International Journal of Current Research and Review
ISSN: 2231-2196 (Print)ISSN: 0975-5241 (Online)
logo
slider
slider
slider
slider
Bootstrap Slider

Indexed and Abstracted in: Crossref, CAS Abstracts, Publons, Google Scholar, Open J-Gate, ROAD, Indian Citation Index (ICI), ResearchGATE, Ulrich's Periodicals Directory, WorldCat (World's largest network of library content and services)

Search Articles

Track manuscript

Full Html

IJCRR - 13(17), September, 2021

Pages: 136-139

Date of Publication: 12-Sep-2021


Print Article   Download XML  Download PDF

Efficacy of Modified Carbapenem Inactivation Method for Carbapenemase Detection and Comparative Evaluation with Polymerase Chain Reaction for the Identification of Carbapenemase-Producing Klebsiella pneumonia Isolates

Author: Bhat Asifa, Benazir Shazia, Fomda Bashir Ahmad

Category: Healthcare

Abstract:Introduction: Rapid and reliable detection of carbapenemase-producing microorganisms is an important element of antimicrobial stewardship. Various phenotypic methods for the detection of these organisms have their limitations. Aims: This study was conducted to assess the performance of the Modified Carbapenem Inactivation Method (mCIM) which is a recent specific phenotypic method described by CLSI 2018 guidelines for the detection of carbapenemase production. Methodology: In the study, mCIM was performed in 80 Gram-negative isolates that were resistant to meropenem by the KirbyBauer disc diffusion method. Separately, another 20 blaKPC( Klebsiella pneumoniae carbapenemase) polymerase chain reaction (PCR) positive and 15 blaKPC PCR negative Klebsiella pneumoniae isolates were tested by mCIM and their results were compared. Results: The positivity of mCIM was 92.7% and 80% in the case of Enterobacteriaceae and Pseudomonas spp. respectively. The test also showed 100% sensitivity for detecting carbapenemase production in PCR positive Klebsiella pneumoniae isolates harbouring the blaKPC gene. Conclusion: mCIM is a user-specific phenotypic test that is simple and easy to carry out for the detection of carbapenemase-producing microorganisms in microbiology laboratories.

Keywords: Carbapenem resistance, Carbapenemases, mCIM, Phenotypic method, Polymerase chain reaction

Full Text:

INTRODUCTION: Carbapenemases have become a frequent cause of drug resistance in Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii during the last decade.1 Multiple carbapenemase genes have been described till now. The common determinants contributing to carbapenem resistance include blaKPC (Ambler class A), blaNDM(Ambler classB), and blaOXA-48-like(Ambler class D) genes. These enzymes are routinely isolated from Klebsiella pneumoniae and  Escherichia coli along with other  Gram-negative non-fermenters like Pseudomonas aeruginosa and  Acinetobacter spp.2 Infections due to carbapenemase-producing Gram-negative bacteria can cause serious illness leading to a prolonged period of hospitalization and increased mortality ratio. Therefore, monitoring the development of resistance against carbapenems is of utmost importance.3

Various phenotypic, as well as genotypic methods, have been used to detect carbapenemases. Modified Hodge test was a useful phenotypic test previously included in the CLSI guidelines but it had the disadvantage of giving false-positive results mostly with  Enterobacter spp. harbouring AmpC enzymes and alterations in porin channels. It also suffered false-negative results in  New Delhi Metallo-beta-lactamase(NDM) producing isolates.4 Other phenotypic tests like the Carba NP test requires the use of specific and exclusive reagents, also the interpretation of the Carba NP test is subjective and it has shown poor sensitivity for the detection of OXA-48-type carbapenemases.5,6 Genotypic assays can principally detect only known targets and thus the performance of such test could be seriously affected by the occurrence of mutations within the targets.4

Modified carbapenem inactivation method (mCIM) is included as a screening test for carbapenemase-producing Enterobacteriaceae in CLSI 2018.7 Compared to Carba NP, which has a rapid turnaround time of 2 hours, mCIM is time-consuming, requiring an overnight incubation for the detection of carbapenemases. But it is relatively simple and has shown sensitivity and specificity of more than 99%.8

The emergence and spread of carbapenem-resistant bacteria is an issue of great clinical and public health concern.4 Thus, the  study was carried out to evaluate the usefulness of mCIM  for the identification of carbapenem-resistant isolates in our hospital because the accurate diagnosis of infections due to  carbapenemase-producing Gram-negative bacteria is important for epidemiological purposes, infection-prevention measures and expediting appropriate therapy in such infected patients.

MATERIAL AND METHODS                                  

This prospective cross-sectional study was conducted in the Department of Microbiology, Sher-i- Kashmir Institute of Medical Sciences (SKIMS) India, a tertiary care institute from October 2019 to March 2020.

Clinical Isolates: 80 Gram-negative isolates recovered from various clinical samples (blood, pus, urine, sputum and other body fluids) were included in the study. The isolates comprised of Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa.

Antibiotic susceptibility was performed by Kirby-Bauer disc diffusion method according to CLSI guidelines and the isolates resistant to meropenem(10 µg) were selected.7 These isolates were subjected to a modified carbapenem inactivation method(mCIM). In addition, 20 blaKPC PCR positive and 15 blaKPC PCR negative  Klebsiella pneumonia isolates were tested by mCIM separately.

mCIM testing: It was done according to CLSI 2018 guidelines.7 Using a sterile inoculating loop, 1µl of the test organism(Escherichia coli / Klebsiella pneumoniae) or 10µl of Pseudomonas aeruginosa was added into a tube containing 2 ml of tryptic soy broth(HIMEDIA); the bacterial suspension was vortexed for 10 to 15s. Aseptically, a 10µg meropenem disc (HIMEDIA) was added to this bacterial suspension and was incubated for 4 h ±15 min at 35°C ± 2°C in ambient air. Preceding the completion of the 4-hour carbapenem inactivation step, a 0.5 McFarland standard suspension of the mCIM indicator organism (Escherichia coli ATCC 25922, a carbapenem-susceptible strain) was prepared and inoculated on the Mueller-Hinton agar plate(HIMEDIA) using the method for standard disc diffusion susceptibility testing.  The meropenem disc was then removed from the tryptic soy broth bacterial suspension using a 10µl inoculating loop which was dragged along the edge of the tube to remove excess liquid, and the disc was placed on the inoculated MHA plate. It was then incubated for 18 to 24 h at 35°C ± 2°C in ambient air.7

mCIM result interpretation: The test was interpreted according to CLSI 2018 guidelines.7  The zone of inhibition around each meropenem disc was measured. A zone diameter of 6 to 15 mm or presence of colonies within 16-18mm zone was considered as a positive result (i.e. carbapenemase production ), a zone diameter of more than or equal to 19 mm was considered a negative result (i.e. no carbapenemase production ) and a zone diameter of 16-18 mm was considered an indeterminate result.7  A small ring of a growth adjacent to the meropenem disc, representing carryover of the test organism from the Tryptic soy broth was ignored (Fig.1). For intermediate results, mCIM for the test isolate was repeated after checking for the purity of Escherichia coli ATCC 25922 indicator strain and the meropenem disc integrity by subjecting it to repeat disc diffusion test.

Polymerase chain reaction (PCR): Molecular identification of KPC-producing Klebsiella pneumoniae was done by bla KPC PCR using bacterial lysates prepared by removal of 200μl of overnight broth culture. The lysates were centrifuged at 12,000 × g for 2 min, and then re-suspended in 200μl of molecular-grade water followed by boiling at 95°C for 10 min, and discarding the cellular debris by centrifugation at 12,000 × g for  2 min at 4°C. 1μl of cell lysates were then subjected to  PCR analysis using the following primers designed to identify all blaKPC genes (blaKPC-1 through blaKPC-7):

  1. KPC forward (ATGTCACTGTATCGCCGTCT),

  2. KPC reverse (TTTTCAGAGCCTTACTGCCC).

The reaction was set up in a PCR vial, after the addition of master mix, primers and the extracted DNA. 25μl of Master Mix contained 10X Taq buffer, 0.4mM dNTPs mix, 2mM Mgcl2, and 2U Proofreading Taq DNA polymerase.(Thermo scientific, USA). Lysates derived from blaKPC carrying Klebsiella pneumoniae strain 1705 and Escherichia coli ATCC 25922  were used as positive and negative controls respectively. The PCR was set up at the following conditions: 15 min at 95°C and 38 cycles of 1 min at 94°C, 1 min at 62°C, and 1 min at 72°C, which was followed by an extension step of 10 min at 72°C.9 The PCR products were analysed by electrophoresis on 2% agarose gel stained with ethidium bromide and visualized with UV light. The blaKPC gene gave a band at 893bp.

 RESULTS: Out of the total 80 isolates tested for carbapenemase production by mCIM, 71 (88.7%) were carbapenemase producers. Initially, an indeterminate result was present in 12 isolates(8 Klebsiella pneumoniae and 4 Pseudomonas aeruginosa isolates). After repeating mCIM of these isolates 6 among 8 Klebsiella pneumoniae isolates were mCIM positive and 2 were mCIM negative. Among the 4 Pseudomonas aeruginosa isolates, 2 were positive and 2 were negative after repeating mCIM. The positivity of mCIM in different isolates is shown in Table-1.

While comparing mCIM of the blaKPC Klebsiella pneumoniae isolates, it showed 100% sensitivity in the detection of carbapenemase production in PCR positive Klebsiella pneumoniae isolates harbouring the bla KPC gene. (Table 2)

DISCUSSION

Resistance to carbapenems is a worrisome international public health problem.2  Rapid detection of carbapenemase-producing Enterobacteriaceae is important both for taking effective precautions against the infection and for starting the appropriate treatment procedure.3 Polymerase chain reaction is considered the gold standard for carbapenemase gene identification, but it has some limitations. False-negative PCR results can occur due to a carbapenemase gene not tested in the PCR reaction, or mutations affecting the annealing of primers. False-positive PCR results can be due to the detection of inactive genes (with no carbapenemase expression). Such results can delay infection-control measures or, oppositely, initiate them when they are not required.10

Different phenotypic methods also have their shortcomings. The sensitivity and specificity of these tests vary depending on the bacterial species, enzyme type and expression level of the gene that codes for the enzyme or carbapenem resistance.3

In our study, we evaluated the performance of the mCIM (recommended by CLSI 2018) which is a simple test and has been seen to have better sensitivity and specificity than other phenotypic methods for the detection of carbapenemases.

 The overall positivity of mCIM for Enterobacteriaceae and non-Enterobacteriaceae (Pseudomonas spp.) in our study was 88.7%. 11.3 % of our isolates that were resistant to meropenem by disc diffusion were mCIM negative which could be because of the various other

mechanisms of resistance in these isolates rather than carbapenemase production. It was observed that the detection of carbapenemases was high (92.7%) in the case of Enterobacteriaceae  (Klebsiella pneumoniae and Escherichia. coli). The overall sensitivity of mCIM for Enterobacteriaceae is 93% to 100% in a study by Pierce VM et al. 4 In the case of Pseudomonas isolates, the positivity of mCIM in our study was  80%.  In a study by   Luiz  F et al., the sensitivity of mCIM was 81% for Pseudomonas isolates.11   In another multicentric study by Simner PJ et al. the sensitivity of the mCIM for detection of carbapenemase-producing Pseudomonas isolates across 10 sites was found to be  98.0%.12  However in a  comparative study by Howard JC et al. the sensitivity of mCIM was found to be only 71.4%.13

Since PCR is the gold standard test for the detection of carbapenemases, we compared the results of mCIM and conventional PCR in a separate group of blaKPC gene-positive and negative isolates of Klebsiella pneumonia.  All the 20 blaKPC PCR positive isolates were positive by mCIM, thus giving a sensitivity of 100% for this gene. However, in the case of 15 blaKPC PCR negative isolates, 4(26.6%) were positive which indicates the presence of a carbapenemase other than KPC carbapenemase. Further 11(73.4%) blaKPC PCR negative isolates were negative by this test also because these could have a different resistant mechanism other than carbapenemase production (porin mutations, efflux pumps etc).

CONCLUSION

The mCIM was inexpensive, easy to perform and interpret, supported by the overall excellent reproducibility of the results in Enterobacteriaceae. Comparing with PCR it was found to be an accurate method for the identification of carbapenemase production in Klebsiella Pneumoniae isolates. This test also shows good reproducibility of the results in Pseudomonas isolates. Thus the test aids in the rapid and reliable identification of carbapenemase-producing carbapenem-resistant Enterobacteriaceae in microbiological laboratories and helps in understanding the local epidemiology of resistance to carbapenems, thus serving as one of the important tools to prevent the spread of these drug-resistant pathogens.

Acknowledgement: We thank the staff of the Department of Microbiology, SKIMS Srinagar for their support during the study.

Conflict of interest: The authors declare that the research was conducted in absence of any conflict of interest.

Ethical Clearance: Not Required

Source of funding: No financial support to declare.

Author`s contributions: Author Benazir Shazia designed the study, wrote the protocol and performed the laboratory methods. Author Bhat Asifa wrote the first draft of the manuscript, performed the laboratory methods and the literature searches. Author Fomda BA managed the analysis of the study. All the authors read and approved the final manuscript.

References:

1. Jing X, Zhou H, Min X, Zhang X, Yang Q, Du S et al. The Simplified Carbapenem Inactivation Method (sCIM) for Simple and Accurate Detection of Carbapenemase-Producing Gram-Negative Bacilli. Front. Microbiol. 2018; 9:2391.

2..McMullen AR, Yarbrough ML, Wallace MA, Shupe A, Burnham C-AD. Evaluation of Genotypic and Phenotypic Methods to Detect Carbapenemase Production in Gram-Negative Bacilli. Clin Chem. 2017 Mar;63(3):723–30.

3. Serapsüzükyildiz, Banuka¸ Skatepe, Havvaavciküçük¸ Sükranöztürk. Performance of Carba NP and CIM tests in oxa-48 carbapenemase-producing Enterobacteriaceae. ActaMicrobiologica et Immunologica Hungarica 2017; 64:1,9–16.

4. Pierce VM, Simner PJ, Lonsway DR, Roe-Carpenter DE, Johnson JK, Brasso WB et al. Modified carbapenem inactivation method for phenotypic detection of carbapenemase production among Enterobacteriaceae. J Clin Microbiol. 2017;55:2321–2333.

5. Papagiannitsis CC, Studentova V, Izdebski R, Oikonomou O, Pfeifer Y, Petinaki E, Hrabak J. Matrix-assisted laser desorption ionization-time of flight mass spectrometry meropenem hydrolysis assay with NH4HCO3, a reliable tool for direct detection of carbapenemase activity. J Clin Microbiol 2015;53:1731–1735.      

Efficacy of Modified Carbapenem Inactivation Method    10

6. Tamma PD, Opene BNA, Gluck A, Chambers KK, Carroll KC, Simner PJ. A comparison of eleven phenotypic assays for the accurate detection of carbapenemase-producing Enterobacteriaceae. J Clin Microbiol. 2017;55:1046-1055.

7. Clinical and Laboratory Standards Institute (CLSI). Performance standards for antimicrobial susceptibility testing.22nd informational supplement (M100-S28). Wayne, PA: CLSI; 2018.

8. Pragasam AK, Veeraraghavan B, Bakthavatchalam YD, Gopi R, Aslam RF. Strengths and limitations of various screening methods for carbapenem-resistant Enterobacteriaceae including new method recommended by clinical and laboratory standards institute: A tertiary care experience. Indian J Med Microbiol 2017;35:116-9.

9. Schechner V, Straus-Robinson K, Schwartz D, Pfeffer I, Tarabeia J, Moskovich R et al. Evaluation of PCR-based testing for surveillance of KPC-producing carbapenem-resistant members of the Enterobacteriaceae family. J Clin Microbiol. 2009 Oct;47(10):3261-5.

10. Tijet N, Patel SN, Melano RG. Detection of carbapenemase activity in Enterobacteriaceae: comparison of the carbapenem inactivation method versus the Carba NP test. J Antimicrob Chemother. 2015;71(1):274–276.

11. Lisboa LF, Turnbull L, Boyd DA, Mulvey MR, Dingle TC. Evaluation of a modified carbapenem inactivation method for detection of carbapenemases in Pseudomonas aeruginosa  J Clin Microbiol 2018;56(1):e01234-17.

12.  Simner PJ, Johnson JK, Brasso WB, Anderson K, Lonsway DR, Pierce VM et al. Multicenter Evaluation of the Modified Carbapenem Inactivation Method and the Carba NP for Detection of Carbapenemase-Producing Pseudomonas aeruginosa and Acinetobacter baumannii. J Clin Microbiol. 2017 Dec 26;56(1):e01369-17.

13. Howard JC, Creighton J, Ikram R, Werno AM. Comparison of the performance of three variations of the Carbapenem Inactivation Method (CIM, modified CIM [mCIM] and in-house method (iCIM)) for the detection of carbapenemase-producing Enterobacterales and non-fermenters. J. Glob. Antimicrob. Resist. 2020 Jun 1;21:78–82.

Announcements

Dr. Pramod Kumar Manjhi joined Editor-in-Chief since July 2021 onwards

COPE guidelines for Reviewers

SCOPUS indexing: 2014, 2019 to 2021


Awards, Research and Publication incentive Schemes by IJCRR

Best Article Award: 

One article from every issue is selected for the ‘Best Article Award’. Authors of selected ‘Best Article’ are rewarded with a certificate. IJCRR Editorial Board members select one ‘Best Article’ from the published issue based on originality, novelty, social usefulness of the work. The corresponding author of selected ‘Best Article Award’ is communicated and information of award is displayed on IJCRR’s website. Drop a mail to editor@ijcrr.com for more details.

Women Researcher Award:

This award is instituted to encourage women researchers to publish her work in IJCRR. Women researcher, who intends to publish her research work in IJCRR as the first author is eligible to apply for this award. Editorial Board members decide on the selection of women researchers based on the originality, novelty, and social contribution of the research work. The corresponding author of the selected manuscript is communicated and information is displayed on IJCRR’s website. Under this award selected women, the author is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.

Emerging Researcher Award:

‘Emerging Researcher Award’ is instituted to encourage student researchers to publish their work in IJCRR. Student researchers, who intend to publish their research or review work in IJCRR as the first author are eligible to apply for this award. Editorial Board members decide on the selection of student researchers for the said award based on originality, novelty, and social applicability of the research work. Under this award selected student researcher is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.


Best Article Award

A study by Dorothy Ebere Adimora et al. entitled \"Remediation for Effects of Domestic Violence on Psychological well-being, Depression and Suicide among Women During COVID-19 Pandemic: A Cross-cultural Study of Nigeria and Spain\" is awarded Best Article of Vol 14 issue 23
A study by Muhas C. et al. entitled \"Study on Knowledge & Awareness About Pharmacovigilance Among Pharmacists in South India\" is awarded Best article for Vol 14 issue 22
A study by Saurabh Suvidha entitled \"A Case of Mucoid Degeneration of Uterine Fibroid with Hydrosalphinx and Ovarian Cyst\" is awarded Best article of Vol 14 issue 21
A study by Alice Alice entitled \"Strengthening of Human Milk Banking across South Asian Countries: A Next Step Forward\" is awarded Best article of Vol 14 issue 20
A study by Sathyanarayanan AR et al. entitled \"The on-task Attention of Individuals with Autism Spectrum Disorder-An Eye Tracker Study Using Auticare\" is awarded Best article of Vol 14 issue 19
A study by Gupta P. et al. entitled \"A Short Review on \"A Novel Approach in Fast Dissolving Film & their Evaluation Studies\" is awarded Best Article of Vol 14 issue 18.
A study by Shafaque M. et al. entitled \"A Case-Control Study Performed in Karachi on Inflammatory Markers by Ciprofloxacin and CoAmoxicillin in Patients with Chronic Suppurative Otitis Media\" is awarded Best Article of Vol 14 issue 17
A study by Ali Nawaz et al. entitled \"A Comparative Study of Tubeless versus Standard Percutaneous Nephrolithotomy (PCNL) \? A Randomized Controlled Study\" is awarded Best Article for Vol 14 issue 16.
A study by Singh R. et al. entitled \"A Prospective Study to Find the Association of Astigmatism in Patients of Vernal Keratoconjunctivitis (VKC) in a Tertiary Health Care Centre in India (Vindhya Region MP)\" is awarded Best Article for Vol 14 issue 15
A Study by Humaira Tahir et al. entitled "Comparison of First Analgesic Demand after Major Surgeries of Obstetrics and Gynecology between Pre-Emptive Versus Intra-Operative Groups by Using Intravenous Paracetamol: A Cross-Sectional Study" is awarded Best Article for Vol 14 issue 14
A Study by Monica K. entitled "Risk Predictors for Lymphoma Development in Sjogren Syndrome - A Systematic Review" is awarded Best Article for Vol 14 issue 13
A Study by Mokhtar M Sh et al. entitled "Prevalence of Hospital Mortality of Critically Ill Elderly Patients" is awarded Best Article for Vol 14 issue 12
A Study by Vidya S. Bhat et al. entitled "Effect of an Indigenous Cleanser on the Microbial Biofilm on Acrylic Denture Base - A Pilot Study" is awarded Best Article for Vol 14 issue 11
A Study by Pandya S. et al. entitled "Acute and 28-Day Repeated Dose Subacute Toxicological Evaluation of Coroprotect Tablet in Rodents" is awarded Best Article for Vol 14 issue 10
A Study by Muhammad Zaki et al. entitled "Effect of Hemoglobin Level on the Severity of Acute Bronchiolitis in Children: A Case-Control Study" is awarded Best Article for Vol 14 issue 09
A Study by Vinita S & Ayushi S entitled "Role of Colour Doppler and Transvaginal Sonography for diagnosis of endometrial pathology in women presenting with Abnormal Uterine Bleeding" is awarded Best Article for Vol 14 issue 08
A Study by Prabhu A et al. entitled "Awareness of Common Eye Conditions among the ASHA (Accredited Social Health Activist) Workers in the Rural Communities of Udupi District- A Pilot Study" is awarded Best Article for Vol 14 issue 07
A Study by Divya MP et al. entitled "Non-Echoplanar Diffusion-Weighted Imaging and 3D Fiesta Magnetic Resonance Imaging Sequences with High Resolution Computed Tomography Temporal Bone in Assessment and Predicting the Outcome of Chronic Suppurative Otitis Media with Cholesteatoma" is awarded Best Article for Vol 14 issue 06
A Study by Zahoor Illahi Soomro et al. entitled "Functional Outcomes of Fracture Distal Radius after Fixation with Two Different Plates: A Retrospective Comparative Study" is awarded Best Article for Vol 14 issue 05
A Study by Ajai KG & Athira KN entitled "Patients’ Gratification Towards Service Delivery Among Government Hospitals with Particular Orientation Towards Primary Health Centres" is awarded Best Article for Vol 14 issue 04
A Study by Mbungu Mulaila AP et al. entitled "Ovarian Pregnancy in Kindu City, D.R. Congo - A Case Report" is awarded Best Article for Vol 14 issue 03
A Study by Maryam MJ et al. entitled "Evaluation Serum Chemerin and Visfatin Levels with Rheumatoid Arthritis: Possible Diagnostic Biomarkers" is awarded Best Article for Vol 14 issue 02
A Study by Shanthan KR et al. entitled "Comparison of Ultrasound Guided Versus Nerve Stimulator Guided Technique of Supraclavicular Brachial Plexus Block in Patients Undergoing Upper Limb Surgeries" is awarded Best Article for Vol 14 issue 01
A Study by Amol Sanap et al. entitled "The Outcome of Coxofemoral Bypass Using Cemented Bipolar Hemiarthroplasty in the Treatment of Unstable Intertrochanteric Fracture of Femur in a Rural Setup" is awarded Best Article Award of Vol 13 issue 24
A Study by Manoj KP et al. entitled "A Randomized Comparative Clinical Trial to Know the Efficacy of Ultrasound-Guided Transversus Abdominis Plane Block Against Multimodal Analgesia for Postoperative Analgesia Following Caesarean Section" is awarded Best Article Award of Vol 13 issue 23
A Study by Karimova II et al. entitled "Changes in the Activity of Intestinal Carbohydrases in Alloxan-Induced Diabetic Rats and Their Correction with Prenalon" is awarded Best Article of Vol 13 issue 22
A Study by Ashish B Roge et al. entitled "Development, Validation of RP-HPLC Method and GC MS Analysis of Desloratadine HCL and It’s Degradation Products" is awarded Best Article of Vol 13 issue 21
A Study by Isha Gaurav et al. entitled "Association of ABO Blood Group with Oral Cancer and Precancer – A Case-control Study" is awarded Best Article for Vol 13 issue 20
A Study by Amr Y. Zakaria et al. entitled "Single Nucleotide Polymorphisms of ATP-Binding Cassette Gene(ABCC3 rs4793665) affect High Dose Methotrexate-Induced Nephrotoxicity in Children with Osteosarcoma" is awarded Best Article for Vol 13 issue 19
A Study by Kholis Ernawati et al. entitled "The Utilization of Mobile-Based Information Technology in the Management of Dengue Fever in the Community Year 2019-2020: Systematic Review" is awarded Best Article for Vol 13 issue 18
A Study by Bhat Asifa et al. entitled "Efficacy of Modified Carbapenem Inactivation Method for Carbapenemase Detection and Comparative Evaluation with Polymerase Chain Reaction for the Identification of Carbapenemase Producing Klebsiella pneumonia Isolates" is awarded Best Article for Vol 13 issue 17
A Study by Gupta R. et al. entitled "A Clinical Study of Paediatric Tracheostomy: Our Experience in a Tertiary Care Hospital in North India" is awarded Best Article for Vol 13 issue 16
A Study by Chandran Anand et al. entitled "A Prospective Study on Assessment of Quality of Life of Patients Receiving Sorafenib for Hepatocellular Carcinoma" is awarded Best article for Vol 13 issue 15
A Study by Rosa PS et al. entitled "Emotional State Due to the Covid – 19 Pandemic in People Residing in a Vulnerable Area in North Lima" is awarded Best Article for Vol 13 issue 14
A Study by Suvarna Sunder J et al. entitled "Endodontic Revascularization of Necrotic Permanent Anterior Tooth with Platelet Rich Fibrin, Platelet Rich Plasma, and Blood Clot - A Comparative Study" is awarded Best Article for Vol 13 issue 13
A Study by Mona Isam Eldin Osman et al. entitled "Psychological Impact and Risk Factors of Sexual Abuse on Sudanese Children in Khartoum State" is awarded Best Article for Vol 13 issue 12
A Study by Khaw Ming Sheng & Sathiapriya Ramiah entitled "Web Based Suicide Prevention Application for Patients Suffering from Depression" is awarded Best Article for Vol 13 issue 11
A Study by Purushottam S. G. et al. entitled "Development of Fenofibrate Solid Dispersions for the Plausible Aqueous Solubility Augmentation of this BCS Class-II Drug" is awarded Best article for Vol 13 issue 10
A Study by Kumar S. et al. entitled "A Study on Clinical Spectrum, Laboratory Profile, Complications and Outcome of Pediatric Scrub Typhus Patients Admitted to an Intensive Care Unit from a Tertiary Care Hospital from Eastern India" is awarded Best Article for Vol 13 issue 09
A Study by Mardhiah Kamaruddin et al. entitled "The Pattern of Creatinine Clearance in Gestational and Chronic Hypertension Women from the Third Trimester to 12 Weeks Postpartum" is awarded Best Article for Vol 13 issue 08
A Study by Sarmila G. B. et al. entitled "Study to Compare the Efficacy of Orally Administered Melatonin and Clonidine for Attenuation of Hemodynamic Response During Laryngoscopy and Endotracheal Intubation in Gastrointestinal Surgeries" is awarded Best Article for Vol 13 issue 07
A Study by M. Muthu Uma Maheswari et al. entitled "A Study on C-reactive Protein and Liver Function Tests in Laboratory RT-PCR Positive Covid-19 Patients in a Tertiary Care Centre – A Retrospective Study" is awarded Best Article of Vol 13 issue 06 Special issue Modern approaches for diagnosis of COVID-19 and current status of awareness
A Study by Gainneos PD et al. entitled "A Comparative Evaluation of the Levels of Salivary IgA in HIV Affected Children and the Children of the General Population within the Age Group of 9 – 12 Years – A Cross-Sectional Study" is awarded Best Article of Vol 13 issue 05 Special issue on Recent Advances in Dentistry for better Oral Health
A Study by Alkhansa Mahmoud et al. entitled "mRNA Expression of Somatostatin Receptors (1-5) in MCF7 and MDA-MB231 Breast Cancer Cells" is awarded Best Article of Vol 13 issue 06
A Study by Chen YY and Ghazali SRB entitled "Lifetime Trauma, posttraumatic stress disorder Symptoms and Early Adolescence Risk Factors for Poor Physical Health Outcome Among Malaysian Adolescents" is awarded Best Article of Vol 13 issue 04 Special issue on Current Updates in Plant Biology to Medicine to Healthcare Awareness in Malaysia
A Study by Kumari PM et al. entitled "Study to Evaluate the Adverse Drug Reactions in a Tertiary Care Teaching Hospital in Tamilnadu - A Cross-Sectional Study" is awarded Best Article for Vol 13 issue 05
A Study by Anu et al. entitled "Effectiveness of Cytological Scoring Systems for Evaluation of Breast Lesion Cytology with its Histopathological Correlation" is awarded Best Article of Vol 13 issue 04
A Study by Sharipov R. Kh. et al. entitled "Interaction of Correction of Lipid Peroxidation Disorders with Oxibral" is awarded Best Article of Vol 13 issue 03
A Study by Tarek Elwakil et al. entitled "Led Light Photobiomodulation Effect on Wound Healing Combined with Phenytoin in Mice Model" is awarded Best Article of Vol 13 issue 02
A Study by Mohita Ray et al. entitled "Accuracy of Intra-Operative Frozen Section Consultation of Gastrointestinal Biopsy Samples in Correlation with the Final Histopathological Diagnosis" is awarded Best Article for Vol 13 issue 01
A Study by Badritdinova MN et al. entitled "Peculiarities of a Pain in Patients with Ischemic Heart Disease in the Presence of Individual Combines of the Metabolic Syndrome" is awarded Best Article for Vol 12 issue 24
A Study by Sindhu Priya E S et al. entitled "Neuroprotective activity of Pyrazolone Derivatives Against Paraquat-induced Oxidative Stress and Locomotor Impairment in Drosophila melanogaster" is awarded Best Article for Vol 12 issue 23
A Study by Habiba Suhail et al. entitled "Effect of Majoon Murmakki in Dysmenorrhoea (Usre Tams): A Standard Controlled Clinical Study" is awarded Best Article for Vol 12 issue 22
A Study by Ghaffar UB et al. entitled "Correlation between Height and Foot Length in Saudi Population in Majmaah, Saudi Arabia" is awarded Best Article for Vol 12 issue 21
A Study by Siti Sarah Binti Maidin entitled "Sleep Well: Mobile Application to Address Sleeping Problems" is awarded Best Article for Vol 12 issue 20
A Study by Avijit Singh"Comparison of Post Operative Clinical Outcomes Between “Made in India” TTK Chitra Mechanical Heart Valve Versus St Jude Mechanical Heart Valve in Valve Replacement Surgery" is awarded Best Article for Vol 12 issue 19
A Study by Sonali Banerjee and Mary Mathews N. entitled "Exploring Quality of Life and Perceived Experiences Among Couples Undergoing Fertility Treatment in Western India: A Mixed Methodology" is awarded Best Article for Vol 12 issue 18
A Study by Jabbar Desai et al. entitled "Prevalence of Obstructive Airway Disease in Patients with Ischemic Heart Disease and Hypertension" is awarded Best Article for Vol 12 issue 17
A Study by Juna Byun et al. entitled "Study on Difference in Coronavirus-19 Related Anxiety between Face-to-face and Non-face-to-face Classes among University Students in South Korea" is awarded Best Article for Vol 12 issue 16
A Study by Sudha Ramachandra & Vinay Chavan entitled "Enhanced-Hybrid-Age Layered Population Structure (E-Hybrid-ALPS): A Genetic Algorithm with Adaptive Crossover for Molecular Docking Studies of Drug Discovery Process" is awarded Best article for Vol 12 issue 15
A Study by Varsha M. Shindhe et al. entitled "A Study on Effect of Smokeless Tobacco on Pulmonary Function Tests in Class IV Workers of USM-KLE (Universiti Sains Malaysia-Karnataka Lingayat Education Society) International Medical Programme, Belagavi" is awarded Best article of Vol 12 issue 14, July 2020
A study by Amruta Choudhary et al. entitled "Family Planning Knowledge, Attitude and Practice Among Women of Reproductive Age from Rural Area of Central India" is awarded Best Article for special issue "Modern Therapeutics Applications"
A study by Raunak Das entitled "Study of Cardiovascular Dysfunctions in Interstitial Lung Diseas epatients by Correlating the Levels of Serum NT PRO BNP and Microalbuminuria (Biomarkers of Cardiovascular Dysfunction) with Echocardiographic, Bronchoscopic and HighResolution Computed Tomography Findings of These ILD Patients" is awarded Best Article of Vol 12 issue 13 
A Study by Kannamani Ramasamy et al. entitled "COVID-19 Situation at Chennai City – Forecasting for the Better Pandemic Management" is awarded best article for  Vol 12 issue 12
A Study by Muhammet Lutfi SELCUK and Fatma entitled "Distinction of Gray and White Matter for Some Histological Staining Methods in New Zealand Rabbit's Brain" is awarded best article for  Vol 12 issue 11
A Study by Anamul Haq et al. entitled "Etiology of Abnormal Uterine Bleeding in Adolescents – Emphasis Upon Polycystic Ovarian Syndrome" is awarded best article for  Vol 12 issue 10
A Study by entitled "Estimation of Reference Interval of Serum Progesterone During Three Trimesters of Normal Pregnancy in a Tertiary Care Hospital of Kolkata" is awarded best article for  Vol 12 issue 09
A Study by Ilona Gracie De Souza & Pavan Kumar G. entitled "Effect of Releasing Myofascial Chain in Patients with Patellofemoral Pain Syndrome - A Randomized Clinical Trial" is awarded best article for  Vol 12 issue 08
A Study by Virendra Atam et. al. entitled "Clinical Profile and Short - Term Mortality Predictors in Acute Stroke with Emphasis on Stress Hyperglycemia and THRIVE Score : An Observational Study" is awarded best article for  Vol 12 issue 07
A Study by K. Krupashree et. al. entitled "Protective Effects of Picrorhizakurroa Against Fumonisin B1 Induced Hepatotoxicity in Mice" is awarded best article for issue Vol 10 issue 20
A study by Mithun K.P. et al "Larvicidal Activity of Crude Solanum Nigrum Leaf and Berries Extract Against Dengue Vector-Aedesaegypti" is awarded Best Article for Vol 10 issue 14 of IJCRR
A study by Asha Menon "Women in Child Care and Early Education: Truly Nontraditional Work" is awarded Best Article for Vol 10 issue 13
A study by Deep J. M. "Prevalence of Molar-Incisor Hypomineralization in 7-13 Years Old Children of Biratnagar, Nepal: A Cross Sectional Study" is awarded Best Article for Vol 10 issue 11 of IJCRR
A review by Chitra et al to analyse relation between Obesity and Type 2 diabetes is awarded 'Best Article' for Vol 10 issue 10 by IJCRR. 
A study by Karanpreet et al "Pregnancy Induced Hypertension: A Study on Its Multisystem Involvement" is given Best Paper Award for Vol 10 issue 09

List of Awardees

A Study by Ese Anibor et al. "Evaluation of Temporomandibular Joint Disorders Among Delta State University Students in Abraka, Nigeria" from Vol 13 issue 16 received Emerging Researcher Award


RSS feed

Indexed and Abstracted in


Antiplagiarism Policy: IJCRR strongly condemn and discourage practice of plagiarism. All received manuscripts have to pass through "Plagiarism Detection Software" test before Toto Macau forwarding for peer review. We consider "Plagiarism is a crime"

IJCRR Code of Conduct: To achieve a high standard of publication, we adopt Good Publishing Practices (updated in 2022) which are inspired by guidelines provided by Committee on Publication Ethics (COPE), Open Access Scholarly Publishers Association (OASPA) and International Committee of Medical Journal Editors (ICMJE)

Disclaimer: International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal.



ABOUT US

International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal

Contact

148, IMSR Building, Ayurvedic Layout,
        Near NIT Complex, Sakkardara,
        Nagpur-24, Maharashtra State, India

editor@ijcrr.com

editor.ijcrr@gmail.com


Copyright © 2026 IJCRR. Specialized online journals by ubijournal