International Journal of Current Research and Review
ISSN: 2231-2196 (Print)ISSN: 0975-5241 (Online)
logo
slider
slider
slider
slider
Bootstrap Slider

Indexed and Abstracted in: Crossref, CAS Abstracts, Publons, Google Scholar, Open J-Gate, ROAD, Indian Citation Index (ICI), ResearchGATE, Ulrich's Periodicals Directory, WorldCat (World's largest network of library content and services)

Search Articles

Track manuscript

Full Html

IJCRR - Vol 03 Issue 03, March, 2011

Pages: 42-51

Print Article   Download XML  Download PDF

IPOPROTEIN LIPASE GENE POLYMORPHISM AT Pvu II RESTRICTION SITE AND CORONARY ARTERY DISEASE

Author: A. Cholarajan, A.Sharmila Princy

Category: Healthcare

Abstract:The present study was made to find the PvuII restriction enzyme polymorphism of lipoprotein lipase
(LPL) gene and its association with angiographically defined coronary artery disease (CAD). Lipoprotein
lipase (LPL) plays a central role in lipid metabolism by hydrolyzing triglyceride in chylomicrons and
VLDL. Polymorphic variants of the LPL gene are common and might affect risk of CAD.Two milliliter
of blood samples were collected from 30 patients, and 30 control subjects. Genomic DNA was isolated
from the blood samples and subjected to PCR-RFLP analysis for determination of the genotype with
regard to the Pvu II polymorphism of LPL gene. The amplified product was digested with restriction
enzyme Pvu II and genotyped by through electrophoresis in 2.5% agarose gel. For the PvuII genotypes,
within the CAD group(n=30), the +/- genotype (+ presence of Pvu II restriction site, - absence of Pvu II
restriction site) was found in 12 individuals (40%),whereas 10(33%) carried the +/+,and 8(27%) carried
the -/- genotype. In the control group (n=30), the -/- genotype was found in 6 subjects (20%), 13 (43%)
carried the +/+ genotype and 11(37%) carried the +/- genotype. The genotype frequency distribution was
significantly different in the CAD and control study group. The most frequent genotype among CAD
patients was (-/-), this genotype was more frequent in patients than in control subjects.There was a
difference in the distribution of LPL-PvuII genotypes between the healthy subjects and the patients with
CAD. The common LPL polymorphic allele, the PvuII (+) or (-) is modestly associated with CAD.
Genetic variants of LPL deserve further evaluation as risk factors for CAD.

Keywords: Lipoprotien lipase; coronary artery disease ; pvu II restriction site ; Enzyme

Full Text:

INTRODUCTION

Coronary Artery Disease (CAD) is the most common form of heart disease. This condition occurs when the coronary arteries, that supply oxygen- rich blood to the heart muscle, gradually become narrowed or blocked by plaque deposits. The plaque deposits decrease the space through which blood can flow. Poor blood flow can „starve? the heart muscle and lead to chest pain. A heart attack results when blood flow is completely blocked, usually by a blood clot forming over a plaque that has ruptured (Lusis et al., 2000). Lipoprotein lipase (LPL;triacylglycerolprotein acyl hydrolase, EC 3.1.1.34)catalyzes the hydrolysis of core triacylglycerol of circulating very low density lipoprotein(VLDL) and chylomicrons generating fatty acids for storage in adipose tissue or oxidation in muscle. This enzyme therefore plays a crucial role in plasma lipoprotein processing and energy metabolism in general (Eckel,1987).LPL is a glycoprotein synthesized and secreated by a variety of parenchymal cells, including adipocytes,skeletal and cardiac muscle cells and macrophages. After secreation it becomes bound to glycosaminoglycans on the luminal surface of capillaries. Apolipoprotein CII, which is present on the surface of VLDL and chylomicrons, was shown to act as a cofactor for LPL (Olivecrona et al., 1997).

The importance of LPL in the regulation of overall lipid metabolism and transport in humans and other animals is well documented (Cryer, 1981).LPL is expressed by the parenchymal cells of extra hepatic tissue and catalyses the hydrolysis of the triacylglycerol componenet of chylomicrons and very low density lipoprotein (VLDL),thereby providing non-esterified fatty acids and 2-monoacylglycerol for tissue utilization .Because the circulating lipoproteins are in general, too large to cross the vascular endothelial cells, to which the enzyme is attached via highly charged membrane bound chains of heparin sulfate proteoglycans (HSPG) (Godota et al, 1992) .Although adipose tissue and muscle parenchymal cells are the major source of LPL synthesis, from where the mature enzyme is secreted by macrophages. It is the source of LPL that has been implicated to play a major role in the pathogenesis of atherosclerosis.

LPL gene, mapped to the short arm human chromosome8, contain 10 exons, separated by 9 introns (Deep et al., 1989).Gene analysis showed many mutations involving the noncoding and coding sequences of the human LPL gene (Murthy et al., 1996).Several restriction fragment length polymorphisms (RFLPs) have been identified at the LPL gene. The occurrence of alternate types of nucleotides at the same position in the nucleic acid sequence with no concomitant apparent phenotypic differences is generally referred to as polymorphism and it can be easily detected if it leads to restriction site alterations. The most extensively investigated of these are the PvuII (Fisher et al., 1987) and HindIII (Heinzmann et al., 1987) sites. PvuII polymorphism is the result of change in the restriction site of the LPL gene 6th intron, 1.57kb from SA site (Oka et al., 1989). The region containing PvuII site resembles the splicing in its homology to the consensus sequence required for 3?-splicing and the formation of the lariat structure, suggesting that C497- T(CAG CTG-TAG CTG) change may interfere with correct splicing of mRNA.

DNA polymorphism is a useful marker to analyze disorders with genetic backgrounds, even when the genetic cause of the disease has not been elucidated (Godotaet et al.,1992).A number of DNA polymorphism have been investigated for their possible linkage with hereditary predisposition to common polygenic disorders, such as dyslipidemia (Lusis et al.,1988).Several trails explored association between LPL gene for an association between genotypes identified by the PvuII restriction fragment length polymorphism and plasma triglyceride levels (Chamberlain et al.,1989;Wang et al.,1996),but other failed to find significant association (Heizmann et al.,1991;Jemaa et al.,1995).

MATERIALS AND METHODS

SAMPLE COLLECTION

The blood samples were collected from the patients between the age group of 30-60 from inpatients and outpatient department of Frontier Life Line, Dr.KM.Cherian Heart Foundation, Chennai. Plasma was isolated for subsequent analysis of measuring sugar level, HDL, LDL, Total cholesterol and Triglycerides were carried out in the clinical Biochemistry laboratory of the hospital.

DNA ISOLATION

The genomic DNA was isolated from venous blood by using Phenol chloroform isolation method. The blood samples were obtained in a EDTA (Ethylene diamine tetra acetic acid) coated vacutaines. From this 1ml of the blood was taken into an eppendroff tube and centrifuged at 3000rpm for 30minutes. On centrifugation a white Buffy coat (which has the WBC) was obtained which is removed and transferred to fresh eppendroff tubes. To this, thrice the volume of lysis buffer (0.155M ammonium chloride, 0.1M potassium bicarbonate and 0.1mM EDTA) was added; then Mixed and stored at -20 C for 30minutes which would allow cell lysis to occur. Later the tubes were centrifuged at 2000 rpm for 5 minutes and the supernatant was discarded. To the pellet, 200 l of 0.5M sodium EDTA, 100 l of 10% SDS and 10 l of proteinase k (100 g/ml) were added and left for overnight incubation. The next day to this overnight solution, equal volumes of Tetrahydroxy aminomethyl hydrochloric acid (Tris) saturated phenol (pH 8) was added and mixed well in an overhead shaker for 30minutes. The tubes were centrifuged at 6000 rpm for 10minutes and the upper aqueous layer was removed without disturbing the lower organic layer (containing phenol). To the aqueous layer again obtained equal volumes of Tris saturated phenol, Chloroform and isoamyl alcohol in the ratio 25:24:1 were added and mixed in an overhead shaker for 30minutes. Again the upper aqueous supernatant was taken and further residual phenol was removed by extracting with equal volumes of chloroform and isoamyl alcohol (24:1) and mixed well in an overhead shaker. To the aqueous layer, one tenth the volumes of 3M sodium acetate and equal volumes of chilled ethanol was added and shaken well. The tubes were centrifuged at 12000 rpm for 2 minutes and the supernatant was discarded. The pellet was washed with 70 % ethanol and the DNA obtained was stored in TE (1M Tris, 1mM EDTA) at 4 C.

POLYMERASE CHAIN REACTION Polymerase chain reaction (PCR) is a technique which is designed to permit selective amplification of a specific target DNA sequence or sequences within a heterogeneous collection of DNA sequences. The PvuII genotypes were determined by polymerase chain reaction (PCR) amplification of the polymorphic regions found in intron 6 region of the lipoprotein lipase (Oka et al.,1989), followed by digestion of these amplified fragments with PvuII restriction endonuclease. The PvuII-containing site was amplified using the following primers (Sigma, Bangalore).

Forward 5?- CATCCATTTTCTTCCACAGGG -3?

Reverse 5?-TAGCCCAGAATGCTCACCAGACT- 3?

PCR reaction amplification was carried out in 15 µl reaction volume containing, 1X PCR buffer, 1.5mM MgCl2, 200µM dNTPs, forward and reverse primers 0.5µM respectively, 0.5U Taq DNA polymerase (Sigma, USA ) and Genomic DNA (50ng – 100ng). The thermo cycling procedure was carried out using Thermocycler (MJ Research Inc, USA) for 30 cycles. PCR cycling conditions were 94°C for 5 minutes for initial denaturation followed by 30 cycles of 94 °C denaturation for 45 seconds, 54°C annealing for 30 seconds, 72°C extension for 30 seconds, 72 °C final extension for 3 minutes.

RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)

The amplified DNA sample was subjected to restriction digestion with 5 units of Pvu II restriction enzyme (Biogene.U.S.A). It was incubated at 37 °C for 3 hours. Then the digested sample was subjected to 2.5% agarose gel electrophoresis.

GEL ELECTROPHORESIS

The gel template was cleaned and its edges were sealed. A solution of 2.5% agarose gel (1X Tris borate EDTA) was prepared and the solution was warmed until the Agarose melted. The melted gel was cooled and 3µl of ethidium bromide was added (10 mg/ml stock). The warm solution was poured into the template and allowed to solidify. The comb and the seal were carefully removed from the solidified gel. The gel was placed in electrophoresis tank and it was filled with 1X TBE buffer. The DNA sample was mixed with loading dye. The sample was loaded carefully with the help of micropipette. The electrode was connected and a voltage of 1-5 volts per cm was applied. The current supply was stopped when the dye had migrated above 70%. The gel was placed carefully on an ultraviolet transilluminator and the DNA bands were viewed. The gel was then photographed and developed.

STATISTICAL ANALYSIS The mean, standard deviation were calculated for each parameter (age, BMI, glucose level, etc.) for both the control and patient samples.

 

RESULT AND DISCUSSION

The baseline features and biochemical parameters of both control and patients were listed and expressed as mean ± Standard Deviation in the Table-1. The number of genotypes of Pvu II restriction site of LPL gene was computed by gene counting method from the documented gels (Figure 1). The mean age of patients and control subjects was 47.3 + 11.62 and 59.9 + 8.57 years respectively. Among 30 involved patients 25 were male and 5 were female. The patients group presented convincingly lower mean levels of body mass index than control subjects. The mean value of low density lipoprotein level and high density lipoprotein level in patients were lower than the control.

 

 

The genotype and allele frequency of the Pvu II restriction site at the LPL locus in patients and control groups were shown in Table-2. The -/- homozygote among the patients and control are 27 and 20% and the +/+ homozygote among the patients and control are 33% and 43 % respectively. Also, the percent of heterozygote +/- varied significantly between the two groups 40% in patients and 37 % in control. The +/- and -/- allele frequency were considerably higher in patients with coronary atherosclerosis than the normal control. The Chi square value in patients and controls were 1.158 and 1.511 respectively, and tested to be present in the Hardy-Weinberg equilibrium.

The statistical reports for CAD and control subjects were shown in table 4 and 5. In control and CAD subjects, there were no significant differences in total cholesterol, HDL and TG level in common genotypes in Pvu II RFLPs. The total cholesterol, TG and HDL levels were found to be highest in the +/- genotype in patients and +/+ genotype in control. The LDL level was found to be higher in the +/- genotype, both in patients and control.

 

 

DISCUSSION

Lipoprotein lipase is a candidate gene for CAD risk, and the possible association of the LPL – Pvu II polymorphism to CAD was studied. The genotype distribution of LPL polymorphism at a Pvu II polymorphic site was investigated. The results of various association studies of LPL – Pvu II polymorphisms with CAD have been inconsistent. Some previous studies have defined, an association between the extent of CAD and the LPL – Pvu II (+/+) genotype and the LPL – Pvu II (-/-) genotype to be moderately associated with CAD. Other studies did not define any significant difference in the distribution of LPL – Pvu II polymorphism between the healthy group and the CAD groups suggesting lack of association between any of the LPL Pvu II genotypes and CAD. The relevance of the Pvu II genotypes may vary among different populations. In the present study, the distribution of the LPL – Pvu II genotypes was significantly different in CAD and control study groups; the frequency of the +/- and -/- genotypes were higher in patients than in controls. Analysis of intra genotype variance of mean values of lipid levels showed that variability of Pvu II in LPL contributes to a certain extent to the level and variability in serum total cholesterol and LDL cholesterol levels. The LPL Pvu II genotypes, the CAD subjects heterozygous (+/-) for the higher total cholesterol, triglycerides, HDL and LDL cholesterol compared with homozygous +/+ and -/- subjects. The findings indicates no significant differences between the prevalence rates for the LPL – Pvu II genotypes in both the study groups, suggesting a very modest association between any of the LPL – Pvu II genotypes and CAD . This study was cross – sectional raising the possibility of changes in prevalence of LPL polymorphisms among cases and control subjects due to differential survival rates for CAD patients presenting for angiography based on LPL genotype status. This seems unlikely, but can be addressed by prospective studies. Disease and control groups differed in some baseline variables, as expected. However, when differences were accounted for by conditional multivariate logistic regression, the relative risk associated with the polymorphism was maintained or augmented.

References:

 1. Chamberlain,JC.,Thorn,JA.,Oka,,K.,et al.(1989).DNA polymorphism at the LPL gene:associations in normal and hypertriglyceridemic subject. Atherosclerosis 79, 85-9.

 

2. Cryer,A.(1981).Role of LPL in lipdd metabolism.International Journal of Biochemistry 13,525-41.

3. Deep,SS.,Peng,R.(1989).Structure of the LPL gene.Biochemistry 28,4131-35. 4. Eckel,RH.,(1989).LPL a multifunctional enzyme relevant to common metabolic disease.The New England Journal of Medicine 320,1060-32.

5. Fisher,KL.,Fitzgerald,GA.,Lawn,RM.(1 987).Two polymorphisms in the human LPL gene.Nucleic Acids Research 15,7657.

6. Godota,T.,Yamada,N.,Murase,T.,Shima noh.,et al.(1992).Detection of three separate DNA polymorphisms in the human LPL gene by amplification and restriction endonuclease digestion.Journal of Lipid Research 33,1067-72.

7. Heinzmann,C.,Ladias,J.,Antonarakis,S., Kirchgessner,T.,et al.(1987).RFLP for the human LPL gene-HindIII.Nucleic Acids Research 15,6763.

8. Heizmann,C.,Kirchgessner,T.,Kwiterovi ch,PO.,Ladias,JA.,et al.(1991)..DNA polymorphism haplotypes of the human LPL gene;possible association with high density lipoprotein levels.Human Genetics 86,578-84.

9. Jemaa,R.,Tuzet,S.,Portos,C.,Betoulle,D., et al.(1995).LPL gene polymorphisms in association with hypertriglyceridemia and body mass index in obese people.Journal of Obesity Related to Metabolic Disorders 19,270-74.

10. Lusis,AJ.(2000).Atherosclerosis.Nature 407,233-41.

11. Murthy,V.,Julian,P.,GagneC.(1996).Mol ecular pathology of the human LPL gene.Pharmacol Therapy 70,101-35.

12. Oka,K., Tkalcevic,GT, Stocks,J., Galton,Dj.(1989). Nucleotide sequence of PvuII polymorphic site at the human LPL gene.Nucleic Acids Research 17, 6752.

13. Olivercrona,T., Hultin,M., Bergo,M. and Olivercrona,G. (1997). Lipoprotein lipase:regulation and role in lipoprotein metabolism.Proc Nutural Society 56,723-9.

14. Wang, XL., Mc Credie, RM., Wilken, DE.(1996). Common DNA polymorphism at the LPL gene association with severity of CAD and diabetes.Circulation 93,1339-45.

Announcements

Dr. Pramod Kumar Manjhi joined Editor-in-Chief since July 2021 onwards

COPE guidelines for Reviewers

SCOPUS indexing: 2014, 2019 to 2021


Awards, Research and Publication incentive Schemes by IJCRR

Best Article Award: 

One article from every issue is selected for the ‘Best Article Award’. Authors of selected ‘Best Article’ are rewarded with a certificate. IJCRR Editorial Board members select one ‘Best Article’ from the published issue based on originality, novelty, social usefulness of the work. The corresponding author of selected ‘Best Article Award’ is communicated and information of award is displayed on IJCRR’s website. Drop a mail to editor@ijcrr.com for more details.

Women Researcher Award:

This award is instituted to encourage women researchers to publish her work in IJCRR. Women researcher, who intends to publish her research work in IJCRR as the first author is eligible to apply for this award. Editorial Board members decide on the selection of women researchers based on the originality, novelty, and social contribution of the research work. The corresponding author of the selected manuscript is communicated and information is displayed on IJCRR’s website. Under this award selected women, the author is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.

Emerging Researcher Award:

‘Emerging Researcher Award’ is instituted to encourage student researchers to publish their work in IJCRR. Student researchers, who intend to publish their research or review work in IJCRR as the first author are eligible to apply for this award. Editorial Board members decide on the selection of student researchers for the said award based on originality, novelty, and social applicability of the research work. Under this award selected student researcher is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.


Best Article Award

A Study by Humaira Tahir et al. entitled "Comparison of First Analgesic Demand after Major Surgeries of Obstetrics and Gynecology between Pre-Emptive Versus Intra-Operative Groups by Using Intravenous Paracetamol: A Cross-Sectional Study" is awarded Best Article for Vol 14 issue 14
A Study by Monica K. entitled "Risk Predictors for Lymphoma Development in Sjogren Syndrome - A Systematic Review" is awarded Best Article for Vol 14 issue 13
A Study by Mokhtar M Sh et al. entitled "Prevalence of Hospital Mortality of Critically Ill Elderly Patients" is awarded Best Article for Vol 14 issue 12
A Study by Vidya S. Bhat et al. entitled "Effect of an Indigenous Cleanser on the Microbial Biofilm on Acrylic Denture Base - A Pilot Study" is awarded Best Article for Vol 14 issue 11
A Study by Pandya S. et al. entitled "Acute and 28-Day Repeated Dose Subacute Toxicological Evaluation of Coroprotect Tablet in Rodents" is awarded Best Article for Vol 14 issue 10
A Study by Muhammad Zaki et al. entitled "Effect of Hemoglobin Level on the Severity of Acute Bronchiolitis in Children: A Case-Control Study" is awarded Best Article for Vol 14 issue 09
A Study by Vinita S & Ayushi S entitled "Role of Colour Doppler and Transvaginal Sonography for diagnosis of endometrial pathology in women presenting with Abnormal Uterine Bleeding" is awarded Best Article for Vol 14 issue 08
A Study by Prabhu A et al. entitled "Awareness of Common Eye Conditions among the ASHA (Accredited Social Health Activist) Workers in the Rural Communities of Udupi District- A Pilot Study" is awarded Best Article for Vol 14 issue 07
A Study by Divya MP et al. entitled "Non-Echoplanar Diffusion-Weighted Imaging and 3D Fiesta Magnetic Resonance Imaging Sequences with High Resolution Computed Tomography Temporal Bone in Assessment and Predicting the Outcome of Chronic Suppurative Otitis Media with Cholesteatoma" is awarded Best Article for Vol 14 issue 06
A Study by Zahoor Illahi Soomro et al. entitled "Functional Outcomes of Fracture Distal Radius after Fixation with Two Different Plates: A Retrospective Comparative Study" is awarded Best Article for Vol 14 issue 05
A Study by Ajai KG & Athira KN entitled "Patients’ Gratification Towards Service Delivery Among Government Hospitals with Particular Orientation Towards Primary Health Centres" is awarded Best Article for Vol 14 issue 04
A Study by Mbungu Mulaila AP et al. entitled "Ovarian Pregnancy in Kindu City, D.R. Congo - A Case Report" is awarded Best Article for Vol 14 issue 03
A Study by Maryam MJ et al. entitled "Evaluation Serum Chemerin and Visfatin Levels with Rheumatoid Arthritis: Possible Diagnostic Biomarkers" is awarded Best Article for Vol 14 issue 02
A Study by Shanthan KR et al. entitled "Comparison of Ultrasound Guided Versus Nerve Stimulator Guided Technique of Supraclavicular Brachial Plexus Block in Patients Undergoing Upper Limb Surgeries" is awarded Best Article for Vol 14 issue 01
A Study by Amol Sanap et al. entitled "The Outcome of Coxofemoral Bypass Using Cemented Bipolar Hemiarthroplasty in the Treatment of Unstable Intertrochanteric Fracture of Femur in a Rural Setup" is awarded Best Article Award of Vol 13 issue 24
A Study by Manoj KP et al. entitled "A Randomized Comparative Clinical Trial to Know the Efficacy of Ultrasound-Guided Transversus Abdominis Plane Block Against Multimodal Analgesia for Postoperative Analgesia Following Caesarean Section" is awarded Best Article Award of Vol 13 issue 23
A Study by Karimova II et al. entitled "Changes in the Activity of Intestinal Carbohydrases in Alloxan-Induced Diabetic Rats and Their Correction with Prenalon" is awarded Best Article of Vol 13 issue 22
A Study by Ashish B Roge et al. entitled "Development, Validation of RP-HPLC Method and GC MS Analysis of Desloratadine HCL and It’s Degradation Products" is awarded Best Article of Vol 13 issue 21
A Study by Isha Gaurav et al. entitled "Association of ABO Blood Group with Oral Cancer and Precancer – A Case-control Study" is awarded Best Article for Vol 13 issue 20
A Study by Amr Y. Zakaria et al. entitled "Single Nucleotide Polymorphisms of ATP-Binding Cassette Gene(ABCC3 rs4793665) affect High Dose Methotrexate-Induced Nephrotoxicity in Children with Osteosarcoma" is awarded Best Article for Vol 13 issue 19
A Study by Kholis Ernawati et al. entitled "The Utilization of Mobile-Based Information Technology in the Management of Dengue Fever in the Community Year 2019-2020: Systematic Review" is awarded Best Article for Vol 13 issue 18
A Study by Bhat Asifa et al. entitled "Efficacy of Modified Carbapenem Inactivation Method for Carbapenemase Detection and Comparative Evaluation with Polymerase Chain Reaction for the Identification of Carbapenemase Producing Klebsiella pneumonia Isolates" is awarded Best Article for Vol 13 issue 17
A Study by Gupta R. et al. entitled "A Clinical Study of Paediatric Tracheostomy: Our Experience in a Tertiary Care Hospital in North India" is awarded Best Article for Vol 13 issue 16
A Study by Chandran Anand et al. entitled "A Prospective Study on Assessment of Quality of Life of Patients Receiving Sorafenib for Hepatocellular Carcinoma" is awarded Best article for Vol 13 issue 15
A Study by Rosa PS et al. entitled "Emotional State Due to the Covid – 19 Pandemic in People Residing in a Vulnerable Area in North Lima" is awarded Best Article for Vol 13 issue 14
A Study by Suvarna Sunder J et al. entitled "Endodontic Revascularization of Necrotic Permanent Anterior Tooth with Platelet Rich Fibrin, Platelet Rich Plasma, and Blood Clot - A Comparative Study" is awarded Best Article for Vol 13 issue 13
A Study by Mona Isam Eldin Osman et al. entitled "Psychological Impact and Risk Factors of Sexual Abuse on Sudanese Children in Khartoum State" is awarded Best Article for Vol 13 issue 12
A Study by Khaw Ming Sheng & Sathiapriya Ramiah entitled "Web Based Suicide Prevention Application for Patients Suffering from Depression" is awarded Best Article for Vol 13 issue 11
A Study by Purushottam S. G. et al. entitled "Development of Fenofibrate Solid Dispersions for the Plausible Aqueous Solubility Augmentation of this BCS Class-II Drug" is awarded Best article for Vol 13 issue 10
A Study by Kumar S. et al. entitled "A Study on Clinical Spectrum, Laboratory Profile, Complications and Outcome of Pediatric Scrub Typhus Patients Admitted to an Intensive Care Unit from a Tertiary Care Hospital from Eastern India" is awarded Best Article for Vol 13 issue 09
A Study by Mardhiah Kamaruddin et al. entitled "The Pattern of Creatinine Clearance in Gestational and Chronic Hypertension Women from the Third Trimester to 12 Weeks Postpartum" is awarded Best Article for Vol 13 issue 08
A Study by Sarmila G. B. et al. entitled "Study to Compare the Efficacy of Orally Administered Melatonin and Clonidine for Attenuation of Hemodynamic Response During Laryngoscopy and Endotracheal Intubation in Gastrointestinal Surgeries" is awarded Best Article for Vol 13 issue 07
A Study by M. Muthu Uma Maheswari et al. entitled "A Study on C-reactive Protein and Liver Function Tests in Laboratory RT-PCR Positive Covid-19 Patients in a Tertiary Care Centre – A Retrospective Study" is awarded Best Article of Vol 13 issue 06 Special issue Modern approaches for diagnosis of COVID-19 and current status of awareness
A Study by Gainneos PD et al. entitled "A Comparative Evaluation of the Levels of Salivary IgA in HIV Affected Children and the Children of the General Population within the Age Group of 9 – 12 Years – A Cross-Sectional Study" is awarded Best Article of Vol 13 issue 05 Special issue on Recent Advances in Dentistry for better Oral Health
A Study by Alkhansa Mahmoud et al. entitled "mRNA Expression of Somatostatin Receptors (1-5) in MCF7 and MDA-MB231 Breast Cancer Cells" is awarded Best Article of Vol 13 issue 06
A Study by Chen YY and Ghazali SRB entitled "Lifetime Trauma, posttraumatic stress disorder Symptoms and Early Adolescence Risk Factors for Poor Physical Health Outcome Among Malaysian Adolescents" is awarded Best Article of Vol 13 issue 04 Special issue on Current Updates in Plant Biology to Medicine to Healthcare Awareness in Malaysia
A Study by Kumari PM et al. entitled "Study to Evaluate the Adverse Drug Reactions in a Tertiary Care Teaching Hospital in Tamilnadu - A Cross-Sectional Study" is awarded Best Article for Vol 13 issue 05
A Study by Anu et al. entitled "Effectiveness of Cytological Scoring Systems for Evaluation of Breast Lesion Cytology with its Histopathological Correlation" is awarded Best Article of Vol 13 issue 04
A Study by Sharipov R. Kh. et al. entitled "Interaction of Correction of Lipid Peroxidation Disorders with Oxibral" is awarded Best Article of Vol 13 issue 03
A Study by Tarek Elwakil et al. entitled "Led Light Photobiomodulation Effect on Wound Healing Combined with Phenytoin in Mice Model" is awarded Best Article of Vol 13 issue 02
A Study by Mohita Ray et al. entitled "Accuracy of Intra-Operative Frozen Section Consultation of Gastrointestinal Biopsy Samples in Correlation with the Final Histopathological Diagnosis" is awarded Best Article for Vol 13 issue 01
A Study by Badritdinova MN et al. entitled "Peculiarities of a Pain in Patients with Ischemic Heart Disease in the Presence of Individual Combines of the Metabolic Syndrome" is awarded Best Article for Vol 12 issue 24
A Study by Sindhu Priya E S et al. entitled "Neuroprotective activity of Pyrazolone Derivatives Against Paraquat-induced Oxidative Stress and Locomotor Impairment in Drosophila melanogaster" is awarded Best Article for Vol 12 issue 23
A Study by Habiba Suhail et al. entitled "Effect of Majoon Murmakki in Dysmenorrhoea (Usre Tams): A Standard Controlled Clinical Study" is awarded Best Article for Vol 12 issue 22
A Study by Ghaffar UB et al. entitled "Correlation between Height and Foot Length in Saudi Population in Majmaah, Saudi Arabia" is awarded Best Article for Vol 12 issue 21
A Study by Siti Sarah Binti Maidin entitled "Sleep Well: Mobile Application to Address Sleeping Problems" is awarded Best Article for Vol 12 issue 20
A Study by Avijit Singh"Comparison of Post Operative Clinical Outcomes Between “Made in India” TTK Chitra Mechanical Heart Valve Versus St Jude Mechanical Heart Valve in Valve Replacement Surgery" is awarded Best Article for Vol 12 issue 19
A Study by Sonali Banerjee and Mary Mathews N. entitled "Exploring Quality of Life and Perceived Experiences Among Couples Undergoing Fertility Treatment in Western India: A Mixed Methodology" is awarded Best Article for Vol 12 issue 18
A Study by Jabbar Desai et al. entitled "Prevalence of Obstructive Airway Disease in Patients with Ischemic Heart Disease and Hypertension" is awarded Best Article for Vol 12 issue 17
A Study by Juna Byun et al. entitled "Study on Difference in Coronavirus-19 Related Anxiety between Face-to-face and Non-face-to-face Classes among University Students in South Korea" is awarded Best Article for Vol 12 issue 16
A Study by Sudha Ramachandra & Vinay Chavan entitled "Enhanced-Hybrid-Age Layered Population Structure (E-Hybrid-ALPS): A Genetic Algorithm with Adaptive Crossover for Molecular Docking Studies of Drug Discovery Process" is awarded Best article for Vol 12 issue 15
A Study by Varsha M. Shindhe et al. entitled "A Study on Effect of Smokeless Tobacco on Pulmonary Function Tests in Class IV Workers of USM-KLE (Universiti Sains Malaysia-Karnataka Lingayat Education Society) International Medical Programme, Belagavi" is awarded Best article of Vol 12 issue 14, July 2020
A study by Amruta Choudhary et al. entitled "Family Planning Knowledge, Attitude and Practice Among Women of Reproductive Age from Rural Area of Central India" is awarded Best Article for special issue "Modern Therapeutics Applications"
A study by Raunak Das entitled "Study of Cardiovascular Dysfunctions in Interstitial Lung Diseas epatients by Correlating the Levels of Serum NT PRO BNP and Microalbuminuria (Biomarkers of Cardiovascular Dysfunction) with Echocardiographic, Bronchoscopic and HighResolution Computed Tomography Findings of These ILD Patients" is awarded Best Article of Vol 12 issue 13 
A Study by Kannamani Ramasamy et al. entitled "COVID-19 Situation at Chennai City – Forecasting for the Better Pandemic Management" is awarded best article for  Vol 12 issue 12
A Study by Muhammet Lutfi SELCUK and Fatma entitled "Distinction of Gray and White Matter for Some Histological Staining Methods in New Zealand Rabbit's Brain" is awarded best article for  Vol 12 issue 11
A Study by Anamul Haq et al. entitled "Etiology of Abnormal Uterine Bleeding in Adolescents – Emphasis Upon Polycystic Ovarian Syndrome" is awarded best article for  Vol 12 issue 10
A Study by entitled "Estimation of Reference Interval of Serum Progesterone During Three Trimesters of Normal Pregnancy in a Tertiary Care Hospital of Kolkata" is awarded best article for  Vol 12 issue 09
A Study by Ilona Gracie De Souza & Pavan Kumar G. entitled "Effect of Releasing Myofascial Chain in Patients with Patellofemoral Pain Syndrome - A Randomized Clinical Trial" is awarded best article for  Vol 12 issue 08
A Study by Virendra Atam et. al. entitled "Clinical Profile and Short - Term Mortality Predictors in Acute Stroke with Emphasis on Stress Hyperglycemia and THRIVE Score : An Observational Study" is awarded best article for  Vol 12 issue 07
A Study by K. Krupashree et. al. entitled "Protective Effects of Picrorhizakurroa Against Fumonisin B1 Induced Hepatotoxicity in Mice" is awarded best article for issue Vol 10 issue 20
A study by Mithun K.P. et al "Larvicidal Activity of Crude Solanum Nigrum Leaf and Berries Extract Against Dengue Vector-Aedesaegypti" is awarded Best Article for Vol 10 issue 14 of IJCRR
A study by Asha Menon "Women in Child Care and Early Education: Truly Nontraditional Work" is awarded Best Article for Vol 10 issue 13
A study by Deep J. M. "Prevalence of Molar-Incisor Hypomineralization in 7-13 Years Old Children of Biratnagar, Nepal: A Cross Sectional Study" is awarded Best Article for Vol 10 issue 11 of IJCRR
A review by Chitra et al to analyse relation between Obesity and Type 2 diabetes is awarded 'Best Article' for Vol 10 issue 10 by IJCRR. 
A study by Karanpreet et al "Pregnancy Induced Hypertension: A Study on Its Multisystem Involvement" is given Best Paper Award for Vol 10 issue 09

List of Awardees

A Study by Ese Anibor et al. "Evaluation of Temporomandibular Joint Disorders Among Delta State University Students in Abraka, Nigeria" from Vol 13 issue 16 received Emerging Researcher Award


A Study by Alkhansa Mahmoud et al. entitled "mRNA Expression of Somatostatin Receptors (1-5) in MCF7 and MDA-MB231 Breast Cancer Cells" from Vol 13 issue 06 received Emerging Researcher Award


RSS feed

Indexed and Abstracted in


Antiplagiarism Policy: IJCRR strongly condemn and discourage practice of plagiarism. All received manuscripts have to pass through "Plagiarism Detection Software" test before Toto Macau forwarding for peer review. We consider "Plagiarism is a crime"

IJCRR Code of Conduct: To achieve a high standard of publication, we adopt Good Publishing Practices (updated in 2022) which are inspired by guidelines provided by Committee on Publication Ethics (COPE), Open Access Scholarly Publishers Association (OASPA) and International Committee of Medical Journal Editors (ICMJE)

Disclaimer: International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal.



ABOUT US

International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal

Contact

148, IMSR Building, Ayurvedic Layout,
        Near NIT Complex, Sakkardara,
        Nagpur-24, Maharashtra State, India

editor@ijcrr.com

editor.ijcrr@gmail.com


Copyright © 2023 IJCRR. Specialized online journals by ubijournal .Website by Ubitech solutions