International Journal of Current Research and Review
ISSN: 2231-2196 (Print)ISSN: 0975-5241 (Online)
logo
slider
slider
slider
slider
Bootstrap Slider

Indexed and Abstracted in: Crossref, CAS Abstracts, Publons, Google Scholar, Open J-Gate, ROAD, Indian Citation Index (ICI), ResearchGATE, Ulrich's Periodicals Directory, WorldCat (World's largest network of library content and services)

Search Articles

Track manuscript

Full Html

IJCRR - 7(5), March, 2015

Pages: 07-12

Print Article   Download XML  Download PDF

DETERMINATION OF HUMAN IMMUNODEFICIENCY VIRUS TYPE-1 AND ALLIED SUBTYPES IN SUDAN

Author: Mohammed A. Hammad, Karimeldin M.A. Salih, Mohammed A. Abdallah, Rashid A. Salih, Ahmed A. Mohammedani, Isam M. Elkhidir, Ayman A. Elshayeb

Category: Healthcare

Abstract:Introduction: Human Immunodeficiency Virus-1 (HIV-1) is the most common infection of an unresolved global disease that has had massive impact on human life since its emergence. Transmission of HIV-1 is still rapidly spreading despite identification over 33 years ago and an immense worldwide research effort to counter it. Objectives: The aim of this study is to determine the HIV-1genotype and subtypes that cause AIDS in Sudan. Methods: Samples were investigated and analyzed in three different laboratories; two in Sudan and the third one in Kenya, the Central Lab of Omdurman Military Hospital, Department of Microbiology, Virology Lab of Faculty of Medicine University of Khartoum and Kenya Medical Research Institute (KMERI) -Virus Research Center- Nairobi Kenya. Results: HIV-1 was detected by RT-PCR at the virology lab and the result revealed (188) samples (90.9 %) positive for HIV- 1 (12) samples (9.1%) were negative for HIV-1. Concerning HIV-1 subtypes or clades one hundred of EDTA samples were processed at Kenya Medical Research Institute (KMERI), Using hetero-duplex Mobility Assay Technique (HMA) for env gene. Three subtypes were detected: subtype (A) (46%), Subtype (C) (33%) and subtype (D) (21%). CD4 count was estimated before antiretroviral therapy and three month after treatment, it was found that 71% were responding and 29% were not. Conclusion: The study concluded that the detected HIV subtypes in Sudan were subtypes (A) (C) and (D). Most of the patients were responding to ARV.

Keywords: AIDS, Genotype, Heteroduplex, Kenya, Serotype, Sudan

Full Text:

INTRODUCTION

Acquired Immunodeficiency Syndrome (AIDS) was first recognized as a new and distinct clinical entity in 1981. The first cases were recognized become of unusual clustering of diseases such as kaposi sarcoma and pneumocystis carinii, and pneumonia in young homosexual men, [1]. Analysis of HIV-1 genes of virus strains from different geographical locales has revealed that HIV-I can be divided into two distinctive groups, M (major) and O (outlier) [2]. HIV-1 group M isolates can be further subdivided into at least 10 distinct genetic subtypes (A-J) [3]. According to recent report by UN estimate in 2008 people living with HIV/AIDS is about 33 million 66.7% found in Africa [1]. HIV is an RNA virus from Lentivirus of the Retroviridae family [4] prevalent in Sudan with a figure of 1.6% among adults [5]. The first case reported was in 1986 and since then WHO become partner in the program [6]. Clinical presentation of HIV may usually pass through four phases depending on the status of immunity primary, early, intermediate and advanced HIV infection [7]. The presentation is ranging from reasonable mild to general (fever, urti, myalgia, arthralgia, lymphadenopathy, weight loss). Skin manfestaion, neurological (encephalopathy, headache, neuropathy), gastrointestinal tract manifestation (vomiting, diarrhea pharyngitis, oral ulcers, fungal infection), or respiratory system(like cough, shortness of breathing) [7], where WHO classification of the disease is according to the presentation rather than the immunological status[8]. AIDS cases were reported in other populations including intravenous drug users and hemophiliacs [9]. Blood transfusion recipients, adults from central Africa and infants born to mothers who themselves had AIDS or were intravenous drug users [9]. A virus related to human T-cell leukemia virus (HTLV-1) and (HTLV-2) was in criminated as a causative agent but later on the causative agent of AIDS was characterized and termed Human Immunodefiency virus Type-1 (HIV-1 and HIV-2) [10]. Sudan is a large country with opened boarders, and due to its geographical location, it is surrounded by nine countries some of which have a high incidence of HIV/AIDS. In addition, uncontrolled migrations of refigures across the borders, drought, famine in some areas, civil wars and difficult economic situations, resulted in immigration and displacement of many people whether from local population or from these neighboring countries. HIV is an important public health problem that prevalent at internationally, and nationally, Regional. The incidence of HIV/AIDS is on increase in Sudan and neighboring countries. The area of HIV diagnosis, management and monitoring are very important. Appearance of Resistance to antiretroviral therapy is increasing. Studies in the area of antiretroviral therapy and HIV drugs resistance are very essential. Such studies are very few in Sudan and are very strategic in the managements of HIV/AIDS [11,12]. The strains of HIV-1 can be classified in to three groups the “Major” group (M), the outlier group (O) and the New group (N). These three groups may represent three separate introductions of simian immunodeficiency virus in to humans; each type is divided in to subtypes and Circulatory Recombinant Forms (CRFs). Group (O) appears to be restricted to west and central Africa and Group (N), discovered in 1998, in Cameron, is extremely rare. More than 90% of HIV-1 infection belong to HIV-1 group (M) and unless specified the rest of this page relate to HIV-1 group (M) only. Within group (M) there are known to be at least nine genetically distinct sub types or (clades) of HIV-1. These are subtypes A, B, C, D, F, G, H, J, and K. Occasionally, two viruses of different sub types can meet in the cell of an infected person and mix together their genetic materials to create a new hybrid virus caprices similar to sexual reproduction and some new strain do not survive for long, but those that infect more than one person are known as circulatory recombinant forms (CRFs) [13]. The CRFs/A/B is a mixture of sub types A &B. The classification of HIV strain into subtypes and CRFs is a complex issue and the definitions are subject to some Subtypes into division of A1, A2, A3, F1 and F2 instead of A & F. Globally speaking, subtype A is the principal HIV-1 subtype found in Central and North African countries, sub type B is predominant in USA, Europe, Australia, Thailand and Brazil; subtype C is prevalent in south Africa, Ethiopia and India; CRFO_AE is common in south Africa. Information on HIV subtypes appears to divers in Iran, were HIV-1 subtypes A&B and has been reported among respectively intravenous by drug users and hemophiliac [14, 15].

MATERIALS AND METHODS

This cross-sectional study of HIV-1 was held to determine the seropositive patients from different areas of Sudan. Systematic random sampling were done by collecting blood, from South, North, West, East and Central Sudan. Forty samples were collected from 200 investigated patient’s attending different clinics and hospitals in every area during two years of study period. The sample was a venous blood, collected in a plain and EDTA vaccutainer containers, from those suspected patient’s positive for HIV-1. From those confirmed HIV-1 positive patient, 100 EDTA blood sample were chosen for the purpose of HIV-1 sub typing, the sub typing methodology was determined in Kenya Medical Research Institute (KMRI), Virus Research Center at the HIV Laboratory. Many techniques have been used to define subtypes of HIV-1 in Sudan, these include; serological test by ELISA, CD4 count by FACS, Heteroduplex mobility assay (HMA) and subtype classification by polymerase chain reaction (RT-PCR). After processing the sample for sub typing, the amplified samples were run on an agarose gel 2% with ethiduium bromide for staining, and visualized .under UV light to confirm HIV-1. Amplicon was used to detect the subtype by specific subtype primer. The subtypes that detected by specific subtype for the universal groups M, N, and O; the Unipol5 for forward and Unipol6 for reverse direction (5’TGGGTACCAGCACA CAAAGGAATAGGAGGAA A3’and5’CCACAGCTGATCTCTGGCCTTCTCTGTAATAGA CC- 3’). For nesting PCR Universal for groups M, N, and O, the Unipol1 for forward and Unipol2 for reverse direction (5’-CCCCTATTCCTTCCCCTTCTTTTAAAA-3’ and 5’-CCCCTATTCCTTCCC CTTCTTTTAAAA-3’) [16], were confirmed by Heteroduplex Mobility Assay (HMA). After determining the HIV-1 subtypes, the patient given a dose of antiretroviral drugs which was Triomue (lamivudine, stavudine and Nevirapine) and after three months of treatment CD4 count was estimated.
 

RESULTS

Determination of HIV- 1 genotype and subtypes is a key role in facilitating the treatment, trails of vaccination, and confirming the results of diagnosis. The Sudan, according to its geographical location is surrounded by countries with high HIV prevalence.

The Geographical distribution of the patients was, as follows: 75 patients from South of Sudan (37.5 % ) 55 patients from the Center (27.5%) 44 patients from the East (22.5%) 22 patient from the West (11.5%) and 4 patients from the North (2.0%)

One hundred – eighty eight (90,9%) were found to be HIV-1 positive samples ,twelve (9,1 %) were negative (-ve), pro-viral DNA in the DBS was amplified by nested PCR, and a 389-nucleotide segment of the C2-V3 env gene region was sequenced.

Blood samples were analyzed on a Partect Automatic Machine to estimate CD¬4 count (FACS). The EDTA blood samples were divided in to two parts, one for the purpose of CD4 count & the other for subtyping after extraction of provirus from peripheral mononuclear cells (PMNCs).

After processing the sample for subtyping, the amplified samples were run on an agarose gel 2% with ethidium bromide for staining, and visualized .under UV light to confirm HIV-1. Amplicon was used to detect the subtype by specific subtype primer.

The distribution of HIV-1 subtypes according to the different areas was; in North Sudan subtypes (A) n=1 (1.0%), subtype (C) n=1 (1%). In South Sudan subtype (A) n=15 (15%), subtype (C) n=10 (10%) and n=13 (13%) for subtype (D) .In East Sudan subtype (A) n=8 (8%), subtype (C) n=9 (9%) and subtype (D) n=3 (3%). In West Sudan subtype (A) n=3 (3%) subtype (C) n=7 (7%) and subtype (D) n=2 (2%).In Center Sudan subtype (A) n=19 (19%), subtypes (C) n=6 (6%) and subtype (D) was n=3 (3%).

DISCUSSION

Two hundred units of seropositive HIV Patients were tested by ELISA as reactive units then by using (RT-PCR) to detect HIV-1. For the patients’ sex, 186 (84%) were male and 32 (16%) were female which is in agreement with HIV male to female ratio in Yemen that were 4:1 male to female [17,18], 88 (90.9%) were HIV-1 positive. The Geographical distribution of the HIV-1 in Sudan is closely related to the distribution of variants in neighboring countries [19]. Consequently, patients from South of Su-dan before separation were n=75 (37.5 %), from Center Sudan n=55 (27.5%), from East Sudan n=44(22.5%), from West Sudan n=22 (11.5%) and from North Sudan (2.0%). The high prevalence estimated rate of HIV was found in South Sudan, and this was related to the geographical location of being near the high prevalence African countries [20]. However, this finding is disagreed with other authority where type A is the subtype that is common in west Africa but agree with them regarding subgroup (C) and (D) which usually found in central and east Africa(Sudan) [21,22]. However, to have subtype (A) dominant in Sudan is not strange since a good number of western Africa citizens migrate to Sudan throughout the last century to pilgrim. Determination of HIV-1 genotype and subtype is the key tools in determine the treatment, since a lot of gene mutation to the virus are reported [23]. Several techniques have been used to determine subtypes of HIV-1: The serological test by ELISA techniques, the CD4 count by FACS, the Heteroduplex Mobility Assay (HMA) and subtype classification by polymerase chain reaction (RT-PCR).This assist the indication of the high specificity and sensitivity for HIV-1 subtypes. Compared with molecular diagnosis technique (RT-PCR) which was the golden standard (figure 2), the use of serologically defined subtype was mainly confined to subtype B infection among whites, as serotyping has been shown to be of good specificity for differentiating subtype B from non-B infections in populations predominantly infected with B subtype [24]. The result for HIV-1 sub typing were n=46 (46%) subtypes (A), n=33 (33%) subtype (C) and n=21 (21%) subtype (D), (figure 3). However, some studies suggest that the CD4 count is a better predictor of disease progression than is plasma HIV-1 RNA in patients with very low CD4 (counts >50 cells/mm3 ) [25]. The Heteroduplex mobility assay (HMA) and multiregion hybridization assay (MHA) offered more affordable option for simple and rapid classification of HIV-1 subtypes in Sudan. However, due to cross-reactivity across subtypes, this method could not define specific sequence differences between isolates of the same or different HIV-1 subgroup (M). Therefore, the protocol was developed in combination with the (RT-PCR) as following; for subtype (A) by (HMA) and for subtype classification by polymerase chain reaction (PCR). The sequence analyses of envelope genes, using geographically diverse subtype reference sequences as well as envelope sequences of known subtype from Sudanese patients’ genotyping. Because the RT-PCR genotyping system proved to be highly successful for the amplification of local strains with positive results [26], for the 100 cases a final algorithm of incorporating serology and genotypic subtype HIV-1 subtype was resulted as following; HIV-1 group (M) subtype (A) n=46 (46%), HIV-1 group (M) subtype (C) n=33 (33%) and HIV-1 group (M) subtype (D) n=21 patient (21%). The distribution of HIV-1 subtypes according to the different areas (fig 5) was agreed with local study of detecting HIV-1 subtypes in Sudan which were subtype (C) (30%) and subtype (D) (50%) [21], subtype (C) is similar to our result, but we were disagreed with that in the following that the commonest subtype we were detected was subtype (A). The transmission and distribution of HIV- 1 subtypes is common and recognized as geographical distribution in the Democratic Republic of Congo which is closely related to the distribution of variants in neighboring countries the dominant strains are A, C and D. this would explain the difference in prevalence between the neighbor boarders [27]. In Sudan, subtype D is the most common 20. However, its introduction here might have been from two fronts; from Central Africa and also from Uganda or Kenya where this subtype is prevalent the three subtypes detected, A, C, and D was shared with Kenya, Uganda and Ethiopia, and these countries became the main source of infection to Sudan [26, 27, 28]. Altlas et al [29] stated that; the HIV patients of African origin showed that 77% of them were responded to ARV triple therapy). The distribution of HIV-1 subtypes B9 and E in this study population is in line with several other studies into the molecular epidemiology of HIV-1 in Thailand.

CONCLUSION

Lastly we conclude that the detected HIV subtypes in Sudan were subtypes (A) (C) and (D). The high prevalence of HIV-1 infection in neighbor countries affected the citizens of Sudan’s Border States with a significant impact of refugees’ mobility across the country. The study showed that there was a significant association between CD4 count and anti-retroviral therapy (ARV) the commonest subtypes that responding to dray were subtypes that responding to dray were subtype (A) and (D) the tubercles patients in subtype (C) treated with rifampicin were not responding to (ARVs).

ACKNOWLEDGMENT

Authors would like to acknowledge with gratitude the assistance that they received from the staff of the Central Lab of Omdurman Military Hospital (Sudan), Virology Lab of Faculty of Medicine University of Khartoum (Sudan) and Kenya Medical Research Institute (Kenya). Authors would also like to extend their gratitude to the teaching staff and technicians of Karary University (Sudan). Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors / editors / publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.

Informed Consent: This work is approved by the ethical committee of Medical Laboratory Science college and under the responsibility of the faculty board members.

Source of Funding: This work was partially supported by the National Treasury for Promoting Medical Service (NTPMS) and United Nation AIDS (UNAIDS) in Sudan and self-finance from the authors.

Conflict of interest: Since AIDS is a global disaster, the authors had decided to evaluate the disease situation in Sudan by using advanced protocols, techniques and analysis. All the authors who had participated in this work performed high calibrations in their contribution for establishing a biomonitoring system for HIV-1.

References:

1. UNAIDS, AIDS. Epidemic update: June 2008. UNAIDS: Geneva; 2008. http://www.unaids.org/Epi2008/doc/report_pdf.html

2. Charneau P, Borman A, Quillent C, et al. Isolation and envelope sequence of a highly divergent HIV-1 isolate: definition of a new HIV-I group. Virology 1994; (2): 59 247-253.

3. Fauci AS, Lane HC. Human immunodeficiency virus disease: AIDS and related disorders. Harrison’s Principles of Internal Medicine 16th Edition. New York, McGraw-Hill Medical Publications Division 2005.

4. UNGASS HIV/AIDS in Northern Sudan. UNGASS Report January 2008. World Health Organization, WHO report 2014.

5. Graeme JS, Irvine SS, Scott M, Kelleher AD, et al. Strategies of care in managing HIV. In Managing HIV. Sydney: Australasian Medical Publishing Company Limited 1997.

6. World Health Organization, WHO Case Definitions of HIV for Surveillance and Revised Clinical Staging and Immunological Classification of HIV-related disease in Adults and Children, August 7, 2006.

7. UNAIDS. Epidemiological Fact Sheets on HIV/AIDS and Sexually Transmitted Infections: Yemen. Geneva: UNAIDS; 2004a [Accessed 12 May 2006]. Online at: http://data.unaids.org/Publications/FactSheets01/yemen_EN.pdf.

8. Louise Lambert, M. Ed., D, HIV and development challenges in Yemen: which grows fastest? Oxford journal. 2007; volume22,issue 1p60-62.

9. WHO-UNAIDS Network for HIV isolation and characterization, Hemelaar J, Gouwsb E, Ghysb DP: Global trends in molecular epidemiology of HIV-1 during 2000–2007. AIDS 2011; (25): 679–689.

10. Lihana WR, Ssemwanga D, Abimiku A, Ndimbi A: Update on HIV-1 diversity in Africa: A decade in review. AIDS Rev 2012; 14:83–100.

11. Philippe D and Charles B. The HIV/AIDS Epidemic in SubSaharan Africa in a Historical Perspective Philippe Denis and Charles Becker (eds) Online edition, October 2006; pp. 35-54.

12. Osmanov S, Pattou C, Walker N, et al: WHO-UNAIDS Network for HIV Isolation and Characterization: Estimated global distribution and regional spread of HIV-1 genetic subtypes in the year 2000. J Acquir Immune Defic Syndr 2002; 29:184-190.

13. Geretti AM: HIV-1 subtypes: epidemiology and significance for HIV management. Curr Opin Infect Dis 2006; 19(1):1- 7.

14. Khamadi S., Ocheing W., Raphael C., et al, HIV Type 1 Subtypes in Circulation in Northern Kenya. AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 21, Number 9, 2005, pp. 810–814.

15. Bobkov AF, Kazennova EV, Selimova LM et al. “Temporal trends in the HIV-1 epidemic in Russia: predominance of subtype A”. J. Med. Virol. 2004;74 (2): 191–6. doi:10.1002/ jmv.20177. PMID 15332265.

16. Goudsmit, Jaap. Viral Sex; The Nature of AIDS. Oxford University Press. New York, New York, 1997. Pg. 51-58. Retrieved May 25, 2008.

17. Robertson DL, Hahn BH, Sharp PM. “Recombination in AIDS viruses”. J. Mol. Evol. 1995,40 (3): 249–59. doi:10.1007/ BF00163230. PMID 7723052.

18. UNAIDS and Government of South Sudan. Global AIDS response report, 2001; (2): 44- 46.

19. U.S. Department of Health and Human Services’ Guidelines for the Use of Antiretroviral Agents in HIV-1-Infected Adults and Adolescents (available at http://aidsinfo.nih. gov/guidelines).

20. Hierholzer M, Graham RR, ElKhidir I, et al. HIV Type 1 Strains from East and West Africa are intermixed in Sudan. AIDS Res Hum Retroviruses. 2002; 18 (15): 1163-6.

21. Centers for Disease Control and Prevention. Vital signs: HIV prevention through care and treatment—United States. MMWR Morb Mortal Wkly Rep. 2011; 60(47):1618- 1623.Availableat http://www.ncbi.nlm.nih.gov/pubmed/22129997.

22. Cozzi Lepri A, Katzenstein TL, Ullum H, et al. The relative prognostic value of plasma HIV RNA levels and CD4 lymphocyte counts in advanced HIV infection. AIDS. 1998;12:1639-43.

23. Kim S, Els D, Nancy D et al. A sensitive in-house RT-PCR genotyping system for combined detection of plasma HIV-1 and assessment of drug resistance. Journal of Virological Methods 133. 2006; 137–145.

24. Vidal N, Mulanga C, EdidiBazepeo S, et al. Distribution of HIV-1 Variants in the Democratic Republic of Congo Suggests Increase of Subtype C in Kinshasa Between 1997 and 2002. J AIDS. 2005; 40 (4): 456-62.

25. Gardner EM, McLees MP, Steiner JF, et al. The spectrum of engagement in HIV care and its relevance to test-and-treat strategies for prevention of HIV infection. Clin Infect Dis. 2011;52(6):793-800. Available at http://www.ncbi.nlm. nih.gov/pubmed/21367734.

26. Janssens W, Heyndrickx L, Fransen K, et al: Genetic variability of HIV type 1 in Kenya. AIDS Res Hum Retroviruses 1994;10:1577±1579.

27. Poss M, Gosink J, Thomas E, et al: Phylogenetic evaluation of Kenyan HIV type 1 isolates. AIDS Res Hum Retroviruses 1997;13: 493±499.

28. Zachar V, Goustin AS, Zacharova V, et al: Genetic polymorphism of envelope V3 region of HIV type 1 subtypes A, C, and D from Nairobi, Kenya. AIDS Res Hum Retroviruses 1996;12:75±78.

29. Ann A, Fredrik G, Anna Li, et al. Impact of HIV type1 genetic subtype on the outcome of antiretroviral therapy.AIDS research and human retrovirus march 2005;21(3) 227.

Announcements

Dr. Pramod Kumar Manjhi joined Editor-in-Chief since July 2021 onwards

COPE guidelines for Reviewers

SCOPUS indexing: 2014, 2019 to 2021


Awards, Research and Publication incentive Schemes by IJCRR

Best Article Award: 

One article from every issue is selected for the ‘Best Article Award’. Authors of selected ‘Best Article’ are rewarded with a certificate. IJCRR Editorial Board members select one ‘Best Article’ from the published issue based on originality, novelty, social usefulness of the work. The corresponding author of selected ‘Best Article Award’ is communicated and information of award is displayed on IJCRR’s website. Drop a mail to editor@ijcrr.com for more details.

Women Researcher Award:

This award is instituted to encourage women researchers to publish her work in IJCRR. Women researcher, who intends to publish her research work in IJCRR as the first author is eligible to apply for this award. Editorial Board members decide on the selection of women researchers based on the originality, novelty, and social contribution of the research work. The corresponding author of the selected manuscript is communicated and information is displayed on IJCRR’s website. Under this award selected women, the author is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.

Emerging Researcher Award:

‘Emerging Researcher Award’ is instituted to encourage student researchers to publish their work in IJCRR. Student researchers, who intend to publish their research or review work in IJCRR as the first author are eligible to apply for this award. Editorial Board members decide on the selection of student researchers for the said award based on originality, novelty, and social applicability of the research work. Under this award selected student researcher is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.


Best Article Award

A study by Dorothy Ebere Adimora et al. entitled \"Remediation for Effects of Domestic Violence on Psychological well-being, Depression and Suicide among Women During COVID-19 Pandemic: A Cross-cultural Study of Nigeria and Spain\" is awarded Best Article of Vol 14 issue 23
A study by Muhas C. et al. entitled \"Study on Knowledge & Awareness About Pharmacovigilance Among Pharmacists in South India\" is awarded Best article for Vol 14 issue 22
A study by Saurabh Suvidha entitled \"A Case of Mucoid Degeneration of Uterine Fibroid with Hydrosalphinx and Ovarian Cyst\" is awarded Best article of Vol 14 issue 21
A study by Alice Alice entitled \"Strengthening of Human Milk Banking across South Asian Countries: A Next Step Forward\" is awarded Best article of Vol 14 issue 20
A study by Sathyanarayanan AR et al. entitled \"The on-task Attention of Individuals with Autism Spectrum Disorder-An Eye Tracker Study Using Auticare\" is awarded Best article of Vol 14 issue 19
A study by Gupta P. et al. entitled \"A Short Review on \"A Novel Approach in Fast Dissolving Film & their Evaluation Studies\" is awarded Best Article of Vol 14 issue 18.
A study by Shafaque M. et al. entitled \"A Case-Control Study Performed in Karachi on Inflammatory Markers by Ciprofloxacin and CoAmoxicillin in Patients with Chronic Suppurative Otitis Media\" is awarded Best Article of Vol 14 issue 17
A study by Ali Nawaz et al. entitled \"A Comparative Study of Tubeless versus Standard Percutaneous Nephrolithotomy (PCNL) \? A Randomized Controlled Study\" is awarded Best Article for Vol 14 issue 16.
A study by Singh R. et al. entitled \"A Prospective Study to Find the Association of Astigmatism in Patients of Vernal Keratoconjunctivitis (VKC) in a Tertiary Health Care Centre in India (Vindhya Region MP)\" is awarded Best Article for Vol 14 issue 15
A Study by Humaira Tahir et al. entitled "Comparison of First Analgesic Demand after Major Surgeries of Obstetrics and Gynecology between Pre-Emptive Versus Intra-Operative Groups by Using Intravenous Paracetamol: A Cross-Sectional Study" is awarded Best Article for Vol 14 issue 14
A Study by Monica K. entitled "Risk Predictors for Lymphoma Development in Sjogren Syndrome - A Systematic Review" is awarded Best Article for Vol 14 issue 13
A Study by Mokhtar M Sh et al. entitled "Prevalence of Hospital Mortality of Critically Ill Elderly Patients" is awarded Best Article for Vol 14 issue 12
A Study by Vidya S. Bhat et al. entitled "Effect of an Indigenous Cleanser on the Microbial Biofilm on Acrylic Denture Base - A Pilot Study" is awarded Best Article for Vol 14 issue 11
A Study by Pandya S. et al. entitled "Acute and 28-Day Repeated Dose Subacute Toxicological Evaluation of Coroprotect Tablet in Rodents" is awarded Best Article for Vol 14 issue 10
A Study by Muhammad Zaki et al. entitled "Effect of Hemoglobin Level on the Severity of Acute Bronchiolitis in Children: A Case-Control Study" is awarded Best Article for Vol 14 issue 09
A Study by Vinita S & Ayushi S entitled "Role of Colour Doppler and Transvaginal Sonography for diagnosis of endometrial pathology in women presenting with Abnormal Uterine Bleeding" is awarded Best Article for Vol 14 issue 08
A Study by Prabhu A et al. entitled "Awareness of Common Eye Conditions among the ASHA (Accredited Social Health Activist) Workers in the Rural Communities of Udupi District- A Pilot Study" is awarded Best Article for Vol 14 issue 07
A Study by Divya MP et al. entitled "Non-Echoplanar Diffusion-Weighted Imaging and 3D Fiesta Magnetic Resonance Imaging Sequences with High Resolution Computed Tomography Temporal Bone in Assessment and Predicting the Outcome of Chronic Suppurative Otitis Media with Cholesteatoma" is awarded Best Article for Vol 14 issue 06
A Study by Zahoor Illahi Soomro et al. entitled "Functional Outcomes of Fracture Distal Radius after Fixation with Two Different Plates: A Retrospective Comparative Study" is awarded Best Article for Vol 14 issue 05
A Study by Ajai KG & Athira KN entitled "Patients’ Gratification Towards Service Delivery Among Government Hospitals with Particular Orientation Towards Primary Health Centres" is awarded Best Article for Vol 14 issue 04
A Study by Mbungu Mulaila AP et al. entitled "Ovarian Pregnancy in Kindu City, D.R. Congo - A Case Report" is awarded Best Article for Vol 14 issue 03
A Study by Maryam MJ et al. entitled "Evaluation Serum Chemerin and Visfatin Levels with Rheumatoid Arthritis: Possible Diagnostic Biomarkers" is awarded Best Article for Vol 14 issue 02
A Study by Shanthan KR et al. entitled "Comparison of Ultrasound Guided Versus Nerve Stimulator Guided Technique of Supraclavicular Brachial Plexus Block in Patients Undergoing Upper Limb Surgeries" is awarded Best Article for Vol 14 issue 01
A Study by Amol Sanap et al. entitled "The Outcome of Coxofemoral Bypass Using Cemented Bipolar Hemiarthroplasty in the Treatment of Unstable Intertrochanteric Fracture of Femur in a Rural Setup" is awarded Best Article Award of Vol 13 issue 24
A Study by Manoj KP et al. entitled "A Randomized Comparative Clinical Trial to Know the Efficacy of Ultrasound-Guided Transversus Abdominis Plane Block Against Multimodal Analgesia for Postoperative Analgesia Following Caesarean Section" is awarded Best Article Award of Vol 13 issue 23
A Study by Karimova II et al. entitled "Changes in the Activity of Intestinal Carbohydrases in Alloxan-Induced Diabetic Rats and Their Correction with Prenalon" is awarded Best Article of Vol 13 issue 22
A Study by Ashish B Roge et al. entitled "Development, Validation of RP-HPLC Method and GC MS Analysis of Desloratadine HCL and It’s Degradation Products" is awarded Best Article of Vol 13 issue 21
A Study by Isha Gaurav et al. entitled "Association of ABO Blood Group with Oral Cancer and Precancer – A Case-control Study" is awarded Best Article for Vol 13 issue 20
A Study by Amr Y. Zakaria et al. entitled "Single Nucleotide Polymorphisms of ATP-Binding Cassette Gene(ABCC3 rs4793665) affect High Dose Methotrexate-Induced Nephrotoxicity in Children with Osteosarcoma" is awarded Best Article for Vol 13 issue 19
A Study by Kholis Ernawati et al. entitled "The Utilization of Mobile-Based Information Technology in the Management of Dengue Fever in the Community Year 2019-2020: Systematic Review" is awarded Best Article for Vol 13 issue 18
A Study by Bhat Asifa et al. entitled "Efficacy of Modified Carbapenem Inactivation Method for Carbapenemase Detection and Comparative Evaluation with Polymerase Chain Reaction for the Identification of Carbapenemase Producing Klebsiella pneumonia Isolates" is awarded Best Article for Vol 13 issue 17
A Study by Gupta R. et al. entitled "A Clinical Study of Paediatric Tracheostomy: Our Experience in a Tertiary Care Hospital in North India" is awarded Best Article for Vol 13 issue 16
A Study by Chandran Anand et al. entitled "A Prospective Study on Assessment of Quality of Life of Patients Receiving Sorafenib for Hepatocellular Carcinoma" is awarded Best article for Vol 13 issue 15
A Study by Rosa PS et al. entitled "Emotional State Due to the Covid – 19 Pandemic in People Residing in a Vulnerable Area in North Lima" is awarded Best Article for Vol 13 issue 14
A Study by Suvarna Sunder J et al. entitled "Endodontic Revascularization of Necrotic Permanent Anterior Tooth with Platelet Rich Fibrin, Platelet Rich Plasma, and Blood Clot - A Comparative Study" is awarded Best Article for Vol 13 issue 13
A Study by Mona Isam Eldin Osman et al. entitled "Psychological Impact and Risk Factors of Sexual Abuse on Sudanese Children in Khartoum State" is awarded Best Article for Vol 13 issue 12
A Study by Khaw Ming Sheng & Sathiapriya Ramiah entitled "Web Based Suicide Prevention Application for Patients Suffering from Depression" is awarded Best Article for Vol 13 issue 11
A Study by Purushottam S. G. et al. entitled "Development of Fenofibrate Solid Dispersions for the Plausible Aqueous Solubility Augmentation of this BCS Class-II Drug" is awarded Best article for Vol 13 issue 10
A Study by Kumar S. et al. entitled "A Study on Clinical Spectrum, Laboratory Profile, Complications and Outcome of Pediatric Scrub Typhus Patients Admitted to an Intensive Care Unit from a Tertiary Care Hospital from Eastern India" is awarded Best Article for Vol 13 issue 09
A Study by Mardhiah Kamaruddin et al. entitled "The Pattern of Creatinine Clearance in Gestational and Chronic Hypertension Women from the Third Trimester to 12 Weeks Postpartum" is awarded Best Article for Vol 13 issue 08
A Study by Sarmila G. B. et al. entitled "Study to Compare the Efficacy of Orally Administered Melatonin and Clonidine for Attenuation of Hemodynamic Response During Laryngoscopy and Endotracheal Intubation in Gastrointestinal Surgeries" is awarded Best Article for Vol 13 issue 07
A Study by M. Muthu Uma Maheswari et al. entitled "A Study on C-reactive Protein and Liver Function Tests in Laboratory RT-PCR Positive Covid-19 Patients in a Tertiary Care Centre – A Retrospective Study" is awarded Best Article of Vol 13 issue 06 Special issue Modern approaches for diagnosis of COVID-19 and current status of awareness
A Study by Gainneos PD et al. entitled "A Comparative Evaluation of the Levels of Salivary IgA in HIV Affected Children and the Children of the General Population within the Age Group of 9 – 12 Years – A Cross-Sectional Study" is awarded Best Article of Vol 13 issue 05 Special issue on Recent Advances in Dentistry for better Oral Health
A Study by Alkhansa Mahmoud et al. entitled "mRNA Expression of Somatostatin Receptors (1-5) in MCF7 and MDA-MB231 Breast Cancer Cells" is awarded Best Article of Vol 13 issue 06
A Study by Chen YY and Ghazali SRB entitled "Lifetime Trauma, posttraumatic stress disorder Symptoms and Early Adolescence Risk Factors for Poor Physical Health Outcome Among Malaysian Adolescents" is awarded Best Article of Vol 13 issue 04 Special issue on Current Updates in Plant Biology to Medicine to Healthcare Awareness in Malaysia
A Study by Kumari PM et al. entitled "Study to Evaluate the Adverse Drug Reactions in a Tertiary Care Teaching Hospital in Tamilnadu - A Cross-Sectional Study" is awarded Best Article for Vol 13 issue 05
A Study by Anu et al. entitled "Effectiveness of Cytological Scoring Systems for Evaluation of Breast Lesion Cytology with its Histopathological Correlation" is awarded Best Article of Vol 13 issue 04
A Study by Sharipov R. Kh. et al. entitled "Interaction of Correction of Lipid Peroxidation Disorders with Oxibral" is awarded Best Article of Vol 13 issue 03
A Study by Tarek Elwakil et al. entitled "Led Light Photobiomodulation Effect on Wound Healing Combined with Phenytoin in Mice Model" is awarded Best Article of Vol 13 issue 02
A Study by Mohita Ray et al. entitled "Accuracy of Intra-Operative Frozen Section Consultation of Gastrointestinal Biopsy Samples in Correlation with the Final Histopathological Diagnosis" is awarded Best Article for Vol 13 issue 01
A Study by Badritdinova MN et al. entitled "Peculiarities of a Pain in Patients with Ischemic Heart Disease in the Presence of Individual Combines of the Metabolic Syndrome" is awarded Best Article for Vol 12 issue 24
A Study by Sindhu Priya E S et al. entitled "Neuroprotective activity of Pyrazolone Derivatives Against Paraquat-induced Oxidative Stress and Locomotor Impairment in Drosophila melanogaster" is awarded Best Article for Vol 12 issue 23
A Study by Habiba Suhail et al. entitled "Effect of Majoon Murmakki in Dysmenorrhoea (Usre Tams): A Standard Controlled Clinical Study" is awarded Best Article for Vol 12 issue 22
A Study by Ghaffar UB et al. entitled "Correlation between Height and Foot Length in Saudi Population in Majmaah, Saudi Arabia" is awarded Best Article for Vol 12 issue 21
A Study by Siti Sarah Binti Maidin entitled "Sleep Well: Mobile Application to Address Sleeping Problems" is awarded Best Article for Vol 12 issue 20
A Study by Avijit Singh"Comparison of Post Operative Clinical Outcomes Between “Made in India” TTK Chitra Mechanical Heart Valve Versus St Jude Mechanical Heart Valve in Valve Replacement Surgery" is awarded Best Article for Vol 12 issue 19
A Study by Sonali Banerjee and Mary Mathews N. entitled "Exploring Quality of Life and Perceived Experiences Among Couples Undergoing Fertility Treatment in Western India: A Mixed Methodology" is awarded Best Article for Vol 12 issue 18
A Study by Jabbar Desai et al. entitled "Prevalence of Obstructive Airway Disease in Patients with Ischemic Heart Disease and Hypertension" is awarded Best Article for Vol 12 issue 17
A Study by Juna Byun et al. entitled "Study on Difference in Coronavirus-19 Related Anxiety between Face-to-face and Non-face-to-face Classes among University Students in South Korea" is awarded Best Article for Vol 12 issue 16
A Study by Sudha Ramachandra & Vinay Chavan entitled "Enhanced-Hybrid-Age Layered Population Structure (E-Hybrid-ALPS): A Genetic Algorithm with Adaptive Crossover for Molecular Docking Studies of Drug Discovery Process" is awarded Best article for Vol 12 issue 15
A Study by Varsha M. Shindhe et al. entitled "A Study on Effect of Smokeless Tobacco on Pulmonary Function Tests in Class IV Workers of USM-KLE (Universiti Sains Malaysia-Karnataka Lingayat Education Society) International Medical Programme, Belagavi" is awarded Best article of Vol 12 issue 14, July 2020
A study by Amruta Choudhary et al. entitled "Family Planning Knowledge, Attitude and Practice Among Women of Reproductive Age from Rural Area of Central India" is awarded Best Article for special issue "Modern Therapeutics Applications"
A study by Raunak Das entitled "Study of Cardiovascular Dysfunctions in Interstitial Lung Diseas epatients by Correlating the Levels of Serum NT PRO BNP and Microalbuminuria (Biomarkers of Cardiovascular Dysfunction) with Echocardiographic, Bronchoscopic and HighResolution Computed Tomography Findings of These ILD Patients" is awarded Best Article of Vol 12 issue 13 
A Study by Kannamani Ramasamy et al. entitled "COVID-19 Situation at Chennai City – Forecasting for the Better Pandemic Management" is awarded best article for  Vol 12 issue 12
A Study by Muhammet Lutfi SELCUK and Fatma entitled "Distinction of Gray and White Matter for Some Histological Staining Methods in New Zealand Rabbit's Brain" is awarded best article for  Vol 12 issue 11
A Study by Anamul Haq et al. entitled "Etiology of Abnormal Uterine Bleeding in Adolescents – Emphasis Upon Polycystic Ovarian Syndrome" is awarded best article for  Vol 12 issue 10
A Study by entitled "Estimation of Reference Interval of Serum Progesterone During Three Trimesters of Normal Pregnancy in a Tertiary Care Hospital of Kolkata" is awarded best article for  Vol 12 issue 09
A Study by Ilona Gracie De Souza & Pavan Kumar G. entitled "Effect of Releasing Myofascial Chain in Patients with Patellofemoral Pain Syndrome - A Randomized Clinical Trial" is awarded best article for  Vol 12 issue 08
A Study by Virendra Atam et. al. entitled "Clinical Profile and Short - Term Mortality Predictors in Acute Stroke with Emphasis on Stress Hyperglycemia and THRIVE Score : An Observational Study" is awarded best article for  Vol 12 issue 07
A Study by K. Krupashree et. al. entitled "Protective Effects of Picrorhizakurroa Against Fumonisin B1 Induced Hepatotoxicity in Mice" is awarded best article for issue Vol 10 issue 20
A study by Mithun K.P. et al "Larvicidal Activity of Crude Solanum Nigrum Leaf and Berries Extract Against Dengue Vector-Aedesaegypti" is awarded Best Article for Vol 10 issue 14 of IJCRR
A study by Asha Menon "Women in Child Care and Early Education: Truly Nontraditional Work" is awarded Best Article for Vol 10 issue 13
A study by Deep J. M. "Prevalence of Molar-Incisor Hypomineralization in 7-13 Years Old Children of Biratnagar, Nepal: A Cross Sectional Study" is awarded Best Article for Vol 10 issue 11 of IJCRR
A review by Chitra et al to analyse relation between Obesity and Type 2 diabetes is awarded 'Best Article' for Vol 10 issue 10 by IJCRR. 
A study by Karanpreet et al "Pregnancy Induced Hypertension: A Study on Its Multisystem Involvement" is given Best Paper Award for Vol 10 issue 09

List of Awardees

A Study by Ese Anibor et al. "Evaluation of Temporomandibular Joint Disorders Among Delta State University Students in Abraka, Nigeria" from Vol 13 issue 16 received Emerging Researcher Award


RSS feed

Indexed and Abstracted in


Antiplagiarism Policy: IJCRR strongly condemn and discourage practice of plagiarism. All received manuscripts have to pass through "Plagiarism Detection Software" test before Toto Macau forwarding for peer review. We consider "Plagiarism is a crime"

IJCRR Code of Conduct: To achieve a high standard of publication, we adopt Good Publishing Practices (updated in 2022) which are inspired by guidelines provided by Committee on Publication Ethics (COPE), Open Access Scholarly Publishers Association (OASPA) and International Committee of Medical Journal Editors (ICMJE)

Disclaimer: International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal.



ABOUT US

International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal

Contact

148, IMSR Building, Ayurvedic Layout,
        Near NIT Complex, Sakkardara,
        Nagpur-24, Maharashtra State, India

editor@ijcrr.com

editor.ijcrr@gmail.com


Copyright © 2025 IJCRR. Specialized online journals by ubijournal