Huber R. A., Headrick A, M., Handwriting identification: Facts and fundamentals, CrC press LLC. New York. 1999.&#xD;
&#xD;
11. Maciaszek J., Natural variation in measurable features of initials. Problems of Forensic Sciences. 2011, vol. 85, Pp; 25&#x2013;39.&#xD;
&#xD;
12. Matuszewski S., Natural variation in selected constructional features of female signatures. Problems of Forensic Sciences. 2004,vol. 57(23), Pp; 24 - 43.&#xD;
&#xD;
13. Matuszewski S., Maciaszek J., Natural variation in length of signature components. Problems of Forensic Sciences. 2008, vol.74, Pp; 182&#x2013;189.&#xD;
&#xD;
14. Upadhyay S, Singh J. Estimation of Age through Handwriting Characteristics in Female Writers. Indian Journal of Science and Technology. 2017,vol.10(13).&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>Investigations on Eu3+ Doped Zinc Phosphate Glasses for Photonic Applications&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>19</FirstPage><LastPage>24</LastPage><AuthorList><Author>B. Venkata Rao</Author><AuthorLanguage>English</AuthorLanguage><Author> G. Venkata Chalapathi</Author><AuthorLanguage>English</AuthorLanguage><Author> R. Jeevan Kumar</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Zinc phosphate (ZP) glasses doped with different concentrations of europium (Eu3+) doped were prepared, and their luminescence spectra was investigated. Thermal properties were studied by differential thermal analysis (DTA) measurements. The phase composition of the product was verified by X-ray diffraction analysis. Structural properties were studied by FTIR and Raman spectrum. Optical transition properties of Eu3+ in the studied zinc phosphate glasses were evaluated in the framework of Judd - Ofelt theory. The radiative transition rates (AR), fluorescence branching ratios (&#x3B2;), stimulated emission cross-sections (&#x3C3;e) and lifetimes (&#x3C4;exp) for certain transitions or levels were evaluated. Red emission of Eu3+ exhibits mainly by the 5D07F2 transition located at 612 nm. Concentration quenching was observed from fluorescence spectra. It is found to be that the lifetimes of 5D0 level increases with increase in concentration and then decreases. Intense orange-red light emission was obtained for the 2.0 mol% of Eu3+ ions in zinc phosphate glasses. This approach shows significant promise for use in reddish-orange lighting applications which is useful in photonics field.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Zinc Phosphate glass, Eu3+, Judd-Ofelt theory, Concentration quenching, FTIR</Keywords><Fulltext>Introduction&#xD;
In recent years, researcher&#x2019;s motivated on glasses and their optical components especially doped with lanthanide ions. The main interest is to search and develop novel optical devices for use in lasers, sensors, displays and optical amplifiers and fibers [1]. Glasses with rare earth ions are one of the functional optical materials. Glasses are in particularly suitable for rare earth ions due to higher solubility in host glass matrix [2]. Generally, rare earth elements have been widely used to modify the host properties of functional materials due to their unique physiochemical activity. &#xD;
&#xD;
One class of host glass materials for visible and near infrared regions are phosphate glasses. Historically, phosphate glasses have been used as a host for optical applications, because of its excellent character with a wide range of rare earths solubility and high transparency. An important issue of this phosphate glass is low chemical stability and durability [3, 4]. &#xD;
&#xD;
Among rare-earth ions, Eu3+ is a highly active luminescence center because of simple energy level structure, its high luminescence performance as well as being a good for site selective spectroscopy. In amorphous and crystalline materials, luminescence properties of Eu3+ are well investigated in order to study the materials structure and local symmetry through spectroscopic probe. Optical materials based on Eu3+ gives strong red in phosphors and hence phosphor materials are useful for displays, lamps, illumination devices and optoelectronic devices. To get the luminescence improvement of Eu3+ ion, one way is co-doped method. Proper selection of co-doped material will play an important key role in energy transfer process.&#xA0; From energy level analysis, it is observed that the chances for energy transfer and cooperative activation between Eu3+ and Sm3+ ions are more. By co-activating with appropriate concentration of Sm3+ with Eu3+ ion it was reported emission intense red light under UV excitation [5, 6]. &#xD;
&#xD;
Recently, Rajagukguk et al. [7] studied structural and optical characteristics of Eu3+ ions in sodium-lead zinc-lithium-borate glass system and concluded that decay time increases with increasing Eu3+ ion concentration. Ouchouicha et al. [8] prepared Eu3+/Eu2+ co-doped calcium aluminosilicate glass&#x2013;ceramics and observed that during heating of the original glass, part of Eu3+ ions were reduced to Eu2+ ions. Steudel et al. [9] investigated quantum efficiency and energy transfer (ET) processes in rare-earth doped borate glass for solid-state lighting and concluded that for constant Sm3+ concentration and increasing Eu3+ doping, the efficiency increases slightly.&#xD;
&#xD;
The present paper focused on the systematic characterization and analysis of concentration effect of Eu3+ on luminescence and. Thermal, structural and optical aspects of zinc phosphate glasses were done by DTA, XRD, FTIR, Raman, optical absorption, emission and lifetime measurements. To study concentration effect, proper analysis of excitation, emission and energy level analysis are needed and these were recorded for Eu3+ doped ZP glasses. &#xD;
&#xD;
Methodology&#xD;
Different zinc phosphate (ZP) glasses were prepared by using raw materials (99.9%), ammonium phosphate (NH4H2PO4), lithium fluoride (LiF), strontium oxide (SrO), zinc oxide (ZnO) and europium oxide (Eu2O3). The glass compositions details as follows (mol%):&#xD;
&#xD;
&#xD;
	&#xD;
		&#xD;
			&#xD;
			1&#xA0;&#xA0; Eu01&#xD;
			&#xD;
			&#xD;
			59.9NH4H2PO4-10LiF-10SrO-20ZnO-0.1Eu2O3&#xD;
			&#xD;
		&#xD;
		&#xD;
			&#xD;
			2&#xA0;&#xA0; Eu05&#xD;
			&#xD;
			&#xD;
			59.5NH4H2PO4-10LiF-10SrO-20ZnO-0.5Eu2O3&#xD;
			&#xD;
		&#xD;
		&#xD;
			&#xD;
			3&#xA0; &#xA0;Eu10&#xD;
			&#xD;
			&#xD;
			59.0NH4H2PO4-10LiF-10SrO-20ZnO-1.0Eu2O3&#xD;
			&#xD;
		&#xD;
		&#xD;
			&#xD;
			4&#xA0;&#xA0; Eu15&#xD;
			&#xD;
			&#xD;
			58.5NH4H2PO4-10LiF-10SrO-20ZnO-1.5Eu2O3&#xD;
			&#xD;
		&#xD;
		&#xD;
			&#xD;
			5&#xA0;&#xA0; Eu20&#xD;
			&#xD;
			&#xD;
			58.0NH4H2PO4-10LiF-10SrO-20ZnO-2.0Eu2O3&#xD;
			&#xD;
		&#xD;
		&#xD;
			&#xD;
			6&#xA0; &#xA0;Eu30&#xD;
			&#xD;
			&#xD;
			57.0NH4H2PO4-10LiF-10SrO-20ZnO-3.0Eu2O3&#xD;
			&#xD;
		&#xD;
	&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
Precise amounts of the starting materials in mol% were weighed out and grinded in an agate mortar. The mixtures were placed in porcelain crucibles and were then heated in an electric furnace. After heating, the obtained liquid was poured on brass plate and then pressed by another brass plate. The obtained glasses are used for measurements.&#xD;
&#xD;
DTA measurement was performed using a NetZsch STA 409 model with N2 atmosphere. Amorphous nature of prepared glasses was verified by SEIFERT X-RAY diffractrometer. FTIR spectrum was recorded using a series of Perkin Elmer spectrum One FT-IR spectrophotometer. Raman spectrum was recorded JOBIN YVUON spectrometer. The optical absorption spectral recording was done on ELICO SL 218 double beam spectrophotometer. The excitation, photoluminescence spectra and decay curves of Eu3+ doped glass samples were recorded using FLS-980 fluorescence spectrometer with xenon lamp as excitation source.&#xD;
&#xD;
Results&#xD;
Thermal analysis- Differential thermal analysis (DTA)&#xD;
In order to understand and interpret the thermal, crystallization and melting behaviour of glass system, differential thermal analysis (DTA) is important one. Through DTA analysis, phase changes are also observed during thermal heat treatment. The separated various phases like glass transition temperature (Tg) and crystallization temperature (Tc) which are depend on the different constituting oxides such as glass former and modifiers in the glass systems. DTA profile is recorded for host ZP glass matrix and is presented in Fig.1. &#xD;
&#xD;
XRD analysis&#xD;
XRD profile of 2.0 mol% of europium doped zinc phosphate glass is pictured in Fig.2.&#xD;
&#xD;
FTIR spectrum&#xD;
Fig.3 shows FTIR spectrum of 2.0 mol% doped zinc phosphate glass matrix.The bands are observed at 740 cm-1, 910 cm-1, 1075 cm-1 and 1230 cm-1. &#xD;
&#xD;
Raman spectrum&#xD;
&#xA0;Fig.4 shows Raman spectrum of 2.0 mol% doped zinc phosphate glass matrix. The&#xA0; bands are observed between 300-480 cm-1 region and at 773 cm-1. &#xD;
&#xD;
Optical absorption of Eu3+ doped ZP glasses&#xD;
The optical changes of the Eu3+doped ZP glasses were observed through the absorption spectra and these measurements for all glasses were recorded and were shown in Fig. 5 for 2.0 mol% of Eu3+ doped glass matrix. The absorption spectra display seven transitions from the ground levels 7F0 and 7F1. The absorption spectral bands originate from 7F0 and 7F1 levels since these levels (7F0 and 7F1) are being closely located to each other. &#xD;
&#xD;
Excitation and emission spectra of Eu3+ doped ZP glasses&#xD;
The observed excitation and emission spectra of Eu3+-doped ZP glasses were shown in Figs. 6 and 7 respectively. The observed excitation spectral transitions were found to be matched with the absorption transitions. In the excitation spectra, major emission intensity was observed at 393 nm due to 7FO&#x2192;5L7 transition for all Eu3+-doped ZP glasses and using this as excitation source, emission spectra were recorded. Fig. 7 shows Eu3+ doped emission spectra for Eu01, Eu05, Eu10, Eu15, Eu20 and Eu30 glasses under ultraviolet excitation source (at 393 nm). &#xD;
&#xD;
Decay analysis of Eu3+ doped ZP glasses&#xD;
The emission decay time of the 5D0 level (at &#x3BB;exc = 393 nm and at &#x3BB;emi=612 nm) of the different ZP glasses are shown in Fig. 8. The decay curves were fitted to the first order exponential function for all Eu3+ doped ZP glasses. &#xD;
&#xD;
Discussion&#xD;
&#xA0;From Fig.1, an endothermic peak located nearly at 136 OC is observed which is due glass transition temperature (Tg). Two exothermic peaks follow after the glass transition temperature indicating the stage of crystallization (TC) process. TC1 and TC2 are two crystallization events are formed during melting process. These two events are occurred nearly at 196 and 267 OC temperatures, respectively. From Fig. 1, where the higher TC2 and lower Tg are used to measure the thermal stability of the amorphous zinc phosphate glass system. The thermal stability or glass forming ability can be measured by difference of glass transition and crystallization temperatures (&#x394;T = TC2-Tg) [10].&#xA0; In the present work, it is observed that the thermal stability is found to be 131 OC which is high for the zinc phosphate glass system.&#xD;
&#xD;
&#xA0;From this XRD figure 2, it is apparent that no characteristic diffraction peaks, indicating that the prepared glasses are of amorphous in nature. Fig.3 consists of the band at 740 cm-1 is ascribed to the symmetric stretching vibration of P&#x2013;O&#x2013;P rings. The absorption band at 910 cm-1 is related to asymmetric stretching vibration of P&#x2013;O&#x2013;P groups linked with linear metaphosphate chains. The band at 1075 cm-1 is assigned to asymmetric stretching of PO-2 group units. The band at 1230 cm-1 is attributed to the stretching of the doubly bonded oxygen vibration, &#x3BD;as(P = O) modes [11]. &#xD;
&#xD;
Fig.4 shows Raman spectrum consists of the broad band at 773 cm-1 is due to symmetric stretching of (P&#x2013;O&#x2013;P) bridging oxygen bonds in (P2O7)4 units. [12, 13, 14 ]. This peak is a convolution of two peaks i.e. one may due to vibrations of the two joined Q2 units and the second one to those of Q1 units. Presence of last two bands indicates that due to addition of different modifiers into glass matrix, long range order of network become cut down and formed chain like units. This type of structural units increases glass strength. &#xD;
&#xD;
The absorption spectra (Fig.5) display seven transitions from the ground levels 7F0 and 7F1. The absorption spectral bands originate from 7F0 and 7F1 levels since these levels (7F0 and 7F1) are being closely located to each other. However, transitions from the 7F2 level were too weak to be investigated because of the minimum fractional thermal populations at room temperature [14]. The optical bands observed due to the 7F0&#x2192;5D4, 7F0&#x2192;5G4, 7F1&#x2192;5G3, 7F0&#x2192;5L6, 7F1&#x2192;5D3, 7F0&#x2192;5D2 and 7F1&#x2192;5D1 transitions, centered at 362, 376, 382, 393, 415, 465 and 535 m respectively. At room temperature, energy difference between 7F1 and 7F0 level was only ~350 cm-1 and thermally populated about 35% and 65% respectively. Hence, absorption transitions were appeared from both levels [16]. So that, Judd-Ofelt analysis from the absorption spectra is very difficult. Out of these seven bands, the absorption band, 7F0&#x2192;5L6 has more intensity than rest of the absorption bands. This transition was forbidden by the &#x394;S and &#x394;L selection rules, but it is allowed by the &#x394;J selection rule. Furthermore, the intensity of 7F0&#x2192;5D2 (electric dipole) transition has higher than that of 7F0&#x2192;5D1 transition (magnetic dipole). Hence, the 7F0&#x2192;5D2 transition is referred as hypersensitive transition [17,18]. &#xD;
&#xD;
The excitation spectra (at &#x3BB;emi= 611 nm) were composed of 7F1&#x2192;5I5, 7F0&#x2192;5H6, 7F0&#x2192;5H3,7, 7F0&#x2192;5D4,&#xA0; 7FO&#x2192;5L10, 7F0&#x2192;5G2,3,4,5, 7FO&#x2192;5L7, 7F0&#x2192;5L6, 7FO&#x2192;5D3, 7FO&#x2192;5D2, 7FO&#x2192;5D1 and 7F1&#x2192;5D1 transitions with the wavelengths located at 302, 319, 326, 360, 364, 376, 381, 393, 413, 463, 522 and 531 nm respectively (Fig.6). The 7F0&#x2192;5L6 (393 nm) and 7F0&#x2192;5D2 (464 nm) transitions indicate relatively higher intensities than the other transitions [19]. It is observed that the peak at 440 nm is associated to the pure electronic transition (PET) and the peak at 464 nm is associated to the phonon side band (PSB) 7F0&#x2192;5D2 occur at higher energy side. Due to excitation by the incident energy corresponding to the PET with an excess energy of vibrational modes of Eu-O bonds, PSBs were occurring. The phonon energy (?&#x3C9;) can be defined as energy difference between PSB (at 22727 cm&#x2212;1) and PET (at 21555 cm&#x2212;1), it was 1172 cm&#x2212;1 in Eu3+ doped ZP glasses. Thus, PSBs result from inter mixing of vibrational modes to the IR bands in the range 1080-1270 cm-1 &#xA0;related to P-O-P and P=O bands. The electron&#x2013;phonon coupling strength parameter (g) was calculated from the integrated intensity ratios of PSB to PET using the formula given in Ref. [20]. The g parameter gives intensity of interaction between Eu3+ cation and O2- ligand anion. This g parameter was found to be 0.1, 0.4, 0.5, 0.7 and 0.5 for Eu01, Eu05, Eu10, Eu15, Eu20 and Eu30 glass matrices respectively. &#xD;
&#xD;
In the excitation spectra, major emission intensity was observed at 393 nm due to 7FO&#x2192;5L7 transition for all Eu3+-doped ZP glasses and using this as excitation source, emission spectra &#xA0;(Fig.7)were recorded. By using 393 nm excitation, transitions from ground level to 5L7 level take place. The population of the 5L7 level relaxes non-radiatively (NR) to the 5D3 level, and then sequentially to the lower 5D0 level via 5D2 and 5D1 levels. Emissions from the 5D0 level to lower levels takes place radiatively due to higher energy gap between the excited 5D0 and 5F6 level and negligible multiphonon relaxation (MPR) effect. Emission occurs only from 5D0 level and emission from 5D1, 5D2 and 5D3 levels were not observed (From Fig.7) due to higher phonon energy of ZP host glass matrix. In the present work, five emission bands (in the visible region) were noticed i.e. from the excited state 5D0 to lower levels i.e. 5D0&#x2192;7F0 (578 nm, yellow), 5D0&#x2192;7F1 (590 nm, orange), 5D0&#x2192;7F2 (611, red), 5D0&#x2192;7F3 (653 nm, deep red), 5D0&#x2192;7F4 (701 nm, deep red). &#xD;
&#xD;
The emission line associated with 5D0&#x2192;7F2 transition has the highest emission intensity and the emission line associated with 5D0&#x2192;7F0 transition has the lowest in emission intensity. Out of five bands, the 5D0&#x2192;7F2 band was a forced electric dipole (ED) allowed transition and it possesses hypersensitive character due to the admixture of odd-parity character into the 4f6 wave functions. Meanwhile, the 5D0&#x2192;7F1 was magnetic dipole (MD) spin-forbidden transition but it is allowed when Eu3+ ion is in higher symmetric position due to spin&#x2013;orbit interaction. The rest of emission lines 5D0&#x2192;7FJ (J = 0 and 3) were strictly forbidden. The intensity ratio (R: ED/MD) was widely used to manifest the bonding medium and asymmetry around Eu3+ ions. This ratio gives information concern covalent/ionic bonding between the Eu3+ ions and the surrounding oxygen ligands. With increase in europium concentration, R value also increases due to increase in asymmetry and higher degree of covalency between Eu&#x2013;O. Smaller values of R is attributed to higher local symmetry for Eu3+ ions. &#xD;
&#xD;
Increase of Eu3+ content from 0.1 mol% to 2.0 mol% increases the emission intensities, and then decreases drastically when Eu3+ content is 3.0 mol%. As the concentration increased, the Eu3+ ions are crowded closer and closer together. This is owing to strong interactions among the europium ions as well as cross relaxation (CR) process at higher concentrations. These CR was from 5D2 to 5D1 levels and from 5D3 to 5D2 levels and channels like : 5D2+7F1&#x2192;5D1+7F4 and 5D3+7F0&#x2192;5D2+7F4. Among all ZP glasses, 2.0 mol% of Eu3+ doped ZP glass shows the strongest red emission intensity.&#xD;
&#xD;
The limited level of absorption transitions and energy level structure of Eu3+ ion, Judd-Ofelt parameters were unable to determine from absorption spectra. Hence, the J-O intensity parameters (&#x3A9;2 and &#x3A9;4) [21, 22] were calculated for Eu20 ZP glass system from the emission spectra. The 5D0&#x2192;7F2 transition has not been observed in emission spectra and hence &#x3A9;6 parameter was not evaluated. It is observed that the &#x3A9;2 parameter is high (7.11 &#xD7; 10&#x2212;20 cm2) in 2.0 mol% Eu3+-doped ZP glass matrix. This indicates that high asymmetry and covalency connected around the europium ions in the Eu20 glass matrix. The J-O parameters followed with trend like &#x3A9;2&gt;&#x3A9;4 in Eu20 ZP glass. This affirmation is also in consistence with the obtained R/O intensity ratios observed in Eu20 glass matrix. J-O intensity parameters were used to assess the radiative properties and are presented in Table 1 for Eu20 ZP glass matrix. &#xD;
&#xD;
It is observed that among all emission transitions, 5D0&#x2192;7F2 transition shows higher values of radiative transition probabilities (AR) in all the concentrations, and this value is high in 2.0 mol%. &#xA0;The experimental branching&#xA0; ratios (&#x3B2;exp) and stimulated emission cross-sections (&#x3C3;e) for all the emission transitions of Eu3+-doped ZP glass matrices are also calculated. The &#x3B2;exp are obtained from the relative areas under specific transitions. From Table 1, among all emission transitions, 5D0&#x2192;7F2 transition has higher &#x3B2;exp (68%) for 2.0 mol% of Eu3+-doped Eu20 glass matrix. It &#xA0;indicates that the dominant red emission located at 612 nm of Eu3+ might be useful for optical materials. The luminescence performance of the material can be decided from &#x3C3;P values. From table 1, the &#x3C3;P values are higher for 5D0&#x2192;7F2 transition compared to other emission transitions. &#xD;
&#xD;
The obtained lifetimes (Fig.8) were 2.3, 2.3, 2.4, 2.5, 2.6, and 2.7 ms for Eu01, Eu05, Eu10, Eu15, Eu20 and Eu30 glasses respectively. Decay time is observed to be increased with increasing Eu3+ ion concentrations from 0.1 mol% to 2.0 mol % and then decreases. The glass sample with 0.1 mol% shows the shortest luminescence lifetimes and sample with 2.0 mol% shows the longest luminescence lifetimes. &#xD;
&#xD;
Conclusion&#xD;
The authors prepared and characterized Eu3+ doped zinc phosphate glasses for luminescence applications. The thermal stability measured by using DTA technique. In the present work, it is observed that the thermal stability is found to be 131 OC which is high for the zinc phosphate host glass system. The phase composition of the product was verified by X-ray diffraction analysis and found to be amorphous in nature. The structural properties are studied through FTIR and Raman measurements. Optical properties of Eu3+&#xA0;in the studied zinc phosphate glasses were evaluated in the framework of Judd&#x2013;Ofelt theory. Among different ZP glasses, Eu20 has high covalency bond. Red emission of Eu3+ is generated mainly by the 5D0&#x2192;7F2 transition located at 612 nm. Concentration quenching and energy transfer were observed from fluorescence spectra and decay curves, respectively. The 0.1 mol% and 3.0 mol% Eu3+ doped ZP samples have the longest and shortest decay times. With the increase in dopant concentration, decay time values gradually decreased. It was found that the main reason for concentration quenching was non-radiative energy transfer through cross-relaxation mechanism due to dipole&#x2013;dipole interaction. This approach shows significant promise for use in bright orange-red lighting applications. The optimized properties of the Eu3+ doped zinc phosphate glasses are found to be promising luminescent materials.&#xD;
&#xD;
ACKNOWLEDGEMENTS&#xD;
&#xA0;Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed. &#xD;
&#xD;
Source of funding: None &#xD;
&#xD;
Conflicts of interest: None&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1641</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1641</Fulltext></URLs><References>&#xD;
	A.N. Meza-Rocha, G. Mu&#xF1;oz&#xA0; A. Speghini, M. Bettinelli, U. Caldi&#xF1;o, Opt. Mater. 2015, 47 (2015).&#xD;
	D. Chateau, F. Chaput, C. Lopes, M. Lindgren, C. Brannlund, J. O? hgren, N. Djourelov, P. Nedelec, C. Desroches, B. Eliasson, T. Kindahl, F. Lerouge,&#xA0; C. Andraud, S. Parola, Appl. Mater. Interfaces, 2012, 4,2369.&#xD;
	S. Babu, A. Balakrishna, D. Rajesh, Y.C. Ratnakaram, Spectrochimica Acta Part A, 2014, 122, 639.&#xD;
	P. Xiao , J.J. Zhang , L.F. Shen, Z.Q. Wang , E.Y.B. Pun, H. Lin,&#xA0;J. Lumin. 2016, 178,147,.&#xD;
	Xiaofeng Wu, Shigang Hu, Congbing Tan, Yunxin Liu, Opt. Commun. 2014, 328, 23.&#xD;
	Ye Jin, Jiahua Zhang, Weiping Qin, J. Alloys Compd. 2013, 579, 263.&#xD;
	J. Rajagukguk, J. Kaewkhao, M. Djamal, R. Hidayat, Suprijadi, Y. Ruangtaweep, J. Mol. Struct. 2016,1121,180 .&#xD;
	H. Bouchouicha, G. Panczer, D. de Ligny , Y. Guyot, M.L. Baesso, L.H.C. Andrade, S.M. Lima, R. Ternane, J. Lumin. 2016,169,528.&#xD;
	Franziska Steudel, Sebastian Loos, Bernd Ahrens, Stefan Schweizer J. Lumin. 2016, 170, 770.&#xD;
	F.Wu, S. Li, Z. Chang, H. Liu, S. Huang, Y. Yue, J. Mole. Struct. 1118 (2016) 42-47.&#xD;
	C. Ivascu, A. Timar Gabor, O. Cozar, L. Daraban, I. Ardelean, J. Mol. Struct. 2011, 993, 249.&#xD;
	M. Lu, F. Wang, Q. Liao, K. Chen, J. Qin, S. Pan J. Mol. Struct. 2015,1081,187.&#xD;
	Y.C.Ratnakarama, S.Babu, L.KrishnaBharat, C.Nayak J. Lumin. 2016,175,57.&#xD;
	K. Brahmachary, D. Rajesh, Y.C. Ratnakaram, J. Lumin. 2015,161,202.&#xD;
	M. Szumera, I. Wac?awska, J. Su?owska, J. Mol. Struct. 2016,1114,78.&#xD;
	N. Mascaraque, G.Tricot, B. Revel, A. Dur&#xE1;na, F. Mu&#xF1;oz, Solid State Ionics 2014,254, 40.&#xD;
	P.Y. Shih, J.Y. Ding, S.Y. Lee, Mater. Chem. Phys. 2003,80,391.&#xD;
	W.A. Pisarskia, J. Pisarska , G. Dominiak-Dzik , M. Ma?czkac , W. Ryba-Romanowski, J. Phys. Chem. Solids 2016,67, 2452.&#xD;
	U. Caldi&#xF1;o, A. Speghini, S. Berneschi , M. Bettinelli, M. Brenci, S. Pelli, G.C. Righini, Opt. Mater. 2012, 34,1067.&#xD;
	D. Ramachari, L. Rama Moorthy, C.K. Jayasankar, J. Lumin.2013, 143,674.&#xD;
	B.R. Judd, Phys. Rev. 1962,127,750.&#xD;
	G.S. Ofelt, J. Chem. Phys.1962, 37,511.&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>Biomonitoring of Soil Pollution Using Plants on Roadsides of Mysuru&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>25</FirstPage><LastPage>29</LastPage><AuthorList><Author>Prakruthi T. R.</Author><AuthorLanguage>English</AuthorLanguage><Author> N. S. Raju</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Soil pollution assessing capacity using plants with accumulative capacity has been studied. Plant samples were collected from roadsides of traffic and residential sites. The concentration of heavy metals and some physico chemical parameters were analyzed using ICP and standard methods. Correlations were attempted between physicochemical parameters and heavy metals in plants. The heavy metals concentration in soil was in the order Fe&gt;Mn&gt;Zn&gt;Cr&gt;Ni&gt;Cu&gt;Pb&gt;Cd. The uptake of heavy metals by plants depends on the absorption capacity of plants. Calotropis procera showed highest absorption capacity followed by Mangifera indica, Cynodon dactylon, Solanum nigrum and Dalbergia sissoo.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Heavy metals, Biomonitoring, Soil, M. indica, D. sissoo, C. procera, S. nigrum and C. dactylon</Keywords><Fulltext>Introduction&#xD;
The increase in pollution in urban areas is mainly due to traffic and industrial establishments. The extent of pollution can be assessed using plants with accumulative capacity. Plant leaf is the most sensitive part that gets affected by pollutants as major physiological processes of plants are concentrated in the leaf (Renjini and Janardhanan, 1989)1. Environmental monitoring using plants is very realistic and useful since it is not only cost effective but they also further assist man in planning the urban cities. The more success is achieved by using the specific plant as biomonitor. The importance and relevance of biomonitors rather than equipment is justified by the statement &#x201C;There is no better indicator of the status of a species or a system than a species or a system itself. (Tingey and David T, 1989)2. Knowledge about plant uptake and soil levels of pollutants are necessary to interpret the results based on plant leaves. This necessitates the importance of understanding about the level of pollutants in soil. In such situation it is possible to know the capacity of the plants to absorb pollutants. In this study five plant species were selected and used to monitor soil pollution in roadsides of traffic and residential area of Mysore. The plants selected included M. indica, D. sissoo, C. procera, S. nigrum and C. dactylon.&#xD;
&#xD;
M. indica belongs to the family Anacardiaceae. It is the most economic tropical fruit native to the foothills of Himalaya, Bangladesh and Burma. It grows to a height of 30-100ft and bear evergreen leaves with broad, rounded canopy. D. sissoo is also known as North Indian Rosewood and belongs to the family Fabaceae. It is a slow growing tree native to Indian Subcontinent and Southern Iran. It grows to a height of 82ft. C. procera is a large shrub belonging to family Apocynaceae and grows to a height of 3-6 ft. They are native to Western and Southern Asia, Africa and Indochina. S. nigrum is also known as black nightshade and belongs to the family Solanaceae. It is native to Eurasia and widely distributed in Asia, Africa, Europe, Australia and America. It is a short lived perennial shrub and grows to a height of 2-9ft. C. dactylon belongs to the family Poaceae and is native to Middle East. The leaves are grey green in color and can grow up to 2-15cm with rough edges. The stems are erect and can grow up to 1-30cm. &#xD;
&#xD;
Materials and methods&#xD;
Mysuru is the second largest city in Karnataka, India. It has spread across an area of 128.42 sq Km and is located at 12o181N 76o391E 12.30oN 76.65oE. Samples were collected at a distance of 0 to 3 mts from roads having high traffic density and from residential sides of Mysuru. Soil and plant samples of M. indica, D. sissoo, C. procera, S. nigrum and C. dactylon were collected in three different seasons; pre-monsoon, monsoon and post monsoon from roadsides of traffic and residential area of Mysuru. The soil samples were collected from the top 10 cm using stainless steel trowel around the plants which has been sampled. The soil samples collected from traffic area around five plants sampled were mixed together to get a composite soil sample and same has been done in the residential sides. The soil samples were air dried and passed through 2mm sieve and stored in self-sealing plastic bags for further analysis. In each area, leaves were collected from 5-10 plants of each species randomly, then samples of each species were mixed together to get a composite sample of the species and same has been done to all the other plants and packed in muslin bags.&#xA0; They were brought to the laboratory and washed with distilled water to remove adhering dust and extraneous particles. The plant samples were shade dried followed by oven drying at 65-700C for 48 hrs grounded using homogenizer (mixers). After grinding, the samples were mixed thoroughly and dried again at 700 C and passed through 1.5 mm sieve. These samples were stored in screw type plastic bottles for further use. Samples were analyzed for some physico chemical parameters using standard analytical procedures (APHA 2012). The heavy metal concentrations were detected using ICP-OES (Perkin Elmer Optima 8000).&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
Discussion&#xD;
&#xA0;Soil&#xD;
Average pH and EC of soil samples collected from residential and traffic sites were 7.43 and 97.32dS/m, 7.52 and 92.05 dS/m respectively. Soil pH of both places was alkaline. The mean organic carbon concentration was 0.29% and 0.37 % in residential and traffic area respectively. The mean concentrations of some physico chemical parameters and heavy metals in residential and traffic area are given in the Table1 and Table2. Cadmium was absent in residential area soil samples and Boron was below detectable limit in both traffic and residential areas. The source of contamination of soil by heavy metals in roadsides of traffic area may be as a result of industrial activity and traffic density and also heavy metals are naturally present in the soil and are non-degradable (Nriagu 19903, Adeyeye 20054). The heavy metals concentration in soil was in the order Fe&gt;Mn&gt;Zn&gt;Cr&gt;Ni&gt;Cu&gt;Pb&gt;C and higher as compared to plant samples. &#xD;
&#xD;
PlantsPhysico chemical characteristics&#xD;
&#xD;
Among Mysuru Residential area plants C. procera contains maximum pH and minimum was in S. nigrum. C. procera and D. sissoo showed maximum and minimum pH respectively in traffic area plants. EC was maximum in C. procera and minimum in D. sissoo in residential and traffic area. Mean Calcium content ranged from 2.26 mg/kg to 5.79 mg/kg and 2.74 mg/kg to 5.65 mg/kg respectively in residential and traffic area. Magnesium content ranged from 0.35 mg/kg to 0.85 mg/kg in residential and 0.51 mg/kg to 1.03 mg/kg in roadsides of traffic. Calcium and Magnesium were above recommended values (GKVK manual 2010)5 in all tested plants. Maximum absorption of Sodium was by C. procera and M. indica in residential and traffic area respectively and it was minimum in S. nigrum in both the places. Mean value of Potassium was 0.5 mg/kg to 1.31mg/kg and it was within the recommended values (GKVK manual 2010)5 in all tested plants. Phosphate was within recommended value (GKVK manual 2010)5 in all plants except C. procera in both residential and traffic areas. All the selected plants in both places showed high sulphate content i.e., above recommended value (GKVK manual 2010)5. Total Nitrogen content was within the prescribed limit (GKVK manual 2010)5 in the plants of both the places. The mean content of organic carbon was 0.29% to 0.35 % and 029% to 0.35 % in residential and traffic site plants respectively.&#xD;
&#xD;
Heavy metals&#xD;
Chromium is a toxic heavy metal emitted mainly by heavy traffic and also by burning of coal. Chromium content was above recommended values (GKVK manual 2010)5 in all plants. C. procera showed maximum content of chromium and D. sissoo showed minimum content in both areas. Boron was below detectable limit in all plants irrespective of place. Nickel, iron, manganese, zinc, copper and lead were within the limits in both places (Allen 19896, Kabata Pendias and Pendias19927, Kabata Pendias and Pendias19948, Kabata Pendias and Pendias 20019). Nickel mainly is derived from burning of coal. It is essential in minute quantity for the organisms and plays an important role in insulin production. It can be easily absorbed by the plants (Gunesetal 2004)10. Nickel content was minimum in D. sissoo in both the places. C. procera and M. indica showed maximum content in residential and traffic area plants respectively. Iron is one of the essential microelements for plants which are present in the earth crust naturally. But higher concentration of iron is toxic to plants. In both places Iron content was maximum in C. procera and minimum in D. sissoo. Manganese is also one of the essential microelements for plants. It is necessary for plants in all the stages of development and functions (Marschner 1995)11 and turns to toxic if it is present in excess amounts in the environment. M. indica and C. procera showed maximum content of manganese in residential and traffic area respectively. D. sissoo had minimum amount of manganese. Zinc is one of the essential elements for all living organisms which are very important for the biosynthesis of proteins and enzymes. But a high zinc concentration is toxic to plants (Zhao et al 2003)12. The main source of zinc is by human inputs, from smelting activities and sewage sludge. In all plants zinc absorption was within the prescribed limit (Kabata Pendias and Pendias1994)8. C. procera had higher amount of zinc while S. nigrum and D. sissoo had minimum amounts in both residential and traffic area. Copper is one of the essential microelements for plants. The main source of copper in soil is from traffic movement because it is produced by tire and broken shoe abrasion. C. procera showed maximum amount of copper in both places and S. nigrum had minimum amount of copper. Lead is the most toxic element for the living organisms. The main source of lead is vehicular emissions. Maximum amount of lead was observed in C. procera and minimum amount was in D. sissoo and S. nigrum in residential and traffic area. Cadmium is a highly toxic heavy metal to the living organisms. It is not needed by the plants and animals (Celik. A and A. Aslihan 2004)13. Cadmium was completely absent in all the plants of residential area. In traffic area plants it varied from 0.22 mg/kg to 1.15 mg/kg. In C. procera cadmium content was above recommended level (Kabata Pendias and Pendias1994)8 and other plants had within limits.&#xD;
&#xD;
&#xD;
&#xD;
Statistical analysis of Mysore residential area plants showed that pH has highly positive correlation between EC, K, P, N, Ni and Fe while EC showed with Ca, Mg, K, P, Cr, Ni, Fe, Mn, Zn and Pb. Similarly Calcium showed correlations with Mg, P, Cr, Ni, Fe, Mn, Zn, Cu and Pb. Magnesium showed positive correlation with Na, P, Cr, Ni, Fe, Mn, Zn and Cu. Sodium showed positive correlation with Mn, Zn and Cu. Pottasium has correlation with S, N, Cr, Ni and Pb.&#xA0; Phosphate with N, Cr, Ni, Fe, Mn, Zn, Cu and Pb. Sulphur has positive correlation with Pb. Nitrogen with Ni, Cu and Pb. Chromium with Ni, Fe, Mn, Zn and Pb. &#xA0;Nickel has correlation with Fe, Mn, Zn, Cu and Pb.&#xA0; Iron with Mn, Zn, Cu and Pb. Manganese has positive correlation with Zn and Cu. Zinc and Cu also showed highly positive correlations.&#xD;
&#xD;
&#xD;
&#xD;
Statistical analysis of Mysore roadside plants showed that pH has highly positive correlation between EC, Ca, Mg, K, PO4, N, Cr, Ni, Fe, Mn, Zn and Cu while EC showed with Ca, Mg, PO4, N, C, Cr, Ni, Fe, Mn, Zn and Cu. Similarly Calcium showed correlations with PO4, N, C, Cr, Fe, Mn, Zn and Cu. Magnesium showed positive correlation with Na, K, N, Cr, Ni, Fe, Zn and Cu. Potassium has correlation with Ni; Phosphate with N, C, Cr, Fe, Mn, Zn and Cu. Tot Nitrogen with C, Ni, Fe, Mn, Zn, Cu and Pb. Org Carbon with Cr, Mn, Zn, Cu and Pb. Chromium with Ni, Fe, Mn, Zn, Cu and Pb. Nickel has correlation with Fe, Mn, Zn and Cu. Iron with Mn, Zn and Cu.&#xA0; Manganese has positive correlation with Zn, Cu and Pb. Zn with Cu and Pb.&#xA0; Cu and Pb also showed highly positive correlations.&#xD;
&#xD;
Conclusion&#xD;
The study showed that, plants can accumulate heavy metals and macro elements and thus they can be recommended to use as indicators to determine the pollution level in the environment. The main cause for the heavy metals concentration in plants on roadsides of traffic area may possibly due to the traffic density. In the present study C. procera showed highest absorption capacity followed by M. indica, C. dactylon, S. nigrum and D. sissoo. By increasing the number of plant species for testing purpose, it is possible to get better results for the absorption of different heavy metals and other elements by plants. A list of common sensitive plants, for using them routinely for monitoring environmental pollution can be prepared.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
Acknowledgements&#xD;
The author (T. R. Prakruthi) is thankful to DST, Ministry of Science and Technology, Government of India for providing financial assistance under INSPIRE Fellowship.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1642</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1642</Fulltext></URLs><References>&#xD;
	Rejini MBJ, Janardhana K. Effect of heavy metals on seed germination and early seedling growth of groundnut, sunflower and Ginger, Geobios, 16 : 164-170, 1989.&#xD;
	Tingey, David T, Bioindicators in Air Pollution Research -- Applications and Constraints. Biologic Markers of Air-Pollution Stress and Damage in Forests. Washington, DC: National Academies Press, 1989: 73&#x2013;80, 1989.&#xD;
	Nriagu, J.O, Global metal pollution: Poisoning the biopher. Environment Envtar, 32 (9): 7-11, 28-33, 1990.&#xD;
	Adeyeye, E.I., Trace metals in soils and plants from Fadama farms in Ekiti state, Nigeria, Bulletin of chemical Society of Ethiopia 19: 23-24, 2005.&#xD;
	GKVK manual 2010&#xD;
	Allen S.E. Analysis of Ecological materials, 2nd ed. Blackwell scientific publications, oxford 1989.&#xD;
	Kabata &#x2013; Pendias, A. and H. Pendias, Trace elements in soils and plants. Boca Raton, FL: CRC press, pp. 365, 1992.&#xD;
	Kabata &#x2013; Pendias, A and H. Pendias, Trace element in soil and plants, second edition. Boca Raton, Florida. CRC. PP: 365, 1994.&#xD;
	Kabata &#x2013; Pendias, A,;Pendias H., Trace elements in soils and plants. 3rd Ed., Crc Press Inc., Boca Ralon, Florida, USA, 2001.&#xD;
	Gunes A, Alpaslan M, Inal A, Plant Growth and fertilizer. Ankara University. Agriculture Publications No: 1539, Ankara, 2004.&#xD;
	Marschner, H,: Mineral Nutrition of Higher plants. Academic press, London, 1995.&#xD;
	Zhao F J, Lombi E, McGraht S P, Assessing the potential for Zinc and cadmium phytoremediation with the hyperaccumulator Thlaspicaerulescens. Plant soil, 249: 37-43, 2003.&#xD;
	Cleik, A. and A. Aslihan, Determining the heavy metal pollution in Denizli (Turkey) by using Robinia pseudo acacia L. 31 (1): 105-112, 2004.&#xD;
	Alam A and Srivastava S.C. (2009): Marchantia Paleacea Bert &#x2013; As an indicator of heavy metal pollution. Indian journal of Forestry 32 (3). 365-470.&#xD;
	Alloway, b.j, Heavy metal in soils. Halsted press, John Wiley and sons Inc., London, 1996&#xD;
	Bargagli, R., Trace elements in Terrestrial plants. An Ecophysiological Approach to Biomonitoring and Biorecovery. Springer verlag, Berlin, 1998.&#xD;
	Bergman W, &#xA0;Nutritional Disorders of plants. Gustav Fischer, New York, 1992.&#xD;
	Bonnet M, camares O, Veisseire P, Effect of Zinc and influence of Acremoniumlolli on growth parameters, chlorophyll a fluorescence and antioxidant enzyme activity of ryegrass. Exp Bot. 51: 945-953, 2000.&#xD;
	Bowen HJM, Environmental chemistry of the elements. Academic press, New york, PP: 333, 1979.&#xD;
	Chatterjee, J., Chatterjee, F, Phytotoxicity of chromium, cabalt and copper in cauliflour. Environmental pollution 109: 69-74, 2000.&#xD;
	Ducic, T. and Apolle: Transport and detoxification of manganese and copper in plants. Braz J, Plant physiol., 17, 103-112,2005.&#xD;
	Elekes, C.C., Dumitriu, I., Busuioc, G., Iliescu, N.S, The appreciation of mineral element accumulation level in some herbaceous plants species by ICP-AES method. Environmental Science and Pollution Research 17: 1230-1236, 2010.&#xD;
	Ellen, S.E., Chemical analyses of ecological material, 2ndedn. Blackwell scientific, London, P. 367, 1989.&#xD;
	Fleming G and Parle P, Heavy metals in soils, herbage and vegetables from an industrialized area west of Dublin city. Irish Journal of Agricultural research 16, 35-48, 1977.&#xD;
	Lindroos, A.J, J. Derome, H. Raitio and P. Raution: Heavy metal concentration in soil solution, soil and needles in a Norway spruce stand on an acid sulphate forest soil. Water Air Soil Pollution. 180, 155-170, 2007.&#xD;
	M. Miclean, M. Senila, C. Roman. T. Frentie, E. Cordor, Plant uptake factors for 55 elements in a rural mining area, NW Romania, metal elements in Environment, Medicine and Biology, 162-165, 2009.&#xD;
	Madyon p, Murillo JM, Maranon T, Cabrera F, Lopez R, Bioaccumulation of As, Cd, Cu, Fe and Pb in wild grasses affected by the Aznalcollar mine spill (Sw Spain). The Science of the Total Environment 290, 105-120, 2002.&#xD;
	Markert, B, Plant as biomoniotors / Indicators for heavy metals in the terrestrial environment &#x2013; weinbeim VCH. Press: 670. White poplar (Popular alba) as a biomonitor of trace element in contaminated riparian forest. Environ. Pollution, 132: 145-155, 1993.&#xD;
	Markert, B.A, Breure A.M, Zechmeister, H.G, Definitions, strategies and principles for bioindication / biomonitoring of the environment. Elsevier Science Ltd, 2003.&#xD;
	Pilgrim, W. Hugher, R.N, Lead, cadmium, arsenic and Zinc in the ecosystem surrounding a lead smelter. Environmental monitoring and Assessment 32, 1-20, 1994.&#xD;
	Prasad, M.N.V., Freitas, H.M.O, Metal hyperaccumulation in plants &#x2013; Biodiversity prospecting for phytoremediation technology. Electronic Journal of Biotechnology 6 (3): 285-321, 2003.&#xD;
	Ross, S.M, &#xA0;Toxic metals in soil-plant systems John wiley and sons, chichester, 1994.&#xD;
	Sesli, M: A study of lead contamination in tobacco leaves sampled from alongside motor road in the rapidly industrializing city of Manisa, Turkey J. Biological Sci., 4, 768-770, 2004.&#xD;
	Wittig, R, General aspects of biomonitoring heavy metals by plants. In: Plants as Biomonitors / Indicators for Heavy metals in the Terrestrial environment. Markert B., VCH publisher, Weinheim, 3-28, 1993.&#xD;
	Wright D.A, welbroun, P, Environmental Toxicology Cambridge University Press, Cambridge, 2002.&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0; &#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>In silico Characterization of Cellulases from Genus Bacillus&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>30</FirstPage><LastPage>37</LastPage><AuthorList><Author>Yogita Lugani</Author><AuthorLanguage>English</AuthorLanguage><Author> Balwinder Singh Sooch</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background: Cellulases are hydrolytic enzymes which hydrolyze &#x3B2;-1,4-glycosidic linkage in cellulose and these are present in many microorganisms including bacteria, fungi and protozoa. The three types of cellulases involved in complete hydrolysis of cellulose are endoglucanase, exoglucanase and &#x3B2;-glucosidase. Various structural and functional domains are present in cellulases and among all these domains, cellulose binding and catalytic domains are found to be important for the hydrolysis of cellulose. Cellulases have showed promising applications in different industrial sectors like paper and pulp, textile, laundry, bioethanol production, brewing, detergent and waste management. A major focus has been given in the recent past by researchers to understand the functional domains and catalytic mechanism of this enzyme to make their effective use for industrial applications.&#xD;
Material and Methods: The protein sequences of cellulases belonging to different Bacillus sp. were retrieved using Uniprot and then physicochemical properties were analyzed using ProtParam and Protscale. Multiple sequence alignment of retrieved sequences was performed using Clustal W and phylogenetic tree was constructed using Mega 6.0 software. SOPMA and GOR IV tools were used for the prediction of secondary structure. The tertiary structure of enzyme was computed using Raptor X.&#xD;
Results: The molecular weight of cellulases were found to range between 49,263-94,682 Da with hydropathicity ranges between -0.292 to -0.580. The acidic amino acid glutamate was found at the active site and methionone was found at the N-terminal of enzyme. The results have shown that the sequence is highly diversed at N-terminus and C-terminus region between different types of cellulases with conserved sequences in the middle. The phylogenetic tree has showed high similarity amongst retrieved sequences. From the tertiary structure, a great degree of variability in &#x3B1;-helix, extended strand in &#x3B2; ladder, hydrogen bonded turn, bend and coil was observed between different types of cellulases.&#xD;
Conclusion: This study provides insights about the physicochemical properties, hydrohobicity, structure and function of cellulases, which would help to exploit this enzyme at industrial level.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Cellulase, Cellulose, Bacillus sp., Endoglucanase, Exoglucanase, ?-glucosidase</Keywords><Fulltext>INTRODUCTION&#xD;
Cellulases are hydrolytic enzymes which can readily hydrolyze both crystalline and paracrystalline structures of cellulose, the largest component of plant residues enters terrestrial ecosystems. Cellulose is present in various lignocellulosic wastes generated from agricultural and industrial processes like sawdust, citrus peel waste, paper mill sludge, industrial waste, paper pulp and municipal solid waste (Maki et al., 2009). The synergistic action of three types of cellulases i.e. endoglucanases (EC 3.2.1.4), exoglucanases (EC 3.2.1.74) and &#x3B2;-glucosidase (EC 3.2.1.21) have been involved for the complete hydrolysis of cellulose (Lugani et al., 2015). Cellulases are industrially important enzymes and are involved in the conversion of lignocellulosic residues for the production of single cell protein, ethanol, bleaching of pulp, fruit juice extraction and for the treatment of waste papers (Shankar and Isaiarasu, 2011). Cellulases are produced by all the microorganisms but mainly by bacteria, actinomycetes and fungi. Among all the microorganisms, members of bacteria have gained intense importance for commercial production of cellulases due to their high growth, wide genetic variability, adaptability and high amendability to genetic manipulations (Patagundi et al., 2014; Lynd et al., 2002). The structure of cellulase composed of carbohydrate binding domain (CBD) at C-terminal which is joined by a short poly- linker region to the N-terminal of catalytic domain. There is presence of two acidic amino acids at the active site of enzyme which catalyze the reaction by acid-base catalysis either through inversion or retention of the configuration of anomeric carbon (Maki et al., 2009). The current focus of most of the researchers has been towards the large scale production of this industrially important enzyme to meet the industrial needs by utilizing various novel bacterial strains. However, a great degree of variability have been observed between different bacterial strains like molecular weight, stability, amino acid composition, family and domain to which they belong, secondary and tertiary structure. Bioinformatics is an interdisciplinary field which is currently used for structural and functional analysis of proteins using various computations tools and databases (Prashant et al., 2010). The information which has been retrieved from available tools and databases about the protein might be useful for the selection of highly efficient bacterial strain for industrial production of enzyme. Moreover, this information may also be helpful for developing new microbial strains with enhanced enzyme production ability by adapting recombinant DNA technology. Keeping in view the above facts about industrial importance of cellulases and use of bioinformatics as an emerging field of molecular biology, the present study was aimed to utilize in silico tools for the characterization of cellulase enzymes from different Bacillus species for their physicochemical characteristics, ancestral relationship and structure determination at various levels.&#xD;
&#xD;
MATERIAL AND METHODS&#xD;
Sequence retrieval and alignment&#xD;
The cellulase protein sequences from different species of Bacillus were retrieved from Uniprot (Universal Protein Resource). The retrieved sequences from Bacillus sp. were Bacillus subtilis, Accession number: P10475; Bacillus akibai,Accession number: P06564; Bacillus thuringiensis, Accession number: M1QQC9; Bacillus pumilus, Accession number: B2ZHC9; Paenibacillus polymyxa, Accession number: E3EEC5; Paenibacillus macerans, Accession number: A0A090Y895. Clustal Omega (version 1.2.4) algorithm was used for the alignment of retrieved protein sequences through multiple sequence alignment.&#xD;
&#xD;
Physicochemical characterization&#xD;
&#xA0;ProtParam tool was used to compute different physicochemical properties of retrieving sequences of cellulases like amino acid composition, aliphatic index (AI), pI, instability index (II), &#xA0;number of positive and negative charged residues, grand average of hydropathicity (GRAVY) and extinction coefficient (Kumar et al., 2012). The isoelectric point (pI) is determined based on the pK value of protein during protein migration under denaturation conditions (Bjellqvust et al., 1993). The concentration of purified protein in the sample is evaluated from the value of extinction coefficient (Umang et al., 2012). The stability of protein is calculated from its instability index (II) and the proteins are predicted as stable when their instability index is smaller than 40; however when the value of instability index is greater than 40, the protein is regarded as unstable (Guruprasad et al., 1990). The volume occupied by aliphatic amino acids side chain (alanine, valine, leucine and isoleucine) relative to total volume occupied is called aliphatic index and it determines the thermostability of a globular protein (Walker, 2005).The hydrophilicity or hydrophobicity of protein is determined by grand average of hydropathicity (GRAVY), which is the ratio of sum of hydropathy values of all the amino acids to total number of residues in the sequence (Umang et al., 2012). The hydropathy plots based on Kyte and Doolittle scale for all the retrieved sequences of cellulases were predicted using Protscale tool (Kumar et al., 2012; http://www.expasy.org/tools/).&#xD;
&#xD;
Phylogenetic analysis&#xD;
The ancestral relationship between retrieved protein sequences of cellulase for different species of Bacillus was estimated by constructing the phylogenetic tree using Mega 6.0 software (Gouripur et al., 2016). Neighbor joining (NJ) algorithm was used for distance tree building and bootstrap value was set at 1000. The bootstrap value denotes to generation of new data sets with replacements.&#xD;
&#xD;
Secondary structure prediction&#xD;
Self optimized prediction method with alignment (SOPMA) and GOR IV tools were used for the analysis of secondary structure and results obtained from these tools were also compared to determine &#x3B1;- helix, &#x3B2;- sheet, turns and loops (Geourjon and Deleage, 1994; http://npsa-pbil.ibcp.fr/cgi-).&#xD;
&#xD;
Tertiary structure prediction&#xD;
&#xA0;The tertiary structure of proteins were constructed by using RaptorX structure prediction server, which provides high quality structural model by using the template of primary protein sequence (http://raptorx.uchicago.edu/StructurePrediction/predict/). &#xD;
&#xD;
RESULTS&#xD;
Sequence retrieval and alignment&#xD;
&#xA0;The protein sequences of cellulase enzymes belonging to different strains of Bacillus sp. were retrieved from Uniprot and these sequences were then characterized using Uniprot tool (Table 1). It has been analyzed from data that the molecular weight of enzyme lies between 54,681 to 94,682 Da and they belong to endoglucanase, &#x3B2;-glucosidase and exoglucanase, respectively. Different types of cellulases shows different catalytic mechanism due to variation in multienzyme complex formation.&#xD;
Thereafter,clustal omega software was used for multiple sequence alignment of these proteins (Fig.1). The cellulase sequences from species of Bacillus were found to be highly diverged at the N-terminal and C-terminal, respectively. However, conserved amino acid sequences with good similarity were found in the middle. The positions with absolute conservation are indicated with asterlink (*), whereas dots (.) represent the position of relative conservation.&#xD;
&#xD;
Physicochemical characterization&#xD;
The results of physicochemical properties like pI, number of positive and negative amino acids, extinction coefficient, instability index, aliphatic index, grand average of hydropathicity and total number of atoms for cellulase from different different species of Bacillu sare shown in Table 2. The isolectric point (pI) is the pH value at which mobility of protein becomes zero with more compact and stable conformation. The pI value of cellulase from Bacillus subtilis is more than 7, which means it contains more number of negatively charged amino acids. Whereas, for all the other species of Bacillus, the pI was found to be less than 7 and their cellulases were acidic in nature containing more number of positive charge residues. Expasy&#x2019;s Prot Param can compute the extinction coefficient for a range of 276, 278, 279, 280 and 282, however 280 nm is more preferred because proteins absorb this wavelength more strongly with minimum interference from other substances. Cellulases from all the selected Bacillus sp. were found to be stable with instability index less than 40. The GRAVY value is negative for all the cellulase sequences and this has showed better possibilities of aqueous interactions. The total number of atoms in different cellulases ranging from 7717 to 13113.The comparison of amino acid composition (%) in different cellulase sequences was also carried out (Table 3) and different amino acids were found to be dominant in different sequences. Protscale tool was used for the construction of Kyte and Doolittle hydropathy plots (Fig.2) and transmembrane region of cellulase from different Bacillus sp. was found to be rich in hydrophobic amino acids as many points lie above the zero baseline. The minimum and maximum hydrophobic position and score for each cellulase sequence was also predicted (Table 4) with minimum and maximum score of -3.100 and3.489, respectively.???????&#xD;
&#xD;
Phylogenetic analysis&#xD;
Mega 6.0 software, which provides a subset of substitution model and neighbor joining algorithm for distance tree building, was used for the construction of phylogenetic tree (Fig. 3). Cellulases from Bacillus subtilis P10475, Bacillus pumilus B2ZHC9, Paenibacillus polymyxa E3EEC5, Paenibacillus macerans A0A090Y895 were found to be closely related compared to Bacillus akibai P06564 and Bacillus thuringiensis M1QQC9, which were diverged from many species of Bacillus.&#xD;
&#xD;
Secondary structure prediction&#xD;
The secondary structure of different cellulase sequences was estimated using GOR IV and SOPMA tools, the percentage of &#x3B1;-helix, extended strand and random coils incellulase from different Bacillus sp. are shown in Table 5. The presence of amino acid in the helix, strand or coil is depicted from the secondary structure (Ojeiru et al., 2010) and secondary structure of cellulase was depicted by SOPMA (Pradeep et al., 2012). From the results, it has been observed that alpha helix was dominant in Bacillus pumilus B2ZHC9 (46.52%), whereas extended strand and random coil was observed to be dominant in Bacillus subtilis P10475 (26.45%) and Paenibacillus polymyxa E3EEC5 (44.91%), respectively. &#xD;
&#xD;
Tertiary structure prediction&#xD;
The tertiary structures of different cellulase sequences were analyzed using RaptorX structure prediction server, which results in modelling of a protein in a step wise manner like template threading, alignment quality assessment and multiple template threading. Different sequences of cellulases showed variability in &#x3B1;-helix, extended strand in &#x3B2; ladder, hydrogen bonded turn, bend and coil (Fig. 4). &#xA0;A high degree of variation was found in the geometric shape and interaction between side chains of amino acids, which lead to differences in their functions.???????&#xD;
&#xD;
DISCUSSION&#xD;
The present study showed the industrial importance of cellulases in different sectors such as textile, laundry, bioethanol production, brewing, detergent, waste management, paper and pulp. There are different types of cellulases with different catalytic subunits which are involved in complete hydrolysis of cellulose. In silico studies are very promising tools in the current era for the characterization of industrially important enzymes for various properties for their selection for appropriate industrial application. The different types of cellulases from Bacillus sp. were studied for comparing their physicochemical characteristics, ancestral relationship and structure prediction at different levels. Various computational tools were used for the characterization of cellulases from different Bacillus sp. A great degree of diversity has been observed in molecular weight, family, domain, number of amino acids, positive and negative charged residues, secondary and tertiary structure between the different forms of cellulases. The phylogenetic analysis also showed the ancestral divergence of difference types of cellulases. This study will be helpful for the selection of industrially important bacterial strain with desirable characteristics for particular industrial processes. Moreover, this information can also be useful for designing new microbial strains by applying proteomics, system biology and microarray based strategies. Further, wet lab studies with reduced labour are required to design novel cellulase producing bacterial strains by using in silico data output.&#xD;
&#xD;
CONCLUSIONS&#xD;
The present study concludes that cellulases are industrially important enzymes due to their ability to utilize agricultural wastes for the production of industrially important products. In recent years, various researchers have adapted genetic engineering approach to develop novel microbial strains with enhanced enzyme producing ability. However, such processes are very tedious and time consuming, which is the major obstacle for adapting such processes for commercial enzyme production. Such limitations can be overcome by initial screening through in silico studies to understand the structure, function and physicochemical properties of the enzyme. These computational studies would be promising tool to design enzymes with desirable characteristics for exploiting them at industrial level.&#xD;
&#xD;
Conflict of interest: There is no conflict of interest between the authors regarding the publication of this article.&#xD;
&#xD;
Acknowledgements: The authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this paper. The authors are grateful to al authors/ editors/ publishers of all those articles, papers, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1643</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1643</Fulltext></URLs><References>&#xD;
	Bjellqvust B, Hughes GJ, Pasquali C, Paquet N, Ravier F, Sanchez JC, Frutiger S, Hochstrasser D. The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences. Electrophoresis 1993; 14(1):1023-1031.&#xD;
	Geourjon C, Deleage G. 1994. SOPM: a self optimized method for protein secondary structure prediction. Protein Engineering 1994; 7(2):157-164.&#xD;
	Gouripur GC, Kaliwa RB, B.B. Kaliwal BB. In silico characterization of beta-galactosidase using computational tools. Journal of Bioinformatics and Sequence Analysis 2016; 8(1):1-11.&#xD;
	Guruprasad K, Reddy B, Pandit MW. Correlation between stability of a protein and its dipeptide composition: a novel approach for predicting in vivo stability of a protein from its primary sequence. Protein Engineering 1990; 4(2):155-164.&#xD;
	Protein secondary structure prediction &#xA0;http://npsa-pbil.ibcp.fr/cgi- [Accessed on 15/03/2017].&#xD;
	Protein tertiary structure prediction,&#xA0;http:// raptorx.uchicago.edu/ StructurePrediction/predict/ [Accessed on 12/03/2017].&#xD;
	Physicochemical characterization of proteins &#xA0;http://www.expasy.org/tools/ [Accessed on 19/03/2017].&#xD;
	Kumar NV, Rani ME, Gunaseeli R, Kannan ND, Sridhar J. Modeling and structural analysis of cellulases using Clostridium thermocellum as template. Bioinformation. 2012; 8(22):1105-1110.&#xD;
	Lugani Y, Singla R, Sooch BS. Optimization of cellulase from newly isolated Bacillus sp. Y3. Journal of Bioprocessing and Biotechniques 2015; 5(11):1-6.&#xD;
	Lynd LR, Weimer PJ, Zyl, WH, Pretorius IS. Microbial cellulase utilization: fundamentals and biotechnology. Microbiology and Molecular Biology Reviews 2002; 66(3):506-577.&#xD;
	Maki M, Leung KT, Qin, W. The prospects of cellulase producing bacteria for the bioconversion of lignocellulosic biomass. International Journal of Biological Sciences 2009; 5(5):500-516.&#xD;
	Ojeiru FE, Kazuya T, Yuki H, Mohammed SM, Shunsuke M. Circular dichroism studies on C-terminal zinc finger domain of transcription factor GATA-2. Yonago Acta medica 2010; 53:25-28.&#xD;
	Patagundi BI, Shivasharan CT, Kaliwal BB. Isolation and characterization of cellulase producing bacteria from soil. International Journal of Current Microbiology and Applied Sciences 2014; 3(5):59-69.&#xD;
	Pradeep NV, Anupama, Vidyashree KG, Lakshmi P. In silico characterization of industrial important cellulases using computational tools. Advances in Life Science and Technology 2012; 4:8-14. &#xD;
	Prashant VT, Uddhav SC, Madura SM, Vishal PD, Renuka RK. Secondary structure prediction and phylogenetic analysis of salt tolerant proteins. Global Journal of Molecular Sciences 2010; 5(1):30-36.&#xD;
	Shankar T, Isaiarasu L. Cellulase production by Bacillus pumilus EWBCM1 under varying cultural conditions. Middle East Journal of Scientific Research 2011; 8(1):40-45.&#xD;
	Umang M, Astha J, Aastha C, Neha A, Vibha R. Computational structural and functional characterization of protein family: Key for the hidden mystry. Journal of Pharmacy Research 2012; 5(7):3643-3649.&#xD;
	Walker JM. The Proteomics Protocols Handbook: Humana Press, 2005, Chap. 52.&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>General Sciences</ArticleType><ArticleTitle>Characterization of Insoluble Organophosphate Degrading Bacteria Isolated from the Root of Citrus Plant&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>38</FirstPage><LastPage>44</LastPage><AuthorList><Author>Sangita Saha</Author><AuthorLanguage>English</AuthorLanguage><Author> Tanusri Mandal</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Aim: To degrade the water insoluble toxic and non-toxic organophosphate compounds into non-toxic water soluble compounds. Plants consume water soluble components from the soil as nutrients. Methods: Dilution plate technique with modified Pikovskaya media has been used to isolate the organophosphate degrading bacteria. Three different water insoluble toxic organophosphate insecticides such as chlorpyrifos, methyl-parathion, phorate and two different water insoluble non-toxic organophosphate compounds present in soil such as calcium phytate, lecithin have been used for this study. Organophosphate solubilizing efficiency test, biochemical characterization, antibiotic test, 16S rDNA sequencing, phylogenetic analysis, LC-MS analysis and biofertilization test have been performed. Results: A potent organophosphate degrading bacteria has been identified as Enterobacter aerogenes strain STLR-I on the basis of NCBI database. The accession number provided by GenBank is KX352268. We have named the bacteria as RZ311 can degrade calcium phytate, chlorpyrifos, methyl-parathion and phorate but it cannot degrade soy-lecithin. Biochemical test and antibiotic test have been shown in the table. The LC-MS data shows the biodegradable compounds present in the media are ammonium polyphosphate, ammonium phosphate, P2 O5 and hypophosphite ion, malic acid, acetic acid, phosphoric acid, gluconic acid etc. The significant vigor index with higher germination percentage of Cicer arietinum seeds have been found for all types of treated inoculum. Discussion: It has been identified as a potent organophosphate biodegrader and bioremidiater with significant biofertilization activity. Conclusion: RZ311, can be used to degrade insoluble toxic and non-toxic organophosphate compounds from environment. The degraded compounds are consumed by the plants for growth&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Organophosphate, Biodegradation, Enterobacter, Biofertilizer, LC-MS</Keywords><Fulltext>Introduction&#xD;
Phosphorus is an essential macro-nutrient for the growth of plant. It has important role in various metabolic processes, such as photosynthesis, respiration, energy transfer, signal transduction process, fixation of nitrogen in nodules and others 1-3. Both inorganic and organic forms of phosphorus are present in the soil. It has been reported that 20-80% of organic phosphorus is water insoluble and plant cannot consume this one4. It has also been reported that plant-root can only absorb 0.1% of total phosphorus contained in the soil5. Hence, phosphorus deficiency has been supplemented with synthetic chemical fertilizers for green revolution. Along with synthetic phosphate fertilizer, other organophosphates, such as pesticides, insecticides, and acaricides are used for protection of crops. Such organophosphate compounds are toxic in nature. These toxic compounds damage the soil quality, plant growth rate and microbial biodiversity6-8. According to the report, crop-yield is reduced by 45% due to the excessive application of pesticides9.&#xD;
&#xD;
The isolated bacterium, RZ311, has been applied to degrade five different types of organophosphate insecticide compounds. Among the five compounds, three compounds are toxic and two are non-toxic compounds. The soil contains two non-toxic organic phosphate compounds such as calcium phytate and lecithin. Three toxic organo-phosphorus insecticides are generally used in the agricultural field. Thus, in our experimental studies, five different water insoluble organic compounds, such as calcium phytate [calcium salt of inositol hexaphosphoric acid], soy-lecithin [2-(nonanoyloxy)-3-(octadeca-9,12-dienoyloxy)propyl&#xA0;2-(trimethylammonio) ethylphosphonate], methyl-parathion [O, O-dimethyl-O-p-nitrophenylphosphoro-thioate], chlorpyrifos [o,o-diethyl o-(3,5,6-trichloro-2-pyridinyl) phosphorothioate] and phorate [O, O &#x2013; (diethylthio) methylphosphoradiothioate] are used. Among them chlorpyrifos, methyl-parathion and phorate are applied as pesticides or insecticides. They are neurotoxins and contaminate environment due to the regular fashion of application. Again calcium phytate acts as anti-nutritional factor due to its chelation effects with most of the metals10. Global ecology is disturbed with the effect of mineral deficiency and its inhibition of major enzymatic activity 10. &#xD;
&#xD;
In this investigation, the primary objective is to isolate a potentially environment friendly &#x201C;microphos&#x201D; from rhizospheric region of the root of citrus plants. As micro-organisms is one of the cost-effective means for biodegradation of insoluble organophosphate into its soluble form, it is a sustainable approach for plant&#x2019;s phosphorus supply.&#xD;
&#xD;
Materials and Methods&#xD;
All the experiments have conducted with sterile double distilled water. All the chemical reagents, which are products of the companies: HIMEDIA/MERCK, India, have been used.&#xD;
&#xD;
Collection of sample&#xD;
The sample of citrus plant-root has been collected from Debra, West Midnapore, having latitude of 22.3690&#xB0; N and longitude of 7.5544&#xB0; E.&#xD;
&#xD;
Isolation of organic phosphate solubilizing bacteria&#xD;
&#xD;
One gram of rhizopheric soil sample of citrus plant has been dissolved in 100 ml of sterilized double distilled water. It is serially diluted from 10-1 to 10-10 times. 100 &#xB5;l of such sample from each of one then has been spread on the petri-plate containing modified Pikovskaya media 11-12. The composition of modified Pikovskaya media is same with the authentic one except calcium tri phosphate. Here, calcium phytate has been used instead of calcium tri-phosphate. Ten different isolates having clear zone surrounding single colonies have been isolated and inoculated in Luria Bertani (LB) broth. Broths have been incubated at 350 C for 3 days for bacterial growth.&#xA0; These bacterial cultures have been further tested for degradation of soy-lecithin, chlorpyrifos, methyl-parathion and phorate. Finally the most potent strain has been selected on the basis of five different water insoluble organic phosphate solubilization activity. &#xD;
&#xD;
Organic phosphate solubilizing efficiency test&#xD;
&#xD;
The marked bacterial culture has been spot plated on five different petri-plates containing modified Pikovskaya media with five different organic compounds. Here, calcium tri phosphate has been replaced from modified Pikovskaya media by any one of these five organic compounds separately. The five plates have been incubated at 350 C for 4 days. The clear zone, from each of the five plates, has been noted for its efficiency test. Insoluble phosphate solubilization efficiency has been calculated using the following formula13-15:&#xD;
&#xD;
Solubilization Efficiency = (solubilization diameter/ growth diameter) X 100&#xD;
&#xD;
Biochemical characterization&#xD;
The supernatant or the whole cell bacterial culture has been used for its biochemical characterization according to the Bergey&#x2019;s Manual of Determinative Bacteriology 16 except HCN and siderophore test.&#xD;
&#xD;
Siderophore and HCN test&#xD;
The seventy-two hours&#x2019; bacterial culture has been grown in King&#x2019;s B broth 17 and it has been used for siderophore and HCN test. The protocol of Reeves et al. has been followed for siderophore test and dihydroxy benzoic acid has been used for standard curve18. HCN test for the isolate has been conducted according to the Reddy et al.19.&#xD;
&#xD;
Antibiotic test&#xD;
100 &#xB5;l of bacterial culture has been spread on plate containing Nutrient agar media and 20 types of Icosa G-I plus antibiotic disc made by HIMEDIA Pvt. Ltd., Mumbai in sterile condition. All the plates have been incubated at 350 C for overnight.&#xD;
&#xD;
Genomic DNA isolation and 16S rDNA amplification&#xD;
Bacterial genomic DNA has been isolated according to the Murray et al. 20 and it has been dissolved in 50 &#xB5;l TAE buffer. Here lysozyme is not used as the bacterial culture which is Gram negative in nature. This isolated DNA has been further used for polymerase chain reaction (PCR). The composition of master mix for PCR reaction has been used as 10X 2.5 &#xB5;l of Taq polymerase buffer, 1 U Taq polymerase enzyme produced by Bangalore Genei, 2 mM of MgCl2, 200 mM of each of deoxynucleoside tri-phosphate, 50 mM of Tris-HCl, 50 ng of genomic DNA, 0.4 &#xB5;M of each of forward (27F: 5&amp;#39;- AGAGTTTGATCCTGGTCAGAACGCT - 3&amp;#39;) and reverse (1492R: 5&amp;#39;- TACGGCTACCTTGTTA CGACTTCACCCC-3&amp;#39;) universal 16S rDNA primers. Here Mastercycler personal-22331 of Eppendrof AG, Germany has been used with standard thermal cycling conditions for amplification. The final PCR product has been assayed through 1% agarose gel electrophoresis.&#xD;
&#xD;
16S rDNA Sequencing and BLAST analysis&#xD;
Standard Sanger dideoxy method has been followed for 16S rDNA sequencing process. The final sequence has been further used for nucleotide BLAST2.3.1+ program and the top most hits have been selected from the result.&#xD;
&#xD;
Submission in NCBI Database&#xD;
The newly identified 16S rDNA sequence has been submitted to GenBank under NCBI database (http://www.ncbi.nlm.nih.gov). &#xD;
&#xD;
Phylogenetic Tree Analysis&#xD;
With maximum identity value from different genus have been selected from NBLAST result and has been further used for phylogenetic tree analysis. In this case, MEGA 6.0 program has been used with 26 sequences (collected from BLAST result) having maximum identities with newly identified one. CLUSTALW 1.6 has been used for multiple sequence alignment in MEGA 6.0. Finally best model has been selected for construction of phylogenetic tree.&#xD;
&#xD;
LC-MS (Liquid Chromatography Mass Spectometry) Analysis&#xD;
6th day&#x2019;s bacterial culture broth of four different kinds of customized Pikovskaya media (mentioned earlier) containing (1) chlorpyrifos (2) methyl-parathion (3) phorate (4) calcium-phytate as a sole source of phosphate have been used for LC-MS analysis.&#xA0; The centrifuged and purified supernatant has been applied for degradation pattern analysis of the organic compounds. Two different types of the columns have been used for LC-MS analysis of the samples. ODS-3 column has been selected for phorate, chlorpyrifos and calcium-phytate containing samples. Intersil C18 column has been utilized for methyl-parathion containing sample. The other conditions have been applied according to the M. K. Harishankar et. al., Jianhua Hao et. al., N. Bano et. al. and Ghorbani-Nasrabadi et. al. for chlorpyrifos, methyl parathion, phorate and calcium phytate respectively21-24.&#xD;
&#xD;
Bio-fertilization test&#xD;
Bio-fertilization activity of the strain has been studied from three different types of experimental conditions. In the first set, surface sterilized Cicer arietinum seeds have been inoculated in seven days&#x2019; treated sterilized soil. In the second set, treated seeds have been inoculated in organic phosphate containing treated soil. In the third set, treated seeds have been inoculated into organic phosphate and bacteria containing soil. On the 2nd day, number of seeds germinated has been noted and on the 14th day root-shoot development and other parameters have been noted accordingly.&#xD;
&#xD;
Results&#xD;
Each of the experiments has been conducted thrice and their average value is considered for experimental analysis. The name of isolated bacterial strain is RZ311. &#xD;
&#xD;
Organic phosphate (OP) solubilization efficiency test result&#xD;
Total ten isolates have been identified from Pikovskaya media with calcium phytate containing plate. Out of the ten, only one bacterial strain RZ311 can solubilize five different insoluble organic phosphate compounds. Organic Phosphate solubilization efficiency has been enlisted in Table 1.&#xD;
&#xD;
Biochemical characterization&#xD;
The different biochemical tests of RZ311 have been performed to study its characteristics. The test results related to gram staining, reaction of citrate, methyl-red, voges-proskaur and oxidase, utilization of catalase, starch hydrolysis, reduction of nitrate and HCN, urease activity, ammonia test and production of indole acetic acid have been shown in Table 2.&#xD;
&#xD;
Siderophore test result&#xD;
511.6 ppm of siderophore production with respect to the standard curve has been recorded for this new strain. &#xD;
&#xD;
Antibiotic test report&#xD;
The clear zone surrounding each of the 15 antibiotic discs have been shown either the zone of susceptibility or the intermediate on the basis of zone diameter record. On the other hand, 5 (Clindamycin 2, Teicoplanin 10, Vancomycin 30, Linezolid 30 and Erythromycin 15) antibiotic discs have not shown any zone surrounding the antibiotic disc. Clarithromycin 15, Oxacillin 1, Ampicilin 30 and Methicillin 5 are fallen under resistant zone. Azithromycin 15 is fallen under intermediate zone. Gentamicin 10, Ampicillin 10, Amikacin 30, Novobiocin 5, Tetracycline 30, Cephalothin 30, Ofloxacin 5, Co-Trimoxazole 25, Chloramphenicol 30 and Penicillin 10 are under susceptibility zone. Table 3 shows the detailed results.&#xD;
&#xD;
Nucleotide BLAST results&#xD;
From the analysis, it has been found that RZ311 is 99% identical with Enterobacter aerogenes strain KCTC with maximum score of 1459. The E-value of it is found to be 0.0.&#xD;
&#xD;
NCBI database and Phylogenetic tree analysis&#xD;
&#xD;
GenBank has assigned 16S rDNA partial sequence in its database on 22nd June, 2016. The GenBank has provided accession number of KX352268 for RZ311. It has been named as Enterobacter aerogenes strain STLR-I. In the model analysis section, it has been found that &#x201C;JC+I&#x201D; can be considered as the best model for construction of phylogenetic tree. Figure 1. shows the phylogenetic relationship among different species from different genus. &#xD;
&#xD;
LC-MS analysis result&#xD;
Total Ionization Chromatogram (TIC) of LC-MS results of four different samples containing (1) calcium phytate (IP6) (2) methyl-parathion, (3) chlorpyrifos, (4) phorate have been shown in the Figure 2, Figure 3, Figure 4 and Figure 5 respectively. The different peaks of each of four samples has been mentioned in the Figures 2, 3, 4 and 5. &#xD;
&#xD;
Biofertilization activity&#xD;
&#xA0;Figures 6 and 7 show the vigor index and germination index of Cicer arietinum seeds&#x2019; activities in different inoculants. From the in-vitro test of seed germination and their plant-let growth, it has been found that CAP RZ311, CH RZ311, CAP C, PH RZ311, PA RZ311, PH C, Control, PA C and CH C are the types of inoculant in treated soil. &#xD;
&#xD;
Discussion&#xD;
It is evident from the water insoluble organophosphate solubilization test that the rhizobacterial strain, RZ311, is a very potent calcium phytate, chlorpyrifos, methyl-parathion and phorate biodegreder. Again, 585.37% of solubilization index manifest about its higher rate of phytase activity for degradation of calcium phytate. But it has negative lecithinase activity as it is just unable to degrade soy-lecithin.&#xD;
&#xD;
Biochemical characterization of RZ311 manifest that it is able to secrete enzymes, such as urease, amylase, oxidase and catalase. Such properties help this specific strain to survive under adverse conditions and also can be used as a potent bioremidieter because it can convert urea into ammonia and CO2, starch into maltose, may transport electron to cytochrome C.&#xA0; RZ311 may also have anti-fungal activity due to the presence of positive siderophore reaction. It can form iron-siderophore complex to form a boundary surrounding it and utilizes as per its requirement in iron limiting condition. Again, RZ311 has plant growth promoting rhizobacterial activity due to its positive result of siderophore. &#xD;
&#xD;
RZ311 is highly sensitive to Clarithromycin, Gentamicin, Oxacillin, Ampicillin, Amikacin, Novobiocin, Tetracycline, Cephalothin, Ofloxacin, Co-Trimoxazole, Chloramphenicol, Methicillin, Penicillin, and Azithromycin, that is, RZ311 is unable to survive in presence of these antibiotics. Hence, RZ311 is safe to handle.&#xD;
&#xD;
Phylogenetic analysis has been shown 0.1% divergence among the studied bacterial species. RZ311 or Enterobacter aerogenes strain STLR-I is closely related to Enterobacter aerogenes strain NCTC 10006. &#xD;
&#xD;
The LC-MS analysis shows that RZ311 is able to degrade completely calcium phytate, chlorpyrifos, methyl-parathion and phorate. Hence the bacterial degraded of four water insoluble organophosphate compounds have been used for LC-MS study. The bio-degraded products contain ammonium phosphate, ammonium polyphosphate, phosphoric acid, P2O5 etc. The final bi-products are water soluble, non-toxic compounds that can be easily consumed by the plants and other micro-organisms. RZ311 strain completely degrades chlorpyrifos into pyruvic acid through TCP (3, 5, 6-trichloro-2-pyrinidol). This TCP degradation and pyruvic acid formation, is the notable work done and it makes this strain different with respect to other reported Enterobacter sp. so far. &#xD;
&#xD;
The seed germination rate of calcium-phytate and phorate is different from methyl-parathion and chlorpyrifos. For calcium-phytate and phorate the seed germination rate is (RZ311 + OP + seed) &gt; (OP + seed) &gt; seed. Again for methyl-parathion and chlorpyrifos the seed germination rate is (RZ311 + OP + seed) &gt; control &gt; (OP + seed). The rate of vigor-index is as follows: (calcium-phytate + RZ311) &gt; (chlorpyrifos + RZ311) &gt; (calcium-phytate without RZ311) &gt; (phorate + RZ311) &gt; (methyl-parathion + RZ311) &gt; (phorate without RZ311) &gt; control.&#xD;
&#xD;
Conclusion&#xD;
The newly isolated bacterial strain RZ311 or Enterobacter aerogenes strain STLR-I, is highly useful for biodegradation of toxic water-insoluble organophosphorus compounds, such as calcium-phytate, chlorpyrifos, methyl-parathion and phorate into non-toxic water soluble compounds. Thus, such types of bio-inoculants can be used to decontaminate the terrestrial as well as aquatic environment from various types of toxic chemicals. The degraded soluble phosphate compounds are consumed by the plants. These soluble phosphates improve soil quality and growth of plants. &#xA0;These soluble phosphates in the soil can reduce the consumption of synthetic fertilizers. Field application is our future objective to extend this work.&#xD;
&#xD;
Acknowledgement:&#xD;
We are very thankful to Dr. N. K. Mandal and Sreyasree Mandal for their work on the language of the manuscript. In addition, Dr. Achintya Mondal and Manas Mondal helped for the data analysis and sample collection. Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed. &#xD;
&#xD;
Conflict of interest&#xD;
All authors have no conflict of interest in conducting and publishing the research paper.&#xD;
&#xD;
Funding&#xD;
Funding is not available from any sources.&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1644</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1644</Fulltext></URLs><References>&#xD;
	Khan MS, Zaidi A, Ahemad M, Oves M, Wani PA. Plant growth promotion by phosphate solubilizing fungi &#x2013; current perspective. Arch Agron Soil Sci 2010; 56:73&#x2013; 98.&#xD;
	Saber K, Nahla LD, Chedly A. Effect of P o n nodule formation and N fixation in bean. Agron Sustain Dev 2005; 25:389 &#x2013; 393.&#xD;
	Sharma SB, Sayyed RZ, Trivedi MH, Gobi TA. Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. Springer Plus 3013; 587 (2 Pt 1): 1-14.&#xD;
	Richardson AE. Soil microorganisms and phosphorus availability. In:Pankhurst CE, Doubeand BM, Gupta VVSR (eds) Soil biota: management in sustainable farming systems. CSIRO, Victoria, Australia, 1994; 50 &#x2013;62.&#xD;
	Zhou K, Binkley D, Doxtader KG. A new method for estimating gross phosphorus mineralization and immobilization rates in soils. Plant Soil 1992; 147:243&#x2013; 250.&#xD;
	Sanchez P, Logan T. Myths and science about the chemistry and fertility of soils in the tropics. In: Lal R, Sanchez P (eds) Myths and science of soils of the tropics. Soil Science Society of America, Madison, WI 1992; 35&#x2013; 46.&#xD;
	Tilman D, Fargione J, Wolff B, D&#x2019; Antonio C, Dobson A, Howarth R, Schindler D, Schlesinger WH, Simberloff D, Wackhamer D. Forecasting agriculturally driven global environmental change. Science 2001; 292:281&#x2013;284.&#xD;
	Schindler DW, Hecky RE, Findlay DL, Stainton MP, Parker BR, Paterson MJ, Beaty KG, Lyng M, Kasian SEM. Eutrophication of lakes cannot be controlled by reducing nitrogen input: results of a 37-year whole-ecosystem experiment. Proc Natl Acad Sci U S A 2008; 105:11254 &#x2013;11258.&#xD;
	Abhilash PC, Singh N. Pesticide use and application: an Indian scenario. J Hazar Mater 2009 Jun 15; 165(1 Pt 3):1&#x2013;12.&#xD;
	Singh B, Satyanarayana T. Applications of phytase of thermophilic mould, Sporotrichum&#xA0; thermophile: A review. J Sci Ind Res (India) 2010 Jun; 411-414.&#xD;
	Pikovskaya RI. Mobilization of phosphorus and soil in connection with the vital activity of some microbial species. Mikrobiologii 1948; 17:362&#x2013;70.&#xD;
	Gaur AC. Phospho-microorganism and varians transformation In Compost Technology, Project Field Document No. 13 FAO, Rome, Italy. 1981; 106-111.&#xD;
	Nguyen C, Yan W, Tacon F L, Lapeyrie F. Genetic viability of phosphate solubilizing activity by monocaryotic and dicatyotic mycelia of the ectomycorrhyzal fungus Laccaria bicolor (Maire) PD Orton, Plant Soil 1992; 143: 193-199.&#xD;
	Seshadri S, Ignacimuthu S, Lakshminarsimhan C. Variations in heterotrophic and phosphate solubilizing bacteria from Chennai, southeast coast of India. Indian J Mar Sci, 2002; 31: 69-72.&#xD;
	Widawati S. Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem. Biodiversitas 2011; 12 (1): 17-21.&#xD;
	Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST. Bergey&#x2019;s Manual of Determinative Bacteriology. 9th edition published by Williams and Wilkins, A. Wavely company, Baltimore. 1994.&#xD;
	King EO, Ward MK, Raney DE. Two simple media for the demonstra- tion of Pyocianin and fluorescein. J Lab Clin Med 1954; 44: 301-307.&#xD;
	Reeves M, Pine L, Neilands JB, Bullows A. Absence of siderophore activity in Legionella spp. grown in iron defi- cient media. J Bacteriology 1983; 154: 324-329.&#xD;
	Reddy BP, Reddy KRN, Rao MS, Rao KS. Efficacy of Antimicrobial Metabolites of Pseudomonas fluorescens Against Rice Fungal Pathogens. Curr Trends Biotechnol Pharm Association of Biotechnology and Pharmacy 2008; 17 (2 Pt 1): 178-182.&#xD;
	Murray MG, Thormpson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 1980; 8: 4321-4326.&#xD;
	Harishankar MK, Sasikala C, Ramya M. Ef?ciency of the intestinal bacteria in the degradation of the toxic pesticide, chlorpyrifos. 3 Biotech 2013 April; 3(2): 137-142.&#xD;
&#xD;
&#xD;
&#xD;
	Hao J,&#xA0;Liu J,&#xA0; Sun M. Identification of a Marine Bacillus Strain C5 and Parathion-Methyl Degradation Characteristics of the Extracellular E sterase B1. BioMed Res. Int 2014; 2014 Article ID 863094, 7 pages.&#xD;
	Bano N, Musarrat J. Isolation and characterization of phorate degrading soil bacteria of environmental and agronomic signi?cance. Lett Appl Microbiol&#xA0;2003; 36(6):349-53.&#xD;
	Ghorbani-Nasrabadi R, Greiner R, Alikhani HA, Hamedi J, Yakhchali B. Distribution of&#xA0; actinomycetes in different soil ecosystems and effect of media composition on extracellular phosphatase activity. J. Soil Sci. Plant Nutr 2013; 13(1): 223-236.&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>A Morphological Study of Suprascapular Notch and Incidence of Ossification of Superior Transverse Scapular Ligament in South Indian Dry Scapulae&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>45</FirstPage><LastPage>49</LastPage><AuthorList><Author>S. Vedha</Author><AuthorLanguage>English</AuthorLanguage><Author> K. Vidulatha</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Introduction: The suprascapular notch is converted into suprascapular foramen by bridging of superior transverse scapular ligament (STSL) on its edges. The structures related to STSL are the suprascapular vessel which passes above and suprascapular nerve which passes below the ligament to reach the supraspinous fossa. The anterior coracoscapular ligament (ACSL) is present below the suprascapular ligament. Ossification of both STSL and ACSL leads to formation of double suprascapular foramen.&#xD;
Aim: The aim of the present study is to know the incidence of suprascapular foramen and prevalence of different types of suprascapular notch in south Indian dry scapula.&#xD;
Method and Result: 250 scapulae were examined in the present study. Out of which, 23 (9.2%) showed complete ossification and 13 (5.2%) showed partial ossification of STSL. Presence of both complete and partial foramen was observed in one of the right sided scapula.&#xD;
Conclusion: The knowledge of variation in shape of suprascapular notch and ossification of both STSL and ACSL is of great concern for anatomist, neurosurgeon, radiologist and orthopaedician to understand the cause of suprascapular nerve entrapment syndrome and for better management of those cases.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Suprascapular notch (SSN), Superior transverse scapular ligament (STSL), Anterior coracoscapular ligament (ACSL), Suprascapular nerve (SN), Suprascapular nerve entrapment syndrome</Keywords><Fulltext>Introduction:&#xD;
The suprascapular notch is a depression on the superior border of the scapula just medial to the root of coracoid process. The notch is bridged by the superior transverse scapular ligament. Sometimes the suprascapular ligament is ossified to form a foramen that transmits the suprascapular nerve. The suprascapular nerve is the largest branch of upper trunk of brachial plexuses. It supplies both supraspinatus and infraspinatus muscles and gives articular branches to the shoulder and acromioclavicular joints1.&#xD;
&#xD;
Approximately 1&#x2013;2% of all shoulder pain is caused by the suprascapular nerve entrapment syndrome2. Kopell and Thompson was the first to describe the suprascapular nerve entrapment in 19593. Many authors have identified that the morphological variation of the suprascapular notch and the ossification of the STSL is the cause of suprascapular nerve entrapment syndrome4,5,6,7. The ossification of the ligament is either partial or complete4. The size and shape of the notch may be a factor in suprascapular nerve entrapment because narrow suprascapular notch have been found in patients with this syndrome2,8,9,10,11,12. It is essential for clinical practice because various techniques are associated with the athroscopic decompression of the nerve13,14,15.&#xD;
&#xD;
Aim of the study:&#xD;
To study the incidence of completely ossified superior transverse scapular ligament forming suprascapular foramen in dry scapulae of Indian population.&#xD;
&#xD;
&#xD;
	To identify the different shapes of suprascapular notch.&#xD;
	To compare our results with previous authors. &#xA0;&#xD;
&#xD;
&#xD;
Material and Methods:&#xD;
A total of 250 human scapulae obtained from the Department of Anatomy, Velammal medical college, Madurai and Govt. Sivagangai medical college, Sivagangai were analysed. Out of this, number of scapulae with completely ossified superior transverse scapular ligament and different shapes of suprascapular notch were identified, photographed and documented. The result of the present study is compared with the results of previous authors in Indian populations.&#xD;
&#xD;
Results:&#xD;
Out of 250 scapulae, 23 (9.2% ) were identified to have complete ossification and 13 (5.2% ) were identified to have partial ossification of superior transverse scapular ligament. One of the scapulae showed both complete and partial foramen in the same scapula was noted (Table 2). Six different shapes of the suprascapular notch were also observed (Table 1).&#xD;
&#xD;
Discussion:&#xD;
The incidence of complete ossification of suprascapular ligament according to Udayasree16, Usha17 were 9.5% and 10% respectively. Whereas Jawed18 and Mistry19 recorded higher incidence and shiksha20, polguj21, and Soni10 recorded a lower incidence. Hence the present study is in accordance with the study done by Udayasree and Usha.&#xD;
&#xD;
According to Rengachary22, Muralidhar23 and Usha % , 5.76% and 4% respectively. Hence the present study is in conformity to the above mentioned studies. However Soni10 in his study didn&#x2019;t encounter a single scapula with partial ossification.kannan17 the incidences of partial ossification of suprascapular ligament were 6&#xD;
&#xD;
Double suprascapular foramen was reported only by four authors in the past. Hrdlica24 was the first to report this type of variation in 1942 followed by Wang25 in 2011, Polguj26 in 2012 and Serghei27 in 2016. In addition, Polguj proposed four hypothesis for formation of double foramen.&#xD;
Hypothesis 1: ossification of superior transverse scapular ligament, anterior coracoscapular ligament&#xD;
Hypothesis 2: ossification of bifid superior transverse scapular ligament&#xD;
Hypothesis 3: partial ossification of trifid superior transverse scapular ligament&#xD;
Hypothesis 4: ossification of bifid anterior coracoscapular ligament&#xD;
&#xD;
Out of % ) with double foramen was noted. But one foramen was partially ossified and the other was complete. Thus in the present study complete ossification of anterior coracoscapular ligament and partial ossification of superior transverse scapular ligament was noted.these four hypothesis, first one was highlighted to be the cause for double foramen by Polguj in his study26. This type of variation may involve in compression of both nerve and vessels. In the present study, one scapula (0.4&#xD;
&#xD;
Rengachary22 in his study of 211 cadaveric adult scapulae, had classified 6 basic type of suprascapular notch&#xA0;&#xD;
Type 1: absence of notch&#xD;
Type 2: V shaped notch&#xD;
Type 3: U shaped notch&#xD;
Type 4: small V shaped notch&#xD;
Type 5: U shaped notch with partial ossification of suprascapular ligament&#xD;
&#xA0;Type 6: complete ossification of suprascapular ligament&#xD;
&#xD;
In the present study, all the above types of notch had been encountered expect type 4. Instead J shaped notch were observed in 13 (5.2%) scapulae.&#xD;
&#xD;
The most common type of notch observed and in the present study was U shaped (53.2% ) which was in accordance with the studies of previous authors. But in the present study two types of U shaped notch were observed that is a deep U which accounted for 37.2% and a shallow U for 16% of scapulae.&#xD;
&#xD;
The incidence of absence of % ), Muralidhar23 (21.15% ) and Usha kannan17 (20% ). suprascapular notch in the present study was 21.2% which was in accordance with the studies conducted by Iqbal28 (18&#xD;
&#xD;
However, in the present study absence of the notch was observed and recorded on both sides which were similar to the study conducted by Raj kishore29. He examined 112 scapulae and found absence of notch in 8.93% and 10.71% on right and left sides respectively. In the present study absence of notch was observed in 8% and 13.2% on right and left sides respectively.&#xD;
Hence the present study is in accordance with the previous studies done by Muralidhar and Usha kannan.&#xD;
&#xD;
Conclusions:&#xD;
Since the suprascapular notch is the most common site of both injury and compression of the suprascapular nerve, a thorough knowledge of this region is essential. This study would help the clinicians for better management of suprascapular nerve entrapment syndrome.&#xD;
&#xD;
Acknowledgements:&#xD;
We would like to acknowledge all the faculty members and technical staff in our department for their advice and assistance. We also acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript and are grateful toauthors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed. &#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1645</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1645</Fulltext></URLs><References>&#xD;
	&#xD;
	Standring SM, Ellis H, Healy JC, Johnson D, Williams A (2005) gray&#x2019;s anatomy. 39th ed. Churchill-livingstone, Edinburgh.&#xD;
	&#xD;
	&#xD;
	M. Polguj, K.S. J?drzejewski, M. Podg&#xF3;rski, M. Topo (2011) correlation between morphometry of the suprascapular notch and anthropometric measurements of the scapula. Folia morphol. Vol. 70, no. 2, pp. 109&#x2013;115.&#xD;
	&#xD;
	&#xD;
	Kopell HP, Thompson Wal (1959) pain and the frozen shoulder. Surg gynecol obstet, 109: 92&#x2013;96. &#xD;
	&#xD;
	&#xD;
	Ticker JB, Djurasovic M, Strauch RJ, April EW, Pollock RG, Flatow EL, et al. The incidence of ganglion cysts and other variations in anatomy along the course of the suprascapular nerve. J shoulder elbow surg.1998;7(5):472-8.&#xD;
	&#xD;
	&#xD;
	Osuagwu FC, Imosemi IO, Shokunbi MT complete ossification of the superior transverse scapular ligament in a nigerian male adult. Int j morphol. 2005;23(2):121-2.&#xD;
	&#xD;
	&#xD;
	Callahan JD, Scully TB, Shapiro SA, Worth RM. Suprascapular nerve entrapment: a series of 27 cases. J neurosurg. 1991;74:893-6.&#xD;
	&#xD;
	&#xD;
	Bayramoglu A, Demiry&#xFC;rek D, T&#xFC;ccar E. Variations in anatomy at the suprascapular notch possibly causing suprascapular nerve entrapment: an anatomical study. Knee surg sports traumatol arthrosc. 2003;11:393-8.&#xD;
	&#xD;
	&#xD;
	Jadhav SD, Patil RJ, Roy PP, Ambali MP, Doshi MA, Desai RR. Supra scapular foramen in indian dry scapulae.njca. 2012; 1(3): 133-135.&#xD;
	&#xD;
	&#xD;
	Shane tubbs,&#xA0;Carl Nechtman,&#xA0;Anthony V. D&#x2019;antoni,&#xA0;Mohammadali M.Shoja&#xA0; Martin M. Mortazavi,&#xA0;Marios Loukas,&#xA0;Curtis J. Rozzelle,&#xA0;and&#xA0;Robert J. Spinner ossification of the suprascapular ligament: a risk factor for suprascapular nerve compression? Int J shoulder surg.&#xA0;2013 jan-mar;&#xA0;7(1): 19&#x2013;22. &#xD;
	&#xD;
	&#xD;
	G. Soni, V.S. Malik, L.Shukla, S. Chabbra, N. Gaur: Morphometric analysis of the suprascapular notch. The internet journal of biological anthropology. 2012 volume 5 numberi.doi:10.5580/2b19&#xD;
	&#xD;
	&#xD;
	Khan, M.A. complete ossification of the suprascapular transverse ligament in an male adult. Int. J. Morphol., 24(2):195-196. 2006&#xD;
	&#xD;
	&#xD;
	Vyas, Kintu K.; Rajput, Hina B.; Zanzrukiya, Kalpesh M.; Suttarwala, Ila; Sarvaiya, Bharat J.; Shroff, Bhavesh D. An osseous study of suprascapular notch and various dimentions of safe zone to prevent suprascapular nerve injury. Indian journal of applied basic medical sciences;jan2013, vol. 15 issue 20, p27&#xD;
	&#xD;
	&#xD;
	Barwood SA, Burkhart SS, LO IK (2007) arthroscopic suprascapular nerve release at the suprascapular notch in a cadaveric model: an anatomic approach. Arthroscopy, 23: 221&#x2013;225. &#xD;
	&#xD;
	&#xD;
	Bhatia DN, De Beer JF, Van Rooyen KS, Du Toit DF (2006) arthroscopic suprascapular nerve decompression at the suprascapular notch. Arthroscopy, 22: 1009&#x2013;1013.&#xD;
	&#xD;
	&#xD;
	Lafosse L, Tomasi A, Corbett S, Baier G, Willems K, Gobezie R (2007) arthroscopic release of suprascapular nerve entrapment at the suprascapular notch: technique and preliminary results. Arthroscopy, 23: 34&#x2013;42. &#xD;
	&#xD;
	&#xD;
	Udayasree L, Siva Prasad G V, Lakshmi V V V. Study of anatomical variations in the shape of suprascapular notch in dried human scapulae and its clinical significance. Journal of evolution of medical and dental sciences 2014; 3 (22): 6053-6057, doi: 10.14260/jemds/2014/2704&#xD;
	&#xD;
	&#xD;
	&#xA0;Kannan U, N.S Kannan, Anbalagan J, Rao S. Morphometric Study of Suprascapular Notch in Indian Dry Scapulae with Specific Reference to the Incidence of Completely Ossified Superior Transverse Scapular Ligament.JCDR.2014;8(3):7-10.&#xD;
	&#xD;
	&#xD;
	Akhtar J, Madhukar P, Fatima N, Kumar A, Kumar B, Sinha R, Kumar V. Ossification of transverse scapular ligament in north indian population. JEMDS, 3(63):13884-92. 2014&#xD;
	&#xD;
	&#xD;
	&#xA0;Mistry P, Chuhan K, Mehta C, Patil D, Bansal M, Suthar K. A study of incidence of ossification of superior transverse scapular ligament of scapula and its clinical implications. Int j of basic and applied medical sciences. 2013; 3 (2): 41-45.&#xD;
	&#xD;
	&#xD;
	Jangde S, Arya R, Paikra S, Basan K. Bony suprascapular foramen, a potential site for suprascapular nerve entrapment: a morphological study on dried human scapulae international journal of anatomy and research, int j anat res 2015, vol 3(3):1316-20. Issn 2321- 4287&#xD;
	&#xD;
	&#xD;
	Polguj M, J?drzejewski K, Majos A, Topol M. Variations of bifid superior transverse scapular ligament as a possible factor of suprascapular entrapment: a anatomical study. International orthopaedics 2012; 36: 2095&#x2013;2100&#xD;
	&#xD;
	&#xD;
	Rengachary SS, Burr D, Lucas S, Hassanein KM, Mohn MP, Matzke H (1979) suprascapular entrapment neuropathy: a clinical, anatomical, and comparative. Study part 2: anatomical study. Neurosurgery, 5(4): 447&#x2013;451&#xD;
	&#xD;
	&#xD;
	Muralidhar Reddy Sangam,&#xA0;Sattiraju Sri Sarada Devi,&#xA0;Karumanchi Krupadanam, and&#xA0;Kolla Anasuya. A study on the morphology of the suprascapular notch and its distance from the glenoid cavity. J Clin Diagn Res.&#xA0;2013 February;&#xA0;7(2): 189&#x2013;192. &#xD;
	&#xD;
	&#xD;
	Hrdicka A. The adult scapula: additional observation and measurement. Am J Phys Anthropol.1942;29:363-415.&#xD;
	&#xD;
	&#xD;
	Wang HJ, Chen C, Wu LP, Pan CQ, Zhang WJ, Li YK. Variable morphology of suprascapular notch: an investigation and quantitative measurement in Chinese population. Clin Anat.2011;24(1):47-55.&#xD;
	&#xD;
	&#xD;
	Polguj M, Podgorski M, Jedrzejewski K, Topol M. The double suprascapular foramen: unique anatomical variation and the new hypothesis of its formation. Skeletal Radiol.2012;41:1631-36.&#xD;
	&#xD;
	&#xD;
	Covantev S, Belic O, Mazuruc N. Double suprascapular foramen: a rare scapular notch variation. Russian open Medical Journal.2016;5(3):1-3.&#xD;
	&#xD;
	&#xD;
	Iqbal K, Iqbal K, Khan S G. Anatomical variations in shape of suprascapular notch of scapula. J.morphol sci. 2010; 27(1): 1-2.&#xD;
	&#xD;
	&#xD;
	Raj Kishore Mahato, Parineeta Suman. &#x201C;Complete Absence of the Suprascapular Notch: A Risk Factor for Suprascapular Nerve Entrapment Neuropathy&#x201D;. Journal of Evolution of Medical and Dental Sciences 2013; l2( 25): 4542-4547.&#xD;
	&#xD;
	&#xD;
	Agrawal D, Singh B, Agrawal GA. Human Scapulae: Supra Scapular Notch, Morphometry and Variations. Indian Journal of Clinical Anatomy and Physiology.2014;1:1-7.&#xD;
	&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>Achondroplasia with Oral Lichen Planus - A Case Report&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>50</FirstPage><LastPage>53</LastPage><AuthorList><Author>Nivedita CKVS</Author><AuthorLanguage>English</AuthorLanguage><Author> Ajit D. Dinkar</Author><AuthorLanguage>English</AuthorLanguage><Author> Sonam Khurana</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>This article aims to highlight the occurrence of oral lichen planus in a patient with achondroplasia. The patient was treated with topical and systemic corticosteroids and showed significant improvement. Achondroplasia is the most common form of nonlethal skeletal dysplasia that manifests with stunted stature and disproportionate limb shortening. Clinical manifestations are mainly a result of mutations in fibroblast growth factor receptor-3 (FGFR3) gene. It is of special interest in the dental field because of its craniofacial features and dentists treating patients with achondroplasia should be well aware of the clinical features, risk factors and complications associated with this condition.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Achondroplasia, Short stature, FGFR3 gene</Keywords><Fulltext>&#xD;
Introduction:&#xD;
Achondroplasia (OMIM 100800) was first described in 1878 and is the most common nonlethal skeletal dysplasia. It is inherited in an autosomal dominant fashion, the distinct clinical features of achondroplasia are evident at birth and primarily affect the skeleton, resulting in short-limbed dwarfism.1 The condition has been recognised for centuries, with examples seen in art from ancient Egypt, Greece, and Rome. However, it is estimated to occur in between one in 10,000 and one in 30,000 live births. The achondroplasia locus was mapped to chromosome 4p16.3 in 1994, and heterozygous mutations of FGFR3 were identified shortly afterwards.2&#xD;
&#xD;
Increased incidence of sporadic mutations have also been associated with increasing paternalage.3 The present article depicts a rare case of achondroplasia with oral lichen planus in a 42 year old male patient.&#xD;
&#xD;
Case Report:&#xD;
A 42 year old male reported to Department of Oral Medicine and Radiology with the chief complaint of burning sensation in the oral mucosa on having hot and spicy food. Burning sensation started almost 2 months back which was insidious in nature and aggravated on having spicy food. He also gave a history of chronic irritation to the buccal mucosa due to entrapment of cheek between the teeth. The patient was born to non consanguineous parents, and was born full term. Postnatal history couldn&#x2019;t be obtained since his parents have expired. Patient has an elder brother who is normal and two elder sisters who have short stature. Medical history revealed that he has epilepsy and is under sodium valproate. He attended school only till 5th standard. Cognitive and intelligence test (Binet Kamat Test and Bhattia&#x2019;s battery of performance) performed by a clinical psychologist revealed that he had poor understanding capacity, poor eye contact, restlessness and delayed reactions for performance. IQ was 69-75 and was categorized as mild but normal. His observation capacity was good.&#xD;
&#xD;
General physical examination showed short stature, lordotic lumbar spine, rhizomelic shortening of the arms and legs, short stubby trident hands. Prominent buttocks and protuberant abdomen&#xD;
&#xD;
were also evident.Anthropometry revealed a height of 124.9 cms and weight of 35kgs, with upper limb to lower limb ratio of &gt;1. The head circumference was 49.7 cms. His vital signs were within the normal limits. Systemic examination did not reveal any other abnormality. Extraoral examination revealed enlarged calvarium, brachycephaly, midfacial hypoplasia, widening of nasal bridge and competent lips. The chin was retruded and not prominent.On intraoral examination, there were diffuse erythematous and ulcerative areas on the right and left buccal mucosa with white prominent keratotic areas and pigmentation at retrocommisural region. White striae arranged in annular pattern were seen on the lower labial mucosa along with generalized erythema of the marginal and papillary gingiva and the lesion was non-tender on palpation. Other dental findings were increased anterior proclination of upper and lower anterior teeth, class 2 canine relationship and generalized recession of gingiva. Size, number and form of teeth were normal with few carious lesions.&#xD;
&#xD;
On radiographic examination, his orthopantomogram showed the presence of permanent teeth with missing 3-4, 3-6, 3-7, 4-6 and 4-7. Enlarged calvarium with an increase in the transverse diameter, J shaped sella, shortening of the skull base, retruded maxilla, Proclinedmaxillary and mandibular incisors were evident in the lateral cephalogram. Submentovertex view showed plagiocephaly. A final diagnosis of achondroplasia was made based on the history, clinical examination and radiological investigations. The patient was advised for biopsy and was subjected to routine blood investigations. Microscopic findings revealed fibro collagenous tissue covered by stratified squamous epithelium showing hyperkeratosis, acanthosis and formation of subepithelial bulla. The subepithelial tissue shows dense chronic inflammatory infiltrate. All these features were suggestive of oral lichen planus. During his treatment period, he was given topical steroids along with systemic steroids. Topical Clobetesol 0.01% along with systemic prednisolone 30mg in divided doses was prescribed to the patient. Initially, he was being reviewed at an interval of every 1-2 weeks for 2 months. When active lesions had stopped forming, the doses of the medications were being tapered and he was being reviewed after every 6 months period. Symptomatic improvement along with resolution of the lesions were noted. The patient was then referred for further dental treatment.&#xD;
&#xD;
Discussion:&#xD;
Achondroplasia is part of a spectrum of disorders caused by different mutations in FGFR3, which includes hypochondroplasia, severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN), and thanatophoric dysplasia, of which two types can be distinguished by radiograph and molecular analysis (thanatophoric dysplasia I and thanatophoric dysplasia II).2 &#xA0;The common mutation causes a gain offunction of the fibroblast growth factor receptor-3 (FGFR3) gene, resulting in decreased endochondral ossification, inhibited proliferation of chondrocytes in growth plate cartilage, decreased cellular hypertrophy and decreasedcartilage matrix production; leading to a variety of manifestations and complications.4 More than 99% of people with achondroplasia carry a point mutation at nucleotide 1138 in one copy of the fibroblast growth factor receptor-3 (FGFR3) gene: most commonly, a G&#x2192;A transition, although G&#x2192;C transversion has also been reported. Both mutations result in the substitution of arginine for glycine at residue 380 (G380R) in the transmembrane region of the fibroblast growth factor receptor-3 (FGFR3) protein. Chondrocyte proliferation and differentiation are inhibited, decreasing bone growth rates. Although the word achondroplasia literally means &#x2018;without cartilage formation&#x2019;, in this disorder the problem is not in cartilage formation but in converting cartilage to bone, particularly in the long bones of the arms and legs, the spine, and the skull. FGFR3 mutations alter the cartilage growth plate architecture; endochondral boneformation is therefore affected.1&#xD;
&#xD;
In heterozygous state, achondroplasia isnon-lethal with normal life span and normal intelligence. However, they are at risk like cervicomedullary compression, spinal stenosis, obesity, obstructive sleep problem. Inhomozygous state, achondroplasia is a lethalcondition in the early few months of life because of severe rib cage deformity that results in respiratory insufficiency.5&#xD;
&#xD;
Affected babies are short at birth and grow slowly throughout childhood; the average final height for women is 123 cm and 130 cm for men.4 Clinical features include long, narrow trunk and short limbs, especially in a proximal(rhizomelic) segment. The head is large with frontal bossing, but the midface is hypoplastic, a result of the endochondral origin of the base of the skull. Hyperextensibility of joints, especially the knees and hands, is common, but full extension and rotation of the elbow is usually restricted. The hands are short and broad with fingers exhibiting a three-pronged (trident) appearance at birth due to an inability to fully oppose the third and fourth digits. Thoracolumbar gibbus might be present at birth and usually develops by 4 months. Mild to moderate hypotonia is common in infancy, often secondary to spinal cord compression at the cervical medullary junction, and contributes to motor milestone delay. Newborns usually lie with hips abducted after their mother lays them down.2&#xD;
&#xD;
Essential radiological features include (1) Symmetric shortening of all long bones, with proximal portions being more affected and lower limb involvement being more than the upper limb (rhizomelia). There&#x2019;s relative flaring and splaying of metaphyses with normal epiphyses. (2) In children, the two limbs of the V of metaphysic appear to embrace the epiphysis giving rise to a ball and socket relationship/chevron deformity (3) The hand bones appear thick and tubular with widely separated 2ndand 3rddigits of the hands and inability to approximate them in extension, leading to appearance of trident hand (4) The pelvic cavity is short and broad, also called as champagne-glass appearance. There&amp;#39;s squaring of iliac wings with some rounding of corners on afrontal projection (elephant ear shaped iliac wings). (5) In spine,there is progressive decrease in the interpedicular distance cranio-caudally in the lumbar spine. Posterior scalloping of vertebral bodies is also common while anteriorly they may appear rounded giving rise to a bullet-shaped configuration. (6) The skull shows narrowed skull base with narrowing of foramen magnum. There is compensatory over-expansion of the skull vault and frontal regions to accommodate the expanding brain. There&#x2019;s relative mid-face hypoplasia and depressed nasal bones.3 As the condylar cartilage is the product of periosteal chondrogenesis, mandibular growth is not affected.6&#xD;
&#xD;
Several dental manifestations have also been previously reported in the literature which includes skeletal and dental class III malocclusion, a narrow maxilla, macroglossia, and an open bite between the posterior teeth.7&#xD;
&#xD;
Chawla K(2012) reported periodontal manifestations in achondroplasia and stated that the possible reason for periodontal disease could be that defective fibroblast growth factor receptor-3 (FGFR3) might hamper the growth and function of fibroblasts, which are the predominant cells found in the periodontal ligament. A missense mutation in FGFR3 gene leads to impaired formation ofFGFR3 protein, which can hamper the growth and function of periodontal fibroblasts.8&#xD;
&#xD;
The differential diagnosis of achondroplasia includes other chondrodystrophies including hypochondroplasia and chondroectodermal dysplasia. Although hypochondroplasiais associated with dwarfism, it can be differentiated from achondroplasia by milder clinical features. Brachycephalyis much less pronounced in hypochondroplasia and also the trident hand configuration is not seen in hypochondroplasia.4 Prenatal diagnosis of homozygous achondroplasia can be made by mutation detection at 10-12 week of gestation as against 16-20 week by ultrasonographic examination. Ultrasonographic examination can detect shortening of long bones only in late pregnancy (third trimester). Prenatal diagnosis can be provided early in pregnancy by DNA based methods on chorionic villi.9 Genetic counseling regarding prenatal testing options is important so that families can understand their reproductive options.1 There have been several trials of human growth hormone treatment in children with achondroplasia, mostly using pharmacological doses comparable with those used in Turner syndrome Surgical limb lengthening is another approach that has been used to increase stature.2&#xD;
&#xD;
Special precautions in head control during dental intervention are essential in children, due to the possible presence of cranio-cervical instability, foramen magnum stenosis and limited neck extension, as it might result in respiratorycomplications.5 It is also important for dental professionals, including pediatric dentists, orthodontists and oral surgeons treating these patients, to recognize risk factors and potential complications before sedation or anaesthesia. When dental treatment is decided to be under GA, it is recommended to do radiologic evaluation of foramen magnum, preoxygenation before anesthesia, using appropriate endotracheal tube size, oral intubation and administration of oxygen after extubation.6&#xD;
&#xD;
Conclusion:&#xD;
In conclusion, dentists treating patients with achondroplasia should be well aware of the clinical features, risk factors and complications associated with this condition. Psychological management during dental treatment is also essential as presence of short stature can pose a number of psychosocial and social problems.&#xD;
&#xD;
Acknowledgement&#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
 &#xD;
&#xD;
&#xA0;&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1646</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1646</Fulltext></URLs><References>&#xD;
	Erin M. Carter, Jessica G. Davis, Cathleen L. Raggio. Advances in understanding etiology of achondroplasia and review of management. Curr Opin Pediatr 19:32&#x2013;37, 2007&#xD;
	William A Horton, Judith G Hall, Jacqueline T Hecht. Achondroplasia. Lancet 2007; 370: 162&#x2013;72&#xD;
	Ananya Panda, Shivanand Gamanagatti, Manisha Jana, Arun Kumar Gupta. Skeletal dysplasias: A radiographic approach and review of common non-lethal skeletal dysplasias. World J Radiol2014; 6(10): 808-825.&#xD;
	Lata Kale, Neha Khambete, Sonia Sodhi, Rahul Kumar. Achondroplasia with oligodontia: Report of a rare case. Journal of Oral and Maxillofacial Pathology, 2013:17(3): 452-54.&#xD;
	Rohilla S, Kaushik A, Vinod V, Tanwar R, Kumar M. Orofacial manifestations of achondroplasia. EXCLI J 2012;11:538-54.&#xD;
	Afnan Al-Saleem, Asma Al-Jobair. Achondroplasia: Craniofacial manifestationsand considerations in dental management. The Saudi Dental Journal 2010; 22:195&#x2013;199.&#xD;
	Celenk P, Arici S, Celenk C. Oral findings in a typical case of achondroplasia. J Int Med Res 2003;31:236-8.&#xD;
	Chawla K, Lamba AK, Faraz F, Tandon S. Achondroplasia and periodontal disease. J Indian Soc Periodontol 2012;16:138-40.&#xD;
	Sethi RS, Kumar L, Chaurasiya OS, Gorakh R. Achondroplasia: A case report. Curr Pediatr Res 2011;15:137-42.&#xD;
&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>Stem Cells and Metallothionein - A Review&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>54</FirstPage><LastPage>61</LastPage><AuthorList><Author>Sundararaj Sankaramanivel</Author><AuthorLanguage>English</AuthorLanguage><Author> Muhammad Yasar Molgakar</Author><AuthorLanguage>English</AuthorLanguage><Author> Pitchan Arul Prakash</Author><AuthorLanguage>English</AuthorLanguage><Author> M.S. Mohamed Jaabir</Author><AuthorLanguage>English</AuthorLanguage><Author> Subramanian Gurunathan</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Stem Cells are capable of self renewal and can differentiate into other lineages upon induction with specific growth factors and proteins. Mesenchymal stem cells obtained from various sources like adipose tissue, umbilical cord, bone marrow, umbilical cord blood have been reported to have stem cell characteristic features laid down by International Society for Cellular Therapy. Research so far deals with the differentiation and self renewal properties of stem cells, which needs to be understood further. Metallothionein, is a metal binding protein isolated from equine renal cortex and shown to be present in nearly all of our cells, with differential expression of it&#x2019;s isoforms. Apart from metal binding properties, this protein expression is deregulated in a variety of diseases and other treatment conditions. With respect to cancer biology, this protein expression is studied in almost all cancer types and results indicate the pivotal role of this protein in cancer. Certain cancers are associated with up-regulation while some types are associated with down-regulation. The localization of this protein has also reported changing between actively proliferating and normal cells. Given the importance of this protein in cancer biology, the role of this protein in stem cell renewal, as well as differentiation, is poorly understood. This review discusses about stem cells, - its type and differentiation; metallothionein - expression, function, review about different cancer types, role in angiogenesis and plausible role of this protein in the self-renewal and differentiation of stem cells.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>Stem cells, Metallothionein, Differentiation, Self renewal, Apoptosis</Keywords><Fulltext>STEM CELLS &#xD;
In the 1960s, mesenchymal stem cells were first identified as plastic adherent, non-haematopoietic stromal cells in bone marrow with osteogenic potential. Initially they were named as colony forming units and later they were renamed as mesenchymal stem cells (MSCs) as they can readily differentiate into adipocytes and osteoblasts (Pittenger et al., Science, 1999) [1]. Subsequently, differentiation to other lineages like ectoderm and endoderm has also been reported. Since then, MSCs have been isolated from many other tissues like adipose tissue, umbilical cord, umbilical cord blood, umbilical cord Wharton&#x2019;s Jelly, synovial membrane and tooth pulp. In general, stem cells are classified based on their source of origin as embryonic stem cells and tissue specific / adult stem cells. Recently, Shinya Yamanaka reported of creating pluripotent stem cells from terminally differentiated fibroblasts [2-12]. Stem cells are also classified based on their differentiation potential - totipotent (early progeny of the zygote up to the eight cell stage of the morula), pluripotent (Inner cell mass of embryo, epiblast), multi/oligopotent (Fetal tissues, membranes, placenta and adult stem cells), bipotent (lymphoid or myeloid stem cells) or unipotent (Muscle stem cells) [13, 14].&#xD;
&#xD;
Characteristic features of MSCs &#xD;
Ideally MSCs are isolated and identified based on their ability to adhere to static surface; preferably plastic coated with elements which support anchoring of cells and this is considered gold standard method still [15]. Another method of identifying and purifying the MSC population is by sorting of cells via Fluorescence activated cell sorting method. This is done by raising monoclonal antibodies against certain cell surface proteins. These surface markers are said to vary in their expression pattern and are donor-, isolation- and passage-dependent [16]. However there is consensus that MSC do not display CD11b, CD31, CD34, CD45, CD117 and HLA-DR. Positive expression of markers identified so far is: CD13, CD29, CD44, CD73, CD90, CD105, CD166,&#xD;
&#xD;
STRO-1, and Sca-1[17, 18, 19]. Several other methods such as membrane filtration, magnetic beads sorting, capillary electrophoresis, and differential centrifugation have also been employed among other emerging technologies to isolate these cells [20, 21]. MSCs also show multi-potential differentiation ability. Research has shown that MSCs have inherent property to differentiate into cells of mesoderm lineage, forming bone (osteocyte), fat (adipocyte) and cartilage (chondrocyte) cells upon induction [22]. These are the minimal criteria to define the isolated populations of cells as mesenchymal stem or stromal cells as described by the International society for Cellular Therapy (ISCT) in 2006 [16].&#xD;
&#xD;
Self-renewal and differentiation &#xD;
Self-renewal may be defined as the ability of cells that sustain the capacity of cells to remain in quiescent or undifferentiated state. It can be influenced by presence or absence growth factors such as Leukemia Inhibitory Factor (LIF), Fibroblast Growth Factors (FGFs), Wnt family of proteins, Sox2 and Oct4 among others. Commitment or differentiation of mesenchymal stem cells, inherently towards mesodermal lineage, as well as cells towards ectodermal and endodermal lineage is a tightly and temporally controlled process guided by microenvironment and culture conditions [23]. These can be regulated in order to enhance the differentiation capacity of MSCs by various methods using biological, biochemical and mechanical approaches [24, 25, 26].&#xD;
&#xD;
Mesodermal differentiation &#xD;
Differentiation of MSCs to form bone, fat or cartilage is inherent and can readily be observed upon induction by culturing MSCs with transforming growth factors &#x3B2;1 and &#x3B2;2 (TGF-&#x3B2;1and 2), bone morphogenic protein (BMP)2, 4, 6, 12 and 13. To mimic the bone development in vitro; cells are cultured in the presence of &#x3B2;-glycerophosphate and ascorbic acid-2-phosphate, BMPs, Wnts, dexamethasone which would result in increased alkaline phosphatase activity and calcium deposits and are positive for von Kossa staining. Chondrocytes or cells forming cartilage can be obtained in vitro by culturing cells in high seeding density as pellet or micromass form, in the presence of Insulin-TransferrinSelenium (ITS), linoleic acid, selenious acid, pyruvate, ascorbate 2-phosphate, dexamethasone and transforming growth factor-&#x3B2; III (TGF-&#x3B2;III). At the end of differentiation period, cells tend to accumulate proteoglycans and type II collagen. To obtain fat cells or mature adipocytes, cells are cultured with dexamethasone, insulin, isobutylmethylxanthine (IBMX), and indomethacin. The resulted cells are able to produce lipid droplets which can be revealed by addition of oil red stain and expression of Adipocyte-specific genes Peroxisome Proliferator-Activated Receptor gamma (PPAR-&#x3B3;), Adipocyte protein 2 (ap2) and Liporotein Lipase (LPL) genes [17, 27, 28].&#xD;
&#xD;
Ectodermal differentiation &#xD;
Despite of mesodermal origin, MSCs have the ability to differentiate into non mesodermal lineage such as neurons and glial cells. Neuronal or glial cells can be obtained upon exposure to cocktails of growth factors like Hepatocyte Growth Factor (HGF), fibroblast growth factor (FGF), epidermal growth factor (EGF), neurogenin-1, forskolin, cAMP, &#x3B2;- Mercaptoethanol (BME), Nerve Growth Factor (NGF), Insulin, Retinoic Acid, Valproic Acid, BME, hydrocortisone, Glial cell line derived Neurotrophic Growth Factors (GNDF), Brain-Derived Neurotrophic Factors (BDNF), 5-Azacytidine, isobutyl methylxanthine (IBMX), and indomethacin among others either alone or in combination [29]. Cerebrospinal fluid (CSF) has also been implicated in culture condition to induce neuronal phenotype and function [30].&#xD;
&#xD;
Endodermal differentiation &#xD;
Likewise, MSCs of various sources have shown to differentiate into endodermal cell types such as hepatocytes, insulin producing beta cells and renal cells. Trans-differentiation into hepatocytes is a two-step process involving differentiation and maturation [31]. In the presence of EGF, bFGF and nicotinamide, MSCs differentiate into hepatocytes and exposure to oncostatin M, dexamethasone and ITS+ (Insulin, Transferrin, Selenium) premix will form mature hepatocytes which can be confirmed by expression of markers like albumin, &#x3B1;-fetoprotein and nuclear factor 4 &#x3B1; (HNF-4&#x3B1;). Insulin-producing &#x3B2;-cells can be successfully obtained by induction with growth factors, i.e. Acitvin A, sodium butyrate, taurine and nicotinamide. ?owever cells obtained other than mesodermal lineage are yet to be translated in clinical practice due to low efficiency of functional capacity [32]. Though the above-mentioned reports have been discussed about the isolation, differentiation and clinical usage of stem cells, research in this field needs more input, particularly with respect to differentiation and clinical application. Metallothionein, is a metal binding protein, expressed in most of the cells and tissues, have a major role in cell division, apoptosis and homeostasis of zinc and copper [33]. Numerous reports were about the role of metallothionein in cancer research [34]. Regarding stem cells, role of metallothionein in self renewal and differentiation needs to be identified.&#xD;
&#xD;
METALLOTHIONEIN&#xD;
Margoshes and Valley isolated metallothionein (MT) as a metal binding protein from equine renal cortex. Subsequently many types of MT have been discovered [33]. MT is known to present in all eukaryotes and in some prokaryotes, and&#xA0;possesses a high degree of homology [35]. Characteristic features of this protein include absence of aromatic amino acid and histidine; presence of highly conserved cysteine residues (cys-x-cys, cys-x-y-cys, or cys-x-cys-cys) in the sequence (where x and y are amino-acids other than cysteine), and the presence of high metal content and a low molecular weight 6-7kDa. It has a high affinity for group I b and II b metals and is found to be a major zinc binding intracellular protein. Zinc and cadmium binds with thiolate clusters and form tetrahedral geometry, where as copper forms trigonal geometry. MT protein contains two domains: N-terminal (beta domain) region with 9 cysteine residues, bind 3 divalent or 6 monovalent ions while the C-terminal (alpha domain) region with 11 cysteine residues, bind 4 divalent or 6 monovalent ions. The two domains are connected by a hinge region composed of a conserved lys-lys segment [36-44]. The MT genes encoding at least 11 MT-1 genes (MT-1A, 1B, 1E, 1F, 1G, 1H, 1I, 1J, 1K, 1L, 1X); MT2A, MT3 and MT4 are clustered in the q13 regions of human chromosome number 16 [45]. In mice only one copy of each of MT1, 2, 3, 4 are present within a 60kb region on chromosome 8 [46]. MT-I and II are almost expressed in all tissues, whereas MT-III is restricted to a central nervous system and male reproductive organs [47]. MT-IV is expressed only in stratified epithelial cells [47].&#xD;
&#xD;
EXPRESSION OF METALLOTHIONEIN &#xD;
The expression of metallothionein was found to be at constitutive levels in most cells but vary with cell type. The expression of different isoforms of MT was found to be regulated differently. The cis and trans-acting factors were involved in the regulation of MT. DNA methylation of cis-acting elements appears to play a role in the regulation and induction of MT genes in different cell types. The level of trans acting factor plays a role in the differential regulation and induction of MT genes in response to heavy metals. Low level, basal level as well as induced level of MT mRNA and protein is controlled by the cis-acting DNA elements that are located upstream in the 5&#x2019; region of the MT gene. The classical TATA boxes and the initiator regions (InR) form the promoter regions of MT-I and MT-II. They recruit the transcription factor II-D (TFIID) as a part of the pre-initiation complex. Apart from the promoter region, they contain a metal responsive element (MRE), which is also essential for all levels of MT induction. But the MREs act in association with a zinc-responsive transcription factor, termed as metal transcription factor-1 (MTF-1). Anti-oxidant Responsive Element (ARE) sequence is also present in adjacent to the MREs. Apart from these, a GC box (consensus sequence GGGGCGGGG), which respond to Sp1 transcription factor is also located in the promoter region of MT [48].&#xD;
&#xD;
FUNCTIONS OF METALLOTHIONEIN:&#xD;
Metallothionein, which is known to be induced by a variety of factors like heavy metals, glucocorticoids, cytokines, UV rays, hypoxic conditions, oxidative stress, cancer and, play different roles like- acting as metallochaperones to transport metal ions; in maintaining the concentrations of intracellular free zinc and copper ions; in acting as anti-oxidant, scavenging the free radicals; in the detoxification of heavy metals; and in the protection against various stress conditions. In short, metallothionein acts as a primary defense mechanism in the cells in order to protect against various harmful conditions [49].&#xD;
&#xD;
MT and CANCER &#xD;
Cellular localization of MT have been reported to be cytoplasmic in non-pathological tissues while in actively proliferating cells, MT localization varies with respect to cell cycle such as in nucleus in the S and G2 phase. This indicates that the altered MT level could correspond to abnormal cell division. Role of MT in proliferation, apoptosis, and invasion in cancer biology have been well studied using biopsy samples or cultured cancer cells. These reports indicate that increase in MT gene as well as protein expression, in actively proliferating normal cells, cancer cells of kidney, breast, lung, nasopharynx, salivary gland, ovary, testes, urinary bladder, leukemia and non-Hodgkin&amp;#39;s lymphoma. Decreased MT expression has been reported in human hepatic, prostate and thyroid cancers. Apart from this, reports indicate that MT expression can be used as a biomarker to identify the tumor stage [34] [Figure 1].&#xD;
&#xD;
&#xD;
&#xD;
Figure 1: General overview of Metallothioneins (MTs). Thionein can exist in two forms intracellularly as Apothionein (inactive, unbounded, Cytoplasmic) and Metallothionein (Active, bounded, Cytoplasmic and Nuclear). This transition from Apo- to Metallo- and vice versa is a reversible process. Upon activation, it exerts many physiological functions such as metal homeostasis, gene expression, cell cycle regulation etc.&#xD;
&#xD;
ENDODERMAL CARCINOMAS AND MT:&#xD;
Hypermethylation of MT promoter region has been reported in papillary thyroid tissue when compared to normal thyroid tissue, which is associated with down-regulation of MT in papillary and follicular thyroid carcinoma. When compared with healthy control tissue, laryngeal tissue biopsies show significantly increased expression of MT. Regarding lung cancer, strong MT expression was reported in nonsmall-cell squamous cell carcinoma and adenocarcinoma while a decrease in small-cell lung carcinoma, when compared with healthy control tissue. Reports indicate increased nuclear and cytoplasmic expression of MT in malignant and reactive cells in oral and pharyngeal squamous cell carcinoma. In esophagus carcinoma, MT negative tumors showed decreased lymph node metastases and distant organ metastases when compared with MT positive tumors. Increase in MT expression has been reported in gastric cancers and gastric dysplasia lesions but the levels are unrelated to tumor grade, stage or survival. Nuclei/cytoplasmic expression of MT have been reported in colorectal carcinomas. In hepatic cancer, MT expression is increased in surrounding healthy cells and reactive cells when compared with tumor cells. Regarding pancreatic carcinoma, studies reported that out of 75 patients, 59%showed negative expression and 41% were MT positive. In positive cases, MT expression was localized in cytoplasm and levels were correlated to metastasis and shorter survival. In bladder and ovarian cancer, increased MT staining was associated with tumor stage and grade, reduced survival. There is no association between MT expression and estrogen or progesterone receptor status in ovarian cancer [34] [Figure 2 and 3].&#xD;
&#xD;
MESODERMAL CARCINOMAS AND MT: &#xD;
Significant inverse correlation has been reported between MT expression and patient survival in renal cancer. In prostate cancer, increased MT level indicate an improved prognosis. Prostate cancer cells both in in vitro and in vivo show very low expression of MT levels when compared with healthy cells. In contrast, in case of uterine cancer increase in MT expression correlated with higher tumor grade, poor survival and increased tumor cell proliferative capacity [34] [Figure 2 and 3].&#xD;
&#xD;
ECTODERMAL CARCINOMAS AND MT: &#xD;
Number of studies reported that MT levels were associated with tumor grade, recurrence rate as well as poor survival in malignant invasive ductal breast carcinomas and MT expression is inversely correlated with estrogen and progesterone receptor status. Regarding skin cancer, mixed results were reported for MT expression. Weinlich et al., (2007) [50] reported that increased MT expression is correlated with poor survival while Suzuki et al., (2003) [51] reported that increased MT expression is protective in initial stages of skin&#xA0;carcinogenesis. In CNS, increase in MT expression is found to be therapeutically important as it is believed to protect non-malignant astrocytes and neurons from radiation-induced apoptosis, thereby increasing the survival [34] [Figure 2 and 3].&#xD;
&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
Figure 2: An overview of role of Metallothioneins in various neoplasms and malignancies.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xD;
&#xD;
Figure 3: Mechanism of action of metallothioneins (MTs) in physiology and pathology. MTs upon induction by various metals and oxidative stress, translocate from cytoplasm to the nucleus and starts transcription of anti-apoptotic and survival genes by donating the metals, zinc for example, to zinc-dependent transcription factors, thus inhibiting apoptosis. However, the same mechanism can lead to abnormal proliferation of cells even in the presence of oxidative stress thereby transforming cells into neoplastic or precancerous cells. MTs also reduce DNA damage caused by UV irradiation and augments DNA repair mechanisms. Conversely, it induces chemo- and radiotherapeutics resistance in the given cell giving them a niche to grow as malignant cell. MTs, on the other hand down regulates/ inhibit iNOS production thus protecting brain cortex degeneration. Also, MTs exert its protective role by inhibiting Cyclooxygenase which causes collagen induced arthritis. Nevertheless, hyper-methylation in the MT genes can diminish its protective activity and thus become a promotor or enhancer of malignant transformation of cells.&#xD;
&#xD;
REGENERATIVE EFFECTS OF MT: &#xD;
MT expression during cell cycle varies considerably. In G0 and G1, MT is localized primarily in cytoplasm, while in S and G2 phase, they are seen in nucleus and finally in G2/M, MT expression is cytoplasmic. Apart from this, reports indicate that nuclear expression of MT has a role in cell growth. Augmenting reports indicate that MT can activate transcription factors, metalloenzymes and cyclin D by which it exerts its function during regeneration and tissue repair. Anti-inflammatory cytokines, growth factors, neutrophils and their receptors like IL-10, TGF-&#xDF; and&#xA0; its receptor, FGF and its receptor, vascular endothelial growth factor (VEGF), NGF, NT-3-5, brain-derived neurotrophic factor (BDNF) and glial cell line derived neurotrophic factor (GDNF) were reported to be activated by MT [34].&#xD;
&#xD;
ANGIOGENESIS AND MT: &#xD;
Metastasis of cancer requires growth of new blood vessels, supply of oxygen and nutrients to tumor cells. The process of angiogenesis involves degradation of endothelial basement membrane, migration of endothelial cells to perivascular stroma and capillary sprouting. De novo synthesis and expression levels of number of growth factors like FGF, TGF-&#x3B2; and VEGF are known to be induced by MT. These factors are known to have a role in angiogenic process. Number of reports indicates relationship between MT and angiogenesis. In MT deficient mice, following the CNS injury, expression of angiogenic factors decreases when compared with that of normal. MT deficiency also inhibits proangiogenic effects of IL-6. In vivo expression of MT in endothelial cells at the site of angiogenesis and down-regulation of MT in those cells inhibit cell proliferation and migration; in vitro network formation as well in vivo angiogenesis, have been reported. Also reports indicate that MT down regulation arrest cells in G1 phase. Together these reports indicate that MT has a role in angiogenesis [34].&#xD;
&#xD;
Stem cells differentiation and Metallothionein: &#xD;
Dohi et al., (2005) [52] reported that MT-2 expression was increased at both mRNA and protein level during the course of osteoblastic differentiation of MSCs. They further reported that MT-1 and 2 mRNA levels were very high during 48h after addition of dexamethasone and it declined to basal level. The osteoblastic markers alkaline phosphatase (ALP) and osteocalcin mRNA levels increased steadily from day 1 to day 14. Addition of antisense oligonucleotides against MT 1and 2 mRNA during the first two days of differentiation in the presence of dexamethasone, decreased the ALP and osteocalcin level after day 14. They reported that early expression of MT mRNA and protein has a role towards osteoblastic differentiation of MSCs. MT as a zinc storage protein inside the cell, might play a role in differentiation process, by controlling the availability of zinc inside the cell&#xA0;MT may also directly involve in controlling the differentiation process by interacting with other transcription factors. In 2011, Lin et al., [53] reported that addition of zinc in the differentiation process of dental pulp stem cells towards odontoblasts, agumented the differentiation process. Though they have not confirmed the report by inhibiting MT expression, this report cannot be ruled out regarding the role of MT in differentiation process.&#xD;
&#xD;
DISCUSSION &#xD;
Plausible roles of MT in the self-renewal and differentiation of Stem Cell:&#xA0;MT, Cell cycle and Apoptosis: Reports indicate that MT localization varies during cell cyle and with cell stage. MT has been reported to be present in cytoplasm in non pathological tissues, whereas in actively proliferating tissues, MT localizes in nucleus. In S and G2 phase, nuclear localization of MT has been reported [34]. Stem cells in their self-renewal state can continuously divide. In such case, it will be noteworthy to study about the expression, localization as well as role of MT in stem cells. MT has been reported to have role in apoptosis. Particularly when cardiomyocytes from MT transgenic mice are exposed to doxorubicin, MT suppresses apoptosis via inhibition of cytochrome c release from mitochondria and caspase - 3 [54]. Reports also indicate that zinc directly regulates caspase -3 activities [55]. Tumor suppressor gene p53 needs zinc in order to maintain the active structure. Replacement of zinc with cadmium disrupts its function. Physical interactions between MT and p53 have been reported [56, 57]. Another mitogenic transcription factor NF-&#x3BA;B was also reported to be deregulated in cancer cells. Reports indicate that MT can interact with p50 subunit of RelA/NF-&#x3BA;B. This interaction stabilizes the DNA binding activity of NF-&#x3BA;B which in turn activates expression of several mitogenic genes [58]. Other reports indicate that MT can physically interact with the protein PKC&#xB5;, which has dual role in prostate cancer depending upon androgen status. PKC&#xB5; expression is repressed in androgen-independent prostate cancer, whereas it is enhanced in androgen-dependent prostate cancer. MT is said to directly interact with lysine residue (612) at ATP binding site of PKC&#xB5;, which is responsible for its enzymatic activity. This&#xA0;indicates that interaction of MT with PKC&#xB5; can decrease its enzymatic activity. This may be a reason for decreased activity of PKC&#xB5; in androgen-dependent prostate cancer. However it is noteworthy to find out the interaction between MT and androgen [59]. The above reports indicate that MT might have a role in stem cell renewal as well as differentiation. This area of research needs more attention to find out the role of MT in regulating differential genes involved in self-renewal as well as differentiation [Figure 4].&#xD;
&#xD;
&#xD;
&#xD;
CONCLUSION&#xD;
In a multicellular organism like humans, daily wear and tear process is a common phenomenon. To maintain the cell homeostasis, every organ harbors a small quiescent population of cells termed as stem cells which serve as a reservoir of organ-specific progenitor cells. These cells have the ability to both self-renew and give rise to differentiated cells and gain specialized function. Stem cells are reported to be present in various organs and tissues. Stem cell isolation, culture, differentiation and clinical application have been reported by various laboratories. Stem cells have the ability to self renew and differentiate. Research needs more input in understanding the balance between self-renewal and differentiation. Though various growth factors and chemicals have been used for maintaining the above-mentioned state, role of metallothionein has not been reported in detail. Metallothionein is a metal binding protein, which plays active role in cell division, cancer and apoptosis. This protein is reported to be activated by various agents like metals, growth factors, x-rays, etc. Most of the growth factors and chemicals used in differentiation of stem cells have the ability to activate metallothionein expression. Proteins like p53, NF-&#x3BA;B and PKC have been reported to interact with metallothionein. These proteins have role in cell cycle and apoptosis. Given the interaction of metallothionein and these proteins, role of metallothionein in stem cell renewal and differentiation cannot be ruled out. This area of research would be helpful in understanding the self-renewal and differentiation. By altering the expression of metallothionein, either self-renewal or differentiation can be improved, which would yield better population of cells for clinical translation.&#xD;
&#xD;
ACKNOWLEDGEMENT &#xD;
Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/ editors/publishers of all those articles, journals and books&#xA0;from where the literature for this article has been reviewed and discussed.&#xD;
&#xD;
Source of funding &#xD;
The author S.S is funded by Science and Engineering Research Board (SERB), India&#xD;
&#xD;
Compliance with Ethical Standards Conflict of Interest: The authors have no competing interests to declare.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1647</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1647</Fulltext></URLs><References>&#xD;
	Pittenger, MF., Mackay, A. M., Beck, S. C., Jaiswal, R. K., Douglas, R., Mosca, JD., Moorman, M. A., Simonetti, D. W., Craig S., Marshak, D. R.(1999). Multilineage potential of adult human mesenchymal stem cells. Science, 284: 143-147.&#xD;
	Jin, H.J., Bae, Y.K., Kim, M., et al. (2013). Comparative analysis of human mesenchymal stem cells from bone marrow, adipose tissue, and umbilical cord blood as sources of cell therapy. International journal of molecular sciences 14(9): 17986-18001.&#xD;
	Kwon, A., Kim, Y., Kim, M., et al. (2016). Tissue-specific Differentiation Potency of Mesenchymal Stromal Cells from Perinatal Tissues. Scientific reports 6:23544&#xD;
	Sunil, P. M., Manikandan, R., Muthu, M., Abraham, S. (2012). Stem cell therapy in oral and maxillofacial region: An overview. Journal of oral and maxillofacial pathology: &#xA0;16(1): 58-63.&#xD;
	da Silva Meirelles, L., Chagastelles, P.C., Nardi, N.B. (2006). Mesenchymal stem cells reside in virtually all post-natal organs and tissues. Journal of cell science 119(11): 2204-2213.&#xD;
	Shilpa, P. S., Kaul, R., Sultana, N., Bhat, S. (2013). Stem cells: Boon to dentistry and medicine. Dental Research Journal 10(2): 149-154.&#xD;
	de Sousa, E.B., Casado, P.L., Moura Neto, V., Duarte, M.E., Aquiar, D.P. (2014). Synovial fluid and synovial membrane mesenchymal stem cells: latest discoveries and therapeutic perspectives. Stem Cell Research and Therapy 5(5): 112. &#xD;
	Gholizadeh-Ghalehaziz, S., Farahzadi, R., Fathi, E., Pashaiasl, M. (2015). A Mini Overview of Isolation, Characterization and Application of Amniotic Fluid Stem Cells. International Journal of Stem Cells. 8(2): 115-120.&#xD;
	Ren, H., Sang, Y., Zhang, F., Liu, Z., Qi, N., Chen, Y. (2016). Comparative analysis of human mesenchymal stem cells from umbilical cord, dental pulp, and menstrual blood as sources for cell therapy. Stem Cells International. 2016(2016): 3516574.&#xD;
	Du, X., Yuan, Q., Zhou, Y., Bei, J. (2015). Endometrial Mesenchymal Stem Cells Isolated from Menstrual Blood by Adherence. Stem Cells International. 2016(2015): 3573846.&#xD;
	Schosserer, M., Reynoso, R., Wally, V., Jug, B., et al. (2015). Urine is a novel source of autologous mesenchymal stem cells for patients with epidermolysis bullosa. BMC Research Notes. 8: 767.&#xD;
	Takahashi, K., Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast culture by defined factors. Cell. 126: 663-676.&#xD;
	HimaBindu, A., Srilatha, B. (2011). Potency of various types of stem cells and their transplantation. Journal of Stem Cell Res Ther. 1:115.&#xD;
	Singh, A.P., Tandon, A., Mujoo, S., Mishra, R. (2012). Stem Cells &#x2013; Biological Solutions to Biological Problems: A Review. International Journal of Oral and Max. Path. 3.2: 37-42.&#xD;
	Dominici, M., Le Blanc, K., Mueller, I., et al. (2006). Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 8(4): 315-317.&#xD;
	Billing, A.M., Ben Hamidane, H., Dib, S.S., Cotton, R.J., et al. (2016). Comprehensive transcriptomic and proteomic characterization of human mesenchymal stem cells reveals source specific cellular markers. Scientific Reports. 6:21507.&#xD;
	Lee, R.H., Kim, B., Choi. I., et al., (2004). Characterization and expression analysis of mesenchymal stem cells from human bone marrow and adipose tissue. Cell Physiol Biochem. 14: 311-24.&#xD;
	Bianco, P., Robey, P.G., Simmons, P.J. (2008). Mesenchymal Stem Cells: revisiting history, concepts and assays. Cell Stem Cell. 2: 313-9.&#xD;
	Gronthos, S., Franklin, D.M., Leddy, A., et al (2001). Surface protein characterization of human adipose tissue derived stromal cells. J Cell Physiol. 189: 54-63&#xD;
	Zhu, B., Murthy, S.K. (2013). Stem cell separation technologies. Current Opinion in Chemical Engineering. 2(1): 3-7.&#xD;
	Plouffe, B.D., Murhty, S.K., Lewis, L.H. (2014). Fundamentals and application of magnetic particles in cell isolation and enrichment: a review. Reports on Progress in Physics. 78(1): 016601&#xD;
	Almalki, S.G., Agarwal, D.K. (2016). Key transcription factors in the differentiation of mesenchymal stem cells. Differentiation. 92(1-2): 41-51.&#xD;
	Ullah, I., Subbarao, R.B., Rho, G.J. (2015). Human mesenchymal stem cells-current trends and future prospective. Bioscience Reports. 35(2): e00191.&#xD;
	Perez-Campo, F.M., Riancho, J.A. (2015). Epigenetic mechanisms regulating mesenchymal stem cell differentiation. Curr Genomics. 16: 368-83.&#xD;
	Ding, S., Wu, T.Y., Brinker, A., et al.,(2003). Synthetic molecules that control stem cell fate. Proc Natl Acad Sci USA. 100: 7632-7.&#xD;
	Mathieu, P.S., Loboa, E.G. (2012). Cytoskeletal and focal adhesion influences on mesenchymal stem cell shape, mechanical properties, and differentiation down osteogenic, adipogenic and chondrogenic pathways. Tissue Eng Part B Rev. 18: 436-44.&#xD;
	Lee, T.J., Jang, J., Kang, S., et al. (2013). Mesenchymal stem cell-conditioned medium enhances osteogenic and chondrogenic differentiation of human embryonic stem cells and human induced pluripotent stem cells by mesodermal lineage induction. Tissue Engineering Part A. 20(7-8): 1306-1313.&#xD;
	Jeon, B.G., Si-Jeong, J., et al. (2015). Differentiation potential of mesenchymal stem cells isolated from human dental tissues into non-mesodermal lineage. Animal Cells and Systems 19(5): 321-331.&#xD;
	Jadalannagari, S., Berry, A.M., Hopkins, R.A., Bhasvar, D., Aljitawi, O.S. (2016). Potential mechanisms underlying ectodermal differentiation of Wharton&amp;#39;s jelly mesenchymal stem cells. Biochem. and Biophy. Res. Comm. 478(2): 831-837.&#xD;
	Otify, D.Y., Youssef, E.A., Nagy, N.B., Marei, M.K., Youssif, M.I. (2014). Transdifferentiation of Bone Marrow Mesenchymal Stem Cells into Neural Cells via Cerebrospinal Fluid. Biomedicine and Biotechnology. 2(4): 66-79.&#xD;
	Azandeh, S., Mohammad Gharravi, A., et al. (2016). Improvement of mesenchymal stem cell differentiation into the endoderm lineage by four step sequential method in biocompatible biomaterial. Bioimpacts. 6(1): 9-13.&#xD;
	Allahbakhshi, E., Hashemitabar, M., Shariati, M., et al. (2013).Differentiation of the definitive endoderm from Wharton&#x2019;s Jelly Mesenchymal Stem Cells (WJMSC). JOURNAL OF BIOLOGICAL RESEARCH-THESSALONIKI. 20: 217-227.&#xD;
	Kagi, J.H.R., Valee, B.L. (1961). Metallothionein: a cadmium and zinc containing protein from equine renal cortex II: Physiochemical properties. J. Biol Chem. 236, 2435-2442. &#xD;
	Pedersen, M.O., Larsen, A., Stoltenberg, M., Penkowa, M. (2000). The role of metallothionein in oncogenesis and cancer prognosis. Progress in Histochemistry and Cytochemistry. 44:29-64&#xD;
	Hamer, D. H.(1986). Metallothionein. Annu Rev Biochem. 55:913-951.&#xD;
	Kagi, J. H., Kojima, Y. (1987). Chemistry and biochemistry of metallothionein. Experientia Suppl .52:25-61.&#xD;
	Kagi, J. H., Himmelhoch, S. R., Whanger, P. D., Bethune, J. L., Vallee, B. L. (1974). Equine hepatic and renal metallothioneins. Purification, molecular weight, amino acid composition, and metal content. J Biol Chem. 249:3537-3542.&#xD;
	Romero-Isart, N., Vasak, M. (2002). Advances in the structure and chemistry of metallothioneins. J Inorg Biochem. 88:388-396.&#xD;
	Krezel, A., Maret, W. (2007) Dual nanomolar and picomolar Zn(II) binding properties of metallothionein. J Am Chem Soc. 129:10911-10921.&#xD;
	Nielson, K. B., Atkin, C. L., Winge, D. R. (1985). Distinct metal-binding configurations in metallothionein. J Biol Chem. 260:5342-5350.&#xD;
	Otvos, J. D., Armitage, I. M. (1979). Structural characterization of metallothionein by multinuclear NMR. Experientia Suppl. 34:249-257.&#xD;
	Otvos, J. D., Armitage, I. M. (1980). Structure of the metal clusters in rabbit liver metallothionein. Proc Natl Acad Sci U S A. 77:7094-7098.&#xD;
	Robbins, A. H., McRee, D. E., Williamson, M., Collett, S. A., Xuong, N. H., Furey, W. F., Wang, B. C., Stout, C. D. (1991). Refined crystal structure of Cd, Zn metallothionein at 2.0 A resolution. J Mol Biol. 221:1269-1293.&#xD;
	Cody, C. W., Huang, P. C. (1993). Metallothionein detoxification function is impaired by replacement of both conserved lysines with glutamines in the hinge between the two domains. Biochemistry. 32:5127-5131.&#xD;
	Karin, M., Eddy, R.L., Henry, W., et al., (1984). Human metallothionein genes are clustered on chromosome 16. Proc Natl Acad Sci USA. 81: 5494-98.&#xD;
	Cox, D.R., Palmitter, R.D. (1983). The metalloehionein &#x2013;I gene maps to mouse chromosome 8: implications for Human Menke&#x2019;s disease. Hum Genet. 64: 61-4.&#xD;
	Thirumoorthy, N., Shyam, A.S., Kumar, K.T.M., Senthilkumar M., et al., (2011). A review of metallothionein isoforms and their role in pathophysiology. World J of Surg Oncol. 9: 54.&#xD;
	Hag, F., Mahoney, M., Koropatnick, J. (2003). Signalling events for metallothionein induction. Mutation Research. 533(1-2): 211-216.&#xD;
	Kimura, T., Kambe, T. (2016). The functions of metallothionein and ZIP and ZnT transporters: An overview and perspective. Int J Mol Sci. 17: 336.&#xD;
	Weinlich, G., Zegler, B. (2007). Metallothionein overexpression, a highly significant prognostic factor in thin melanoma. Histopathology. 51:280-3.&#xD;
	Suzuki, S., Nishimura, N., Zhang, B., Nakatsuru, Y., et al., (2003). Metallothionein deficiency enhances skin carcinogenesis induced by 7,12-dimehtylbenz[a]anthracene and 12-O-tetradecanoylphorbol-13-acetate in metallothionein null mice. Carcinogenesis. 24: 1123-32.&#xD;
	Dohi, Y., Shimaoka, H., Ikeuchi, M., Ohgushi, H., Yonemasu, K., Minami, T. (2005). Role of metallothionein isoforms in bone formation processes in rat marrow mesenchymal stem cells in culture. Biological Trace Element Research. 104: 57-69.&#xD;
	Lin, C.Y., Lin, H.H., Tsai, M.H., Lin, S.P., Chen, M.H. (2011). Zinc chloride for odontogenesis of dental pulp stem cells via metallothionein up regulation. Journal of Endodontics. 37: 211-216.&#xD;
	Wang, G.W., Klein, J.B., Kang, Y.J. (2001). Metallothionein inhibits doxorubicin induced mitochondrial cytochrome c release and caspase -3 activation in cardiomyocytes. J Pharmacol Exp Ther. 298: 461-468.&#xD;
	Schrantz, N., Auffredou, M.T., Bourgeade, M.F., Besnault, L., Leca, G., Vazques, A. (2001). Zinc mediated regulation of caspase activity: dose-dependent inhibition or activation of caspase-3 in the human Burkitt lymphoma B cells (Ramos). Cell Death Differen. 8: 152-161.&#xD;
	Meplan, C., Richard, M-J., Hainaut, P. (2000). Metalloregulation of the tumor suppressor protein p53: zinc mediates the renaturation of p53 after exposure to metal chelators in vitro and in intact cells. Oncogene. 19: 5227 - 36.&#xD;
	Ostrakhovitch, E.A., Olsson, P-E., Jiang, S., Cherian, M.G. (2006). Interaction of metallothionein with tumor suppressor p53 protein. FEBS Lett.&#xA0; 580: 1235 - 8.&#xD;
	Abdel- Mageed, A.B., Agrawal, K.C. (1998). Activation of nuclear factor &#x3BA; B: potential role in the metallothionein-mediated mitogenic response. Cancer Res. 58: 2335 &#x2013; 8.&#xD;
	Rao, P.S., Jaggi, M., Smith, D.J., Hemstreet, G.P., Balaji, K.C. (2003). Metallothionein 2A interacts with the kinase domain of PKC &#x3BC; in prostate cancer. Biochem Biophys Res Com. 310:1032 - 8.&#xD;
&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>Prevalence of Oral Submucous Fibrosis Among Betel Nut Chewers Dental Patients of Patna&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>62</FirstPage><LastPage>65</LastPage><AuthorList><Author>Tanoj Kumar</Author><AuthorLanguage>English</AuthorLanguage><Author> Mobeen Khan</Author><AuthorLanguage>English</AuthorLanguage><Author> Chandra Prakash Gupta</Author><AuthorLanguage>English</AuthorLanguage><Author> Shah Faisal</Author><AuthorLanguage>English</AuthorLanguage><Author> Nazish Akhtar</Author><AuthorLanguage>English</AuthorLanguage><Author> Divyanshu Shrivastava</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Background: Oral Submucous Fibrosis (OSMF) is premalignant condition having high malignant transformation rate and increased risk of oral squamous cell carcinoma which itself accounts for 40% deaths due to malignancy across the world.&#xD;
Objective: To study the prevalence of OSMF among betel nut chewers in north Indian population.&#xD;
&#xD;
Methods: A total of 320 subjects consisting of 246 males and 74 females Dental patients of Patna were selected. The subjects were divided into two groups. The first group was control group consisting of 160 subjects including 123 males and 37 females who didn&amp;#39;t had the habit of betel nut chewing. Another group included betel nut chewers with same no of subjects as that of control group. All participants were screened for presence of OSMF by first 2 authors independently according to the WHO prescribed coloured atlas, clinical examination and history.&#xD;
&#xD;
Results: Prevalence of OSMF was 75% among betel nut chewers. Males were more affected (70%) than the females. The maximum no of cases reported were in the age group of 30-40 years.&#xD;
Conclusion: Betel nut chewing can be considered to be a harmful habit and necessary public health measures should be taken to eradicate this habit.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>OSMF, Betel nut chewers, Premalignant condition</Keywords><Fulltext>&#xD;
INTRODUCTION&#xD;
Oral submucous fibrosis (OSMF) is a premalignant disorder with a high malignant potential of 12-18%.It causes signifi&#xAD;cant morbidity. After getting transformation into squamous cell carcinoma (SCC), it leadsto mortality.Oral cancer accounts for up to 40% of total malignancies in Asia. Tobacco smoking and betel quid chewing con&#xAD;taining tobacco are considered to be the major risk factors for oral cancer, whereas betel quid without tobacco has been also reported to significantly increase the risk for oral cancer in some studies. OSMF found to cause oral cancer 19.1 times more likely than normal individuals.1&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
&#xD;
The initial clinicalpresentation of OSMF includes inflammation. It is followed by hypo&#xAD;vascularity and fibrosis observed as blanching of the oral mucosa characterized with a marble-like appearance. It may be localized, diffuse, or reticular.However, in some cases, small vesicles may develop that subsequently rupture and form erosions.2 In the later advanced stage of OSMF, a fibrotic band that reduces mouth opening is characteristic feature. It causes further problems in maintaining oral hygiene, proper speech, normal &#xA0;mas&#xAD;tication, and swallowing. Formation of fibrous bands in the lip give rise to thickening and rubbery appearance .Other clinical features of advanced OSMF include the absence of puffed-out appearance of cheeks which is observed usually when a patient blows a whistle. Fibrosis of tongue and mouth affect tongue movement and cause depapillation and blanching of mucosa.3&#xD;
&#xD;
OSMF is found to be associated with the chew&#xAD;ing of areca nut (betel nut). This habit is prevalent in South Asian populations but being recognized nowadays also in some parts of Europe and North America. &#xA0;The combination of areca nut and tobacco has led to a sharp increase in the frequency of OSMF.2Betel is found to contain areca nut (Areca catechu), fewfresh leaf of betel pepper (Piper betle), &#xA0;some spices, and little calcium hydroxide (lime). Chewing tobacco or guthka gained a lot of popularity, and betel chewers were found to use guthka quite frequently. However, guthka officially banned from the Indian market recently.4-5Despite this chewing tobacco-containing betel quid hasreported to become one of the most popular bad habits in South Asia.6 Betel is now found widely in the Western world also.OSMF subjects are usually younger and have reported shorter histories of chewing as compared to chewers without OSMF. &#xD;
&#xD;
The present study was conducted to evaluate the prevalence of OSMF among betel nut chewers in different age groups among north Indian population.&#xD;
&#xD;
METHODS AND MATERIALS&#xD;
A total of 320 subjects consisting of 246 males and 74 females Dental patients of Patna were selected for the study after getting their informed consent. The subjects were divided into two groups. The first group was control group consisting of 160 subjects including 123 males and 37 females who didn&#x2019;t had the habit of betel nut chewing. Another group included betel nut chewers with same no of subjects as that of control group.&#xD;
&#xD;
The subjects aged between 20 to 60 years were included in the study. Inclusion criteria for subjects being included in betel nut chewers group consisted of habit of chewing areca nut/pan/gutkha for more than3 year, with a frequency of more than 5 times per day.The subjectswith reduced &#xA0;mouth opening due to other reasons like odontogenic infections and Temporomandibular joint disorders and subjects having habit of tobacco smoking were excluded from the study.&#xD;
&#xD;
All participants were examined for presence of OSMF independently according to the WHO prescribed coloured atlas, clinical examination and history. The examiner was not blinded about the chewing habit of the study subject. In the OSMF patients, a detailed history was obtained including duration, information regarding type and frequency of the chewing habit in study subject.&#xD;
&#xD;
Presence of blanching and fibrous bands was observed for each subject. Interincisal distance was recorded between maxillary and mandibular central incisors with use of vernier calipers. An interincisal distance of &gt;30 mm was considered normal and </Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1648</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1648</Fulltext></URLs><References>1.Cox S. Oral cancer in Australia &#x2013; risk factors and distribution. Ann R Australas Coll Dent Surg. 2000;15:261&#x2013;263.&#xD;
&#xD;
2. Haider SM, Merchant AT, Fikree FF, Rahbar MH. Clinical and func&#xAD;tional staging of oral submucous fibrosis. Br J Oral Maxillofac Surg. 2000;38(1):12&#x2013;15.&#xD;
&#xD;
3.Chaudhry K. Is pan masala-containing tobacco carcinogenic? Natl Med J India. 1999;12(1):21&#x2013;27.&#xD;
&#xD;
4. Gupta PC, Sinor PN, Bhonsle RB, Pawar VS, Mehta HC. Oral submu&#xAD;cous fibrosis in India: a new epidemic? Natl Med J India. 1998;11(3): 113&#x2013;116.&#xD;
&#xD;
5. Roy R. Taxes make cigarette firms huff and puff. The Sunday Times of India, Mubai, 12 (17): February 3, 2002, p 1.&#xD;
&#xD;
6. Heck JE, Marcotte EL, Argos M, et al. Betel quid chewing in rural Bangladesh: prevalence, predictors and relationship to blood pressure. Int J Epidemiol. 2012;41(2):462&#x2013;471.&#xD;
&#xD;
7. Ranganathan K, Devi MU, Joshua E, Kirankumar K, Saraswati TR. Oral submucous fibrosis: a case control study in Chennai, South India. J Oral Pathol Med. 2004;33(5):274e277.&#xD;
&#xD;
8. Hazarey VK, Erlewad DM, Mundhe KA, Ughade SN. Oral submucous fibrosis: a study of 1000 cases from central India. J Oral Pathol Med. 2007;36(1):12e17&#xD;
&#xD;
9. Sirsat SM, Khanolkar VR. Submucous Fibrosis of the Palate and Pillars of the Fauces. Indian J Med Sci 1962;16:188-97.&#xD;
&#xD;
10. Wahi PN, Kapoor VL, Luthra UK, Srivastava MC. Submucous Fibrosis of the oral cavity: Studies on Epidemiology. Bull WHO 1966;35:793-9.&#xD;
&#xD;
11. Shah N, Sharma PP. Role of chewing and smoking habits in the etiology of oral submucous fibrosis: A case control study. J Oral Pathol Med 1998;27:475-9.&#xD;
&#xD;
12. Sirsat SM, Khanolkar VR. Sub mucous fibrosis of the palate in diet. Pre conditioned Wister rats: Induction by local painting of capsaicin-an optical and electron microscopic study. Arch Pathol 1960;70:171-9.&#xD;
&#xD;
13. Sinor PN, Gupta PC, Murti PR,&#xA0;et al&#xA0;. A case control study of oral submucous fibrosis with special reference to the etiologic role of areca nut. J Oral Pathol Med 1990;19:94-8.&#xD;
&#xD;
&#xA0;&#xD;
&#xD;
&#xA0;&#xD;
</References></Article></ArticleSet><ArticleSet><Article><Journal><PublisherName>Radiance Research Academy</PublisherName><JournalTitle>International Journal of Current Research and Review</JournalTitle><PISSN>2231-2196</PISSN><EISSN>0975-5241</EISSN><Volume>9</Volume><Issue>13</Issue><IssueLanguage>English</IssueLanguage><SpecialIssue>N</SpecialIssue><PubDate><Year>2017</Year><Month>July</Month><Day>3</Day></PubDate></Journal><ArticleType>Healthcare</ArticleType><ArticleTitle>A Study on Occurrence of Two Rarest Coccoidal Cyanobacteria from India&#xD;
</ArticleTitle><ArticleLanguage>English</ArticleLanguage><FirstPage>66</FirstPage><LastPage>68</LastPage><AuthorList><Author>Sudip Chatterjee</Author><AuthorLanguage>English</AuthorLanguage></AuthorList><Abstract>Two species of one of the rare form of Cyanobacteria viz. Chlorogloeafritschii and Chlorogloeamicrocystoides was reported. The report is very significant from the point of impact that these two species being reported for the first time from this part of the world and they were obtained from very unusual condition of occurrence. This investigation is an addition to the existing knowledge about the occurrence and diversity of cyanobacteria in the said region.&#xD;
</Abstract><AbstractLanguage>English</AbstractLanguage><Keywords>First report, Rarest Cyanobacteria, Chlogloea, Isolated and established, West Bengal, India</Keywords><Fulltext>INTRODUCTION &#xD;
The occurrence of two rare forms of coccoid cyanobacteria from this part of India is certainly an important addition to the existing knowledge about the available cyanobacterial diversity of the region. The cyanobacterial diversity has long been thought to be restricted within very few genera. The concept of eutrophication is also emerging as the region is heavily industrialized and only one or two types of species are abundantly obtained in almost every part of the concerned district. The reported alga belongs to the Chroococcales order which is believed to be one of the oldest and diversified forms surviving on earth. The Present taxon is represented by only 19 spp. Worldwide (Kom&#xE1;rek (1992). The finding is very interesting to the author in the context of it&amp;#39;s general occurrence is restricted to the saline habitats and sometime as lithophytes (particularly endo-lithophytes). In this present investigation the habitat is certainly different from that of usual occurrence.&#xD;
&#xD;
MATERIALS AND&#xA0; METHODS &#xD;
The specimens were collected from different locations of the Burdwan district from soil samples. Some materials were cultivated in culture and others were preserved in 5% formalin. For culture the specimens were inoculated in slants using medium [Modified BG-11 without N2 -source (Stanier et al. 1971)] solidified by using 3% agar. The pH of the medium was recorded 7.5, without using any buffer solution. The slants were then kept in the aseptic cultural condition for obtaining optimum growth, under the illumination of two standard PHILIPS tube lights (IS-2418) of 40-Watt capacity for 8 hrs: 4 hrs in normal shady condition: 12 hrs of dark intervals. Temperature was maintained 270 C throughout. The growth was observed under light microscope (Olympus GB model) after a regular interval of two weeks for the complete understanding of its life cycle pattern. Camera Lucida drawings were made from both nature and cultured specimens. Microphotography was done using Zeiss Microscope.&#xD;
&#xD;
RESULT AND DISCUSSION&#xD;
&#xD;
I. CHLOROGLOEA Wille 1900&#xD;
[Wille, N. (1900) - AlgologischeNotizen I-VI. Nyt.Magazin for Naturvidenskaberne 38(1): 1- 27; Geitler, L. 1932 -Cyanophyceae. In: Rabenhorst, L. (ed.) Kryptogamenflora von Deutschland, &#xD6;sterreich und der Schweiz. 14, p.306; Desikachary, T.V. 1959 - Cyanophyta. p.162; Starmach, K. 1966 -Cyanophyta - sinice [Cyanophyta - blue-green algae]. Flora slodkow.Polski 2. p.155; Castenholz, R.W., Ripka, R. and Herdman, M. 2001 - In: Boone, D.R. and Castenholz, R.W. (ed.), Bergey&#x2019;s Manualof Systematic Bacteriology.2nd ed., p.592; Kom&#xE0;rek, J. 2003 - 3. Coccoid and Colonial Cyanobacteria.In: Wehr, J.D. and Sheath, R.G. (ed.) Freshwater Algae of North America: Ecology and Classification. p.96; Kom&#xE0;rek, J. and Hauer, T. 2004: CyanoDB.cz - an On- line database of cyanobacterial genera. - Guiry, M.D. and Guiry, G.M. 2017. AlgaeBase.World - wide electronic publication, National University of Ireland, Galway. http://www.algaebase.org;]&#xD;
&#xD;
Description: &#xD;
Many spherical or ellipsoidal or polygonal cells loosely arranged to form a gelatinous mass. Sheath if present, very thin and watery. Cells are yellowish- green to dark blue - green in colour with granular or homogenous content.&#xD;
&#xD;
Taxonomic Position: Cyanophyceae, Chroococcales, Entophysalidaceae.&#xD;
&#xD;
Key to the species:&#xD;
&#xD;
1. Average diameter of individual cell is 1.68 &#x3BC;m&#x2026;&#x2026;&#x2026;&#x2026;&#x2026;&#x2026;&#x2026;..(2) C.microcystoides&#xD;
&#xD;
1. Average diameter of individual cell is 6 &#x3BC;m&#x2026;&#x2026;&#x2026;&#x2026;&#x2026;&#x2026;&#x2026;&#x2026;..............(1) C.fritschii&#xD;
&#xD;
1. Chlorogloeafritschii Mitra&#xD;
&#xD;
[Desikachary 1959, p.163, Pl. - 31, fig. - 1 - 16]&#xD;
&#xD;
&#xD;
&#xD;
Gelatinous, dull green thallus made up of many loosely arranged cells. Cells spherical to hemispherical in outline, margin of the cells are wavy, cells yellowish-green in colour with granular content, 3 &#x3BC;m - 5 &#x3BC;m in diameter. Some cells are 1.4 &#x3BC;m - 1.8 &#x3BC;m in diameter. Habitat - The sample was obtained as thin green film on the surface of water in a pond at Golapbag area [Sample No. SC - 02 (pH 7 and Temperature 31o C) dated 26/10/2002]; from Police line in a sewage canal near the market as isolated algal&#xD;
&#xD;
Taxonomic note: This taxon is presently considered as Chlorogloeopsisfritschii (A.K. Mitra) A.K. Mitra and D.C. Pandey 1967(Guiry and Guiry 2012).mass [Sample No. SC - 10 (pH 6.5 and Temperature 23o C) dated 28/11/2002] and from a sewage canal in almost similar state in Baburbag [Sample No. SC - 45 (pH 6.5 and Temperature 20o C) dated 12/12/2002]. Earlier reports from India: Allahabad (Mitra 1950, 1951); Cochin (Joseph and Sarma 2004). Taxonomic note: This taxon is presently considered as Chlorogloeopsisfritschii (A.K. Mitra) A.K. Mitra and D.C. Pandey 1967(Guiry and Guiry 2012).&#xD;
&#xD;
2. Chlorogloeamicrocystoides Geitler 1925&#xD;
&#xD;
[Geitler 1932, p.310, fig. - 155; Desikachary 1959, p.163, Pl. - 19, fig. - 8; Starmach 1966, p.155, fig. - 191; Whitton 2001, In John et al (ed.), p.39]&#xD;
&#xD;
&#xD;
&#xD;
Very small colonies of blue-green colour with watery sheath, cells irregularly arranged within the colony. Cells ellipsoidal to polygonal in outline. Cells 1.58 &#x3BC;m -1.70 &#x3BC;m broad and 3.2 &#x3BC;m &#x2013; 3.6 &#x3BC;m long, blue-green in colour. Habitat - Sample obtained from the undersurface of an irrigation canal as algal lump of at Gangpur [Sample No. SC - 62 (pH 7.5 and Temperature 20o C) dated 12/12/2002]. Earlier reports from India: Assam (Biswas 1936); Tuwa (Thomas and Gonzalves 1965d).&#xD;
&#xD;
DISCUSSION &#xD;
As evident from the above mentioned result part both the genera are very first report of it&amp;#39;s kind from the said region. The earlier reports are from different parts of India and also dated very long back. Thus workers, concerned with the diversity study of cyanobacteria will be immensely enriched with the obtained result. The knowledge about occurrence&#xA0;and diversity of the said group, in the said region is very limited till date. The present investigation thus will thus be first of its kind for the concerned region.&#xD;
&#xD;
CONCLUSION &#xD;
The obtained result and literature review by the author suggested that the place of investigation is environmentally very much conducive for the luxuriant growth of cyanobacteria. The chance of many rarest taxa occurring in the said region is very high. The author thus encouraged to explore the region further critically to unearth other taxa of the said group for contributing to the existing knowledge for the said group from the said region.&#xD;
&#xD;
ACKNOWLEDGMENTS &#xD;
Thanks are due to Dr. J.P. Keshri of Phycology section, Department of Botany, The University of Burdwan for constant support during the investigation and providing all kinds of research facilities to the author. The constant encouragement of Principal, Syamsundar College and all other associated staff and colleagues of the said college are duly acknowledged.The author acknowledges the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/ editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.&#xD;
</Fulltext><FulltextLanguage>English</FulltextLanguage><URLs><Abstract>http://ijcrr.com/abstract.php?article_id=1649</Abstract><Fulltext>http://ijcrr.com/article_html.php?did=1649</Fulltext></URLs><References>1. Biswas, K.(1930) Contribution to the knowledge of freshwater algae of Manipur, Assam. J. Bombay Nat. Hist. Soc. 34: 189 - 192.&#xD;
&#xD;
2. Desikachary T.V. 1959. Cyanophyta: Indian Council of Agricultural Research, New Delhi, 686 pp.&#xD;
&#xD;
3. Gonsalves, E. A. and Kamat, N. D. (1960) New species of Cyanophyceae from Mysore State. J. Bombay nat. Hist. Soc., 57, 2: 454 - 456.&#xD;
&#xD;
4. Guiry, M.D. and Guiry, G.M. (2012) AlgaeBase. World - wide electronic publication, National University of Ireland, Galway. http://www.algaebase.org&#xD;
&#xD;
5. Hind&#xE1;k F. 1977. Studies on the Chlorococcal algae/ Chlorophyceae:VEDA. Publishing House of the Slovak Academy of Sceence,&#xA0;Bratislava, 186 pp.&#xD;
&#xD;
6. Kom&#xE1;rek, J. and Anagnostides, K. 1986. Modern approach to the classification system of cyanophytes.2 .Chroococcales.Arch. Hydrobiol.Suppl. 73, Algological Studies 43: 157 - 226.&#xD;
&#xD;
7. Kom&#xE1;rek, J. (2003). Coccoid and colonial cyanobacteria. In: Freshwater Algae of North America. Ecology and Classification. (Wehr, J.D. and Sheath, R.G. Eds), pp. 59 - 116. Amsterdam Boston London New York Oxford Paris San Diego San Fransisco Singapore Sydney Tokyo: Academic Press.&#xD;
&#xD;
8. Kom&#xE1;rek J. and Hauer T. 2004. CyanoDB.cz - On - line database of cyanobacterial genera. - http://www.cyanodb.cz&#xD;
&#xD;
9. LukavskyJ,Cepak V. Komarek J. Kasparkova M. Takacova M. 1992. Catalog of Algal and Cyanobacterial Strains of Culture Collection of Autotrophic Organisms at Trebon. Archiv Fur Hydrobiologie, :59 - 112.&#xD;
&#xD;
10. Samad L.K. and Adhikary S.P. 2008.Diversity of Micro-algae and Cyanobacteria on Building Facades and Monuments in India. Algae 23(2): 91-114.&#xD;
&#xD;
11. Setchell, W.A. and Gardner, N.L. (1924). New marine algae from the Gulf of California.Proceeding of the California Academy of Science, Series 4 12: 695-949, 77 plates.&#xD;
&#xD;
12. Stanier R.Y., Kunisawa R., Mandel M. and Cohen-Bazire G., 1971.Purification and properties of unicellular blue-green algae (Order Chroococcales). Bacteriological Review 35: 171-205.&#xD;
</References></Article></ArticleSet></xml>
