International Journal of Current Research and Review
ISSN: 2231-2196 (Print)ISSN: 0975-5241 (Online)
logo
slider
slider
slider
slider
Bootstrap Slider

Indexed and Abstracted in: Crossref, CAS Abstracts, Publons, Google Scholar, Open J-Gate, ROAD, Indian Citation Index (ICI), ResearchGATE, Ulrich's Periodicals Directory, WorldCat (World's largest network of library content and services)

Search Articles

Track manuscript

Full Html

IJCRR - 9(13), July, 2017

Pages: 38-44

Date of Publication: 03-Jul-2017


Print Article   Download XML  Download PDF

Characterization of Insoluble Organophosphate Degrading Bacteria Isolated from the Root of Citrus Plant

Author: Sangita Saha, Tanusri Mandal

Category: General Sciences

Abstract:Aim: To degrade the water insoluble toxic and non-toxic organophosphate compounds into non-toxic water soluble compounds. Plants consume water soluble components from the soil as nutrients. Methods: Dilution plate technique with modified Pikovskaya media has been used to isolate the organophosphate degrading bacteria. Three different water insoluble toxic organophosphate insecticides such as chlorpyrifos, methyl-parathion, phorate and two different water insoluble non-toxic organophosphate compounds present in soil such as calcium phytate, lecithin have been used for this study. Organophosphate solubilizing efficiency test, biochemical characterization, antibiotic test, 16S rDNA sequencing, phylogenetic analysis, LC-MS analysis and biofertilization test have been performed. Results: A potent organophosphate degrading bacteria has been identified as Enterobacter aerogenes strain STLR-I on the basis of NCBI database. The accession number provided by GenBank is KX352268. We have named the bacteria as RZ311 can degrade calcium phytate, chlorpyrifos, methyl-parathion and phorate but it cannot degrade soy-lecithin. Biochemical test and antibiotic test have been shown in the table. The LC-MS data shows the biodegradable compounds present in the media are ammonium polyphosphate, ammonium phosphate, P2 O5 and hypophosphite ion, malic acid, acetic acid, phosphoric acid, gluconic acid etc. The significant vigor index with higher germination percentage of Cicer arietinum seeds have been found for all types of treated inoculum. Discussion: It has been identified as a potent organophosphate biodegrader and bioremidiater with significant biofertilization activity. Conclusion: RZ311, can be used to degrade insoluble toxic and non-toxic organophosphate compounds from environment. The degraded compounds are consumed by the plants for growth

Keywords: Organophosphate, Biodegradation, Enterobacter, Biofertilizer, LC-MS

DOI: 10.7324/IJCRR.2017.9137

Full Text:

Introduction
Phosphorus is an essential macro-nutrient for the growth of plant. It has important role in various metabolic processes, such as photosynthesis, respiration, energy transfer, signal transduction process, fixation of nitrogen in nodules and others 1-3. Both inorganic and organic forms of phosphorus are present in the soil. It has been reported that 20-80% of organic phosphorus is water insoluble and plant cannot consume this one4. It has also been reported that plant-root can only absorb 0.1% of total phosphorus contained in the soil5. Hence, phosphorus deficiency has been supplemented with synthetic chemical fertilizers for green revolution. Along with synthetic phosphate fertilizer, other organophosphates, such as pesticides, insecticides, and acaricides are used for protection of crops. Such organophosphate compounds are toxic in nature. These toxic compounds damage the soil quality, plant growth rate and microbial biodiversity6-8. According to the report, crop-yield is reduced by 45% due to the excessive application of pesticides9.

The isolated bacterium, RZ311, has been applied to degrade five different types of organophosphate insecticide compounds. Among the five compounds, three compounds are toxic and two are non-toxic compounds. The soil contains two non-toxic organic phosphate compounds such as calcium phytate and lecithin. Three toxic organo-phosphorus insecticides are generally used in the agricultural field. Thus, in our experimental studies, five different water insoluble organic compounds, such as calcium phytate [calcium salt of inositol hexaphosphoric acid], soy-lecithin [2-(nonanoyloxy)-3-(octadeca-9,12-dienoyloxy)propyl 2-(trimethylammonio) ethylphosphonate], methyl-parathion [O, O-dimethyl-O-p-nitrophenylphosphoro-thioate], chlorpyrifos [o,o-diethyl o-(3,5,6-trichloro-2-pyridinyl) phosphorothioate] and phorate [O, O – (diethylthio) methylphosphoradiothioate] are used. Among them chlorpyrifos, methyl-parathion and phorate are applied as pesticides or insecticides. They are neurotoxins and contaminate environment due to the regular fashion of application. Again calcium phytate acts as anti-nutritional factor due to its chelation effects with most of the metals10. Global ecology is disturbed with the effect of mineral deficiency and its inhibition of major enzymatic activity 10.

In this investigation, the primary objective is to isolate a potentially environment friendly “microphos” from rhizospheric region of the root of citrus plants. As micro-organisms is one of the cost-effective means for biodegradation of insoluble organophosphate into its soluble form, it is a sustainable approach for plant’s phosphorus supply.

Materials and Methods
All the experiments have conducted with sterile double distilled water. All the chemical reagents, which are products of the companies: HIMEDIA/MERCK, India, have been used.

Collection of sample
The sample of citrus plant-root has been collected from Debra, West Midnapore, having latitude of 22.3690° N and longitude of 7.5544° E.

Isolation of organic phosphate solubilizing bacteria

One gram of rhizopheric soil sample of citrus plant has been dissolved in 100 ml of sterilized double distilled water. It is serially diluted from 10-1 to 10-10 times. 100 µl of such sample from each of one then has been spread on the petri-plate containing modified Pikovskaya media 11-12. The composition of modified Pikovskaya media is same with the authentic one except calcium tri phosphate. Here, calcium phytate has been used instead of calcium tri-phosphate. Ten different isolates having clear zone surrounding single colonies have been isolated and inoculated in Luria Bertani (LB) broth. Broths have been incubated at 350 C for 3 days for bacterial growth.  These bacterial cultures have been further tested for degradation of soy-lecithin, chlorpyrifos, methyl-parathion and phorate. Finally the most potent strain has been selected on the basis of five different water insoluble organic phosphate solubilization activity.

Organic phosphate solubilizing efficiency test

The marked bacterial culture has been spot plated on five different petri-plates containing modified Pikovskaya media with five different organic compounds. Here, calcium tri phosphate has been replaced from modified Pikovskaya media by any one of these five organic compounds separately. The five plates have been incubated at 350 C for 4 days. The clear zone, from each of the five plates, has been noted for its efficiency test. Insoluble phosphate solubilization efficiency has been calculated using the following formula13-15:

Solubilization Efficiency = (solubilization diameter/ growth diameter) X 100

Biochemical characterization
The supernatant or the whole cell bacterial culture has been used for its biochemical characterization according to the Bergey’s Manual of Determinative Bacteriology 16 except HCN and siderophore test.

Siderophore and HCN test
The seventy-two hours’ bacterial culture has been grown in King’s B broth 17 and it has been used for siderophore and HCN test. The protocol of Reeves et al. has been followed for siderophore test and dihydroxy benzoic acid has been used for standard curve18. HCN test for the isolate has been conducted according to the Reddy et al.19.

Antibiotic test
100 µl of bacterial culture has been spread on plate containing Nutrient agar media and 20 types of Icosa G-I plus antibiotic disc made by HIMEDIA Pvt. Ltd., Mumbai in sterile condition. All the plates have been incubated at 350 C for overnight.

Genomic DNA isolation and 16S rDNA amplification
Bacterial genomic DNA has been isolated according to the Murray et al. 20 and it has been dissolved in 50 µl TAE buffer. Here lysozyme is not used as the bacterial culture which is Gram negative in nature. This isolated DNA has been further used for polymerase chain reaction (PCR). The composition of master mix for PCR reaction has been used as 10X 2.5 µl of Taq polymerase buffer, 1 U Taq polymerase enzyme produced by Bangalore Genei, 2 mM of MgCl2, 200 mM of each of deoxynucleoside tri-phosphate, 50 mM of Tris-HCl, 50 ng of genomic DNA, 0.4 µM of each of forward (27F: 5'- AGAGTTTGATCCTGGTCAGAACGCT - 3') and reverse (1492R: 5'- TACGGCTACCTTGTTA CGACTTCACCCC-3') universal 16S rDNA primers. Here Mastercycler personal-22331 of Eppendrof AG, Germany has been used with standard thermal cycling conditions for amplification. The final PCR product has been assayed through 1% agarose gel electrophoresis.

16S rDNA Sequencing and BLAST analysis
Standard Sanger dideoxy method has been followed for 16S rDNA sequencing process. The final sequence has been further used for nucleotide BLAST2.3.1+ program and the top most hits have been selected from the result.

Submission in NCBI Database
The newly identified 16S rDNA sequence has been submitted to GenBank under NCBI database (http://www.ncbi.nlm.nih.gov).

Phylogenetic Tree Analysis
With maximum identity value from different genus have been selected from NBLAST result and has been further used for phylogenetic tree analysis. In this case, MEGA 6.0 program has been used with 26 sequences (collected from BLAST result) having maximum identities with newly identified one. CLUSTALW 1.6 has been used for multiple sequence alignment in MEGA 6.0. Finally best model has been selected for construction of phylogenetic tree.

LC-MS (Liquid Chromatography Mass Spectometry) Analysis
6th day’s bacterial culture broth of four different kinds of customized Pikovskaya media (mentioned earlier) containing (1) chlorpyrifos (2) methyl-parathion (3) phorate (4) calcium-phytate as a sole source of phosphate have been used for LC-MS analysis.  The centrifuged and purified supernatant has been applied for degradation pattern analysis of the organic compounds. Two different types of the columns have been used for LC-MS analysis of the samples. ODS-3 column has been selected for phorate, chlorpyrifos and calcium-phytate containing samples. Intersil C18 column has been utilized for methyl-parathion containing sample. The other conditions have been applied according to the M. K. Harishankar et. al., Jianhua Hao et. al., N. Bano et. al. and Ghorbani-Nasrabadi et. al. for chlorpyrifos, methyl parathion, phorate and calcium phytate respectively21-24.

Bio-fertilization test
Bio-fertilization activity of the strain has been studied from three different types of experimental conditions. In the first set, surface sterilized Cicer arietinum seeds have been inoculated in seven days’ treated sterilized soil. In the second set, treated seeds have been inoculated in organic phosphate containing treated soil. In the third set, treated seeds have been inoculated into organic phosphate and bacteria containing soil. On the 2nd day, number of seeds germinated has been noted and on the 14th day root-shoot development and other parameters have been noted accordingly.

Results
Each of the experiments has been conducted thrice and their average value is considered for experimental analysis. The name of isolated bacterial strain is RZ311.

Organic phosphate (OP) solubilization efficiency test result
Total ten isolates have been identified from Pikovskaya media with calcium phytate containing plate. Out of the ten, only one bacterial strain RZ311 can solubilize five different insoluble organic phosphate compounds. Organic Phosphate solubilization efficiency has been enlisted in Table 1.

Biochemical characterization
The different biochemical tests of RZ311 have been performed to study its characteristics. The test results related to gram staining, reaction of citrate, methyl-red, voges-proskaur and oxidase, utilization of catalase, starch hydrolysis, reduction of nitrate and HCN, urease activity, ammonia test and production of indole acetic acid have been shown in Table 2.

Siderophore test result
511.6 ppm of siderophore production with respect to the standard curve has been recorded for this new strain.

Antibiotic test report
The clear zone surrounding each of the 15 antibiotic discs have been shown either the zone of susceptibility or the intermediate on the basis of zone diameter record. On the other hand, 5 (Clindamycin 2, Teicoplanin 10, Vancomycin 30, Linezolid 30 and Erythromycin 15) antibiotic discs have not shown any zone surrounding the antibiotic disc. Clarithromycin 15, Oxacillin 1, Ampicilin 30 and Methicillin 5 are fallen under resistant zone. Azithromycin 15 is fallen under intermediate zone. Gentamicin 10, Ampicillin 10, Amikacin 30, Novobiocin 5, Tetracycline 30, Cephalothin 30, Ofloxacin 5, Co-Trimoxazole 25, Chloramphenicol 30 and Penicillin 10 are under susceptibility zone. Table 3 shows the detailed results.

Nucleotide BLAST results
From the analysis, it has been found that RZ311 is 99% identical with Enterobacter aerogenes strain KCTC with maximum score of 1459. The E-value of it is found to be 0.0.

NCBI database and Phylogenetic tree analysis

GenBank has assigned 16S rDNA partial sequence in its database on 22nd June, 2016. The GenBank has provided accession number of KX352268 for RZ311. It has been named as Enterobacter aerogenes strain STLR-I. In the model analysis section, it has been found that “JC+I” can be considered as the best model for construction of phylogenetic tree. Figure 1. shows the phylogenetic relationship among different species from different genus.

LC-MS analysis result
Total Ionization Chromatogram (TIC) of LC-MS results of four different samples containing (1) calcium phytate (IP6) (2) methyl-parathion, (3) chlorpyrifos, (4) phorate have been shown in the Figure 2, Figure 3, Figure 4 and Figure 5 respectively. The different peaks of each of four samples has been mentioned in the Figures 2, 3, 4 and 5.

Biofertilization activity
 
Figures 6 and 7 show the vigor index and germination index of Cicer arietinum seeds’ activities in different inoculants. From the in-vitro test of seed germination and their plant-let growth, it has been found that CAP RZ311, CH RZ311, CAP C, PH RZ311, PA RZ311, PH C, Control, PA C and CH C are the types of inoculant in treated soil.

Discussion
It is evident from the water insoluble organophosphate solubilization test that the rhizobacterial strain, RZ311, is a very potent calcium phytate, chlorpyrifos, methyl-parathion and phorate biodegreder. Again, 585.37% of solubilization index manifest about its higher rate of phytase activity for degradation of calcium phytate. But it has negative lecithinase activity as it is just unable to degrade soy-lecithin.

Biochemical characterization of RZ311 manifest that it is able to secrete enzymes, such as urease, amylase, oxidase and catalase. Such properties help this specific strain to survive under adverse conditions and also can be used as a potent bioremidieter because it can convert urea into ammonia and CO2, starch into maltose, may transport electron to cytochrome C.  RZ311 may also have anti-fungal activity due to the presence of positive siderophore reaction. It can form iron-siderophore complex to form a boundary surrounding it and utilizes as per its requirement in iron limiting condition. Again, RZ311 has plant growth promoting rhizobacterial activity due to its positive result of siderophore.

RZ311 is highly sensitive to Clarithromycin, Gentamicin, Oxacillin, Ampicillin, Amikacin, Novobiocin, Tetracycline, Cephalothin, Ofloxacin, Co-Trimoxazole, Chloramphenicol, Methicillin, Penicillin, and Azithromycin, that is, RZ311 is unable to survive in presence of these antibiotics. Hence, RZ311 is safe to handle.

Phylogenetic analysis has been shown 0.1% divergence among the studied bacterial species. RZ311 or Enterobacter aerogenes strain STLR-I is closely related to Enterobacter aerogenes strain NCTC 10006.

The LC-MS analysis shows that RZ311 is able to degrade completely calcium phytate, chlorpyrifos, methyl-parathion and phorate. Hence the bacterial degraded of four water insoluble organophosphate compounds have been used for LC-MS study. The bio-degraded products contain ammonium phosphate, ammonium polyphosphate, phosphoric acid, P2O5 etc. The final bi-products are water soluble, non-toxic compounds that can be easily consumed by the plants and other micro-organisms. RZ311 strain completely degrades chlorpyrifos into pyruvic acid through TCP (3, 5, 6-trichloro-2-pyrinidol). This TCP degradation and pyruvic acid formation, is the notable work done and it makes this strain different with respect to other reported Enterobacter sp. so far.

The seed germination rate of calcium-phytate and phorate is different from methyl-parathion and chlorpyrifos. For calcium-phytate and phorate the seed germination rate is (RZ311 + OP + seed) > (OP + seed) > seed. Again for methyl-parathion and chlorpyrifos the seed germination rate is (RZ311 + OP + seed) > control > (OP + seed). The rate of vigor-index is as follows: (calcium-phytate + RZ311) > (chlorpyrifos + RZ311) > (calcium-phytate without RZ311) > (phorate + RZ311) > (methyl-parathion + RZ311) > (phorate without RZ311) > control.

Conclusion
The newly isolated bacterial strain RZ311 or Enterobacter aerogenes strain STLR-I, is highly useful for biodegradation of toxic water-insoluble organophosphorus compounds, such as calcium-phytate, chlorpyrifos, methyl-parathion and phorate into non-toxic water soluble compounds. Thus, such types of bio-inoculants can be used to decontaminate the terrestrial as well as aquatic environment from various types of toxic chemicals. The degraded soluble phosphate compounds are consumed by the plants. These soluble phosphates improve soil quality and growth of plants.  These soluble phosphates in the soil can reduce the consumption of synthetic fertilizers. Field application is our future objective to extend this work.

Acknowledgement:
We are very thankful to Dr. N. K. Mandal and Sreyasree Mandal for their work on the language of the manuscript. In addition, Dr. Achintya Mondal and Manas Mondal helped for the data analysis and sample collection. Authors acknowledge the immense help received from the scholars whose articles are cited and included in references of this manuscript. The authors are also grateful to authors/editors/publishers of all those articles, journals and books from where the literature for this article has been reviewed and discussed.

Conflict of interest
All authors have no conflict of interest in conducting and publishing the research paper.

Funding
Funding is not available from any sources.

 

 

 

 

 

 

 






 

References:

  1. Khan MS, Zaidi A, Ahemad M, Oves M, Wani PA. Plant growth promotion by phosphate solubilizing fungi – current perspective. Arch Agron Soil Sci 2010; 56:73– 98.
  2. Saber K, Nahla LD, Chedly A. Effect of P o n nodule formation and N fixation in bean. Agron Sustain Dev 2005; 25:389 – 393.
  3. Sharma SB, Sayyed RZ, Trivedi MH, Gobi TA. Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils. Springer Plus 3013; 587 (2 Pt 1): 1-14.
  4. Richardson AE. Soil microorganisms and phosphorus availability. In:Pankhurst CE, Doubeand BM, Gupta VVSR (eds) Soil biota: management in sustainable farming systems. CSIRO, Victoria, Australia, 1994; 50 –62.
  5. Zhou K, Binkley D, Doxtader KG. A new method for estimating gross phosphorus mineralization and immobilization rates in soils. Plant Soil 1992; 147:243– 250.
  6. Sanchez P, Logan T. Myths and science about the chemistry and fertility of soils in the tropics. In: Lal R, Sanchez P (eds) Myths and science of soils of the tropics. Soil Science Society of America, Madison, WI 1992; 35– 46.
  7. Tilman D, Fargione J, Wolff B, D’ Antonio C, Dobson A, Howarth R, Schindler D, Schlesinger WH, Simberloff D, Wackhamer D. Forecasting agriculturally driven global environmental change. Science 2001; 292:281–284.
  8. Schindler DW, Hecky RE, Findlay DL, Stainton MP, Parker BR, Paterson MJ, Beaty KG, Lyng M, Kasian SEM. Eutrophication of lakes cannot be controlled by reducing nitrogen input: results of a 37-year whole-ecosystem experiment. Proc Natl Acad Sci U S A 2008; 105:11254 –11258.
  9. Abhilash PC, Singh N. Pesticide use and application: an Indian scenario. J Hazar Mater 2009 Jun 15; 165(1 Pt 3):1–12.
  10. Singh B, Satyanarayana T. Applications of phytase of thermophilic mould, Sporotrichum  thermophile: A review. J Sci Ind Res (India) 2010 Jun; 411-414.
  11. Pikovskaya RI. Mobilization of phosphorus and soil in connection with the vital activity of some microbial species. Mikrobiologii 1948; 17:362–70.
  12. Gaur AC. Phospho-microorganism and varians transformation In Compost Technology, Project Field Document No. 13 FAO, Rome, Italy. 1981; 106-111.
  13. Nguyen C, Yan W, Tacon F L, Lapeyrie F. Genetic viability of phosphate solubilizing activity by monocaryotic and dicatyotic mycelia of the ectomycorrhyzal fungus Laccaria bicolor (Maire) PD Orton, Plant Soil 1992; 143: 193-199.
  14. Seshadri S, Ignacimuthu S, Lakshminarsimhan C. Variations in heterotrophic and phosphate solubilizing bacteria from Chennai, southeast coast of India. Indian J Mar Sci, 2002; 31: 69-72.
  15. Widawati S. Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem. Biodiversitas 2011; 12 (1): 17-21.
  16. Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams ST. Bergey’s Manual of Determinative Bacteriology. 9th edition published by Williams and Wilkins, A. Wavely company, Baltimore. 1994.
  17. King EO, Ward MK, Raney DE. Two simple media for the demonstra- tion of Pyocianin and fluorescein. J Lab Clin Med 1954; 44: 301-307.
  18. Reeves M, Pine L, Neilands JB, Bullows A. Absence of siderophore activity in Legionella spp. grown in iron defi- cient media. J Bacteriology 1983; 154: 324-329.
  19. Reddy BP, Reddy KRN, Rao MS, Rao KS. Efficacy of Antimicrobial Metabolites of Pseudomonas fluorescens Against Rice Fungal Pathogens. Curr Trends Biotechnol Pharm Association of Biotechnology and Pharmacy 2008; 17 (2 Pt 1): 178-182.
  20. Murray MG, Thormpson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res 1980; 8: 4321-4326.
  21. Harishankar MK, Sasikala C, Ramya M. Ef?ciency of the intestinal bacteria in the degradation of the toxic pesticide, chlorpyrifos. 3 Biotech 2013 April; 3(2): 137-142.
  1. Hao J, Liu J,  Sun M. Identification of a Marine Bacillus Strain C5 and Parathion-Methyl Degradation Characteristics of the Extracellular E sterase B1. BioMed Res. Int 2014; 2014 Article ID 863094, 7 pages.
  2. Bano N, Musarrat J. Isolation and characterization of phorate degrading soil bacteria of environmental and agronomic signi?cance. Lett Appl Microbiol 2003; 36(6):349-53.
  3. Ghorbani-Nasrabadi R, Greiner R, Alikhani HA, Hamedi J, Yakhchali B. Distribution of  actinomycetes in different soil ecosystems and effect of media composition on extracellular phosphatase activity. J. Soil Sci. Plant Nutr 2013; 13(1): 223-236.

Announcements

Dr. Pramod Kumar Manjhi joined Editor-in-Chief since July 2021 onwards

COPE guidelines for Reviewers

SCOPUS indexing: 2014, 2019 to 2021


Awards, Research and Publication incentive Schemes by IJCRR

Best Article Award: 

One article from every issue is selected for the ‘Best Article Award’. Authors of selected ‘Best Article’ are rewarded with a certificate. IJCRR Editorial Board members select one ‘Best Article’ from the published issue based on originality, novelty, social usefulness of the work. The corresponding author of selected ‘Best Article Award’ is communicated and information of award is displayed on IJCRR’s website. Drop a mail to editor@ijcrr.com for more details.

Women Researcher Award:

This award is instituted to encourage women researchers to publish her work in IJCRR. Women researcher, who intends to publish her research work in IJCRR as the first author is eligible to apply for this award. Editorial Board members decide on the selection of women researchers based on the originality, novelty, and social contribution of the research work. The corresponding author of the selected manuscript is communicated and information is displayed on IJCRR’s website. Under this award selected women, the author is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.

Emerging Researcher Award:

‘Emerging Researcher Award’ is instituted to encourage student researchers to publish their work in IJCRR. Student researchers, who intend to publish their research or review work in IJCRR as the first author are eligible to apply for this award. Editorial Board members decide on the selection of student researchers for the said award based on originality, novelty, and social applicability of the research work. Under this award selected student researcher is eligible for publication incentives. Drop a mail to editor@ijcrr.com for more details.


Best Article Award

A study by Dorothy Ebere Adimora et al. entitled \"Remediation for Effects of Domestic Violence on Psychological well-being, Depression and Suicide among Women During COVID-19 Pandemic: A Cross-cultural Study of Nigeria and Spain\" is awarded Best Article of Vol 14 issue 23
A study by Muhas C. et al. entitled \"Study on Knowledge & Awareness About Pharmacovigilance Among Pharmacists in South India\" is awarded Best article for Vol 14 issue 22
A study by Saurabh Suvidha entitled \"A Case of Mucoid Degeneration of Uterine Fibroid with Hydrosalphinx and Ovarian Cyst\" is awarded Best article of Vol 14 issue 21
A study by Alice Alice entitled \"Strengthening of Human Milk Banking across South Asian Countries: A Next Step Forward\" is awarded Best article of Vol 14 issue 20
A study by Sathyanarayanan AR et al. entitled \"The on-task Attention of Individuals with Autism Spectrum Disorder-An Eye Tracker Study Using Auticare\" is awarded Best article of Vol 14 issue 19
A study by Gupta P. et al. entitled \"A Short Review on \"A Novel Approach in Fast Dissolving Film & their Evaluation Studies\" is awarded Best Article of Vol 14 issue 18.
A study by Shafaque M. et al. entitled \"A Case-Control Study Performed in Karachi on Inflammatory Markers by Ciprofloxacin and CoAmoxicillin in Patients with Chronic Suppurative Otitis Media\" is awarded Best Article of Vol 14 issue 17
A study by Ali Nawaz et al. entitled \"A Comparative Study of Tubeless versus Standard Percutaneous Nephrolithotomy (PCNL) \? A Randomized Controlled Study\" is awarded Best Article for Vol 14 issue 16.
A study by Singh R. et al. entitled \"A Prospective Study to Find the Association of Astigmatism in Patients of Vernal Keratoconjunctivitis (VKC) in a Tertiary Health Care Centre in India (Vindhya Region MP)\" is awarded Best Article for Vol 14 issue 15
A Study by Humaira Tahir et al. entitled "Comparison of First Analgesic Demand after Major Surgeries of Obstetrics and Gynecology between Pre-Emptive Versus Intra-Operative Groups by Using Intravenous Paracetamol: A Cross-Sectional Study" is awarded Best Article for Vol 14 issue 14
A Study by Monica K. entitled "Risk Predictors for Lymphoma Development in Sjogren Syndrome - A Systematic Review" is awarded Best Article for Vol 14 issue 13
A Study by Mokhtar M Sh et al. entitled "Prevalence of Hospital Mortality of Critically Ill Elderly Patients" is awarded Best Article for Vol 14 issue 12
A Study by Vidya S. Bhat et al. entitled "Effect of an Indigenous Cleanser on the Microbial Biofilm on Acrylic Denture Base - A Pilot Study" is awarded Best Article for Vol 14 issue 11
A Study by Pandya S. et al. entitled "Acute and 28-Day Repeated Dose Subacute Toxicological Evaluation of Coroprotect Tablet in Rodents" is awarded Best Article for Vol 14 issue 10
A Study by Muhammad Zaki et al. entitled "Effect of Hemoglobin Level on the Severity of Acute Bronchiolitis in Children: A Case-Control Study" is awarded Best Article for Vol 14 issue 09
A Study by Vinita S & Ayushi S entitled "Role of Colour Doppler and Transvaginal Sonography for diagnosis of endometrial pathology in women presenting with Abnormal Uterine Bleeding" is awarded Best Article for Vol 14 issue 08
A Study by Prabhu A et al. entitled "Awareness of Common Eye Conditions among the ASHA (Accredited Social Health Activist) Workers in the Rural Communities of Udupi District- A Pilot Study" is awarded Best Article for Vol 14 issue 07
A Study by Divya MP et al. entitled "Non-Echoplanar Diffusion-Weighted Imaging and 3D Fiesta Magnetic Resonance Imaging Sequences with High Resolution Computed Tomography Temporal Bone in Assessment and Predicting the Outcome of Chronic Suppurative Otitis Media with Cholesteatoma" is awarded Best Article for Vol 14 issue 06
A Study by Zahoor Illahi Soomro et al. entitled "Functional Outcomes of Fracture Distal Radius after Fixation with Two Different Plates: A Retrospective Comparative Study" is awarded Best Article for Vol 14 issue 05
A Study by Ajai KG & Athira KN entitled "Patients’ Gratification Towards Service Delivery Among Government Hospitals with Particular Orientation Towards Primary Health Centres" is awarded Best Article for Vol 14 issue 04
A Study by Mbungu Mulaila AP et al. entitled "Ovarian Pregnancy in Kindu City, D.R. Congo - A Case Report" is awarded Best Article for Vol 14 issue 03
A Study by Maryam MJ et al. entitled "Evaluation Serum Chemerin and Visfatin Levels with Rheumatoid Arthritis: Possible Diagnostic Biomarkers" is awarded Best Article for Vol 14 issue 02
A Study by Shanthan KR et al. entitled "Comparison of Ultrasound Guided Versus Nerve Stimulator Guided Technique of Supraclavicular Brachial Plexus Block in Patients Undergoing Upper Limb Surgeries" is awarded Best Article for Vol 14 issue 01
A Study by Amol Sanap et al. entitled "The Outcome of Coxofemoral Bypass Using Cemented Bipolar Hemiarthroplasty in the Treatment of Unstable Intertrochanteric Fracture of Femur in a Rural Setup" is awarded Best Article Award of Vol 13 issue 24
A Study by Manoj KP et al. entitled "A Randomized Comparative Clinical Trial to Know the Efficacy of Ultrasound-Guided Transversus Abdominis Plane Block Against Multimodal Analgesia for Postoperative Analgesia Following Caesarean Section" is awarded Best Article Award of Vol 13 issue 23
A Study by Karimova II et al. entitled "Changes in the Activity of Intestinal Carbohydrases in Alloxan-Induced Diabetic Rats and Their Correction with Prenalon" is awarded Best Article of Vol 13 issue 22
A Study by Ashish B Roge et al. entitled "Development, Validation of RP-HPLC Method and GC MS Analysis of Desloratadine HCL and It’s Degradation Products" is awarded Best Article of Vol 13 issue 21
A Study by Isha Gaurav et al. entitled "Association of ABO Blood Group with Oral Cancer and Precancer – A Case-control Study" is awarded Best Article for Vol 13 issue 20
A Study by Amr Y. Zakaria et al. entitled "Single Nucleotide Polymorphisms of ATP-Binding Cassette Gene(ABCC3 rs4793665) affect High Dose Methotrexate-Induced Nephrotoxicity in Children with Osteosarcoma" is awarded Best Article for Vol 13 issue 19
A Study by Kholis Ernawati et al. entitled "The Utilization of Mobile-Based Information Technology in the Management of Dengue Fever in the Community Year 2019-2020: Systematic Review" is awarded Best Article for Vol 13 issue 18
A Study by Bhat Asifa et al. entitled "Efficacy of Modified Carbapenem Inactivation Method for Carbapenemase Detection and Comparative Evaluation with Polymerase Chain Reaction for the Identification of Carbapenemase Producing Klebsiella pneumonia Isolates" is awarded Best Article for Vol 13 issue 17
A Study by Gupta R. et al. entitled "A Clinical Study of Paediatric Tracheostomy: Our Experience in a Tertiary Care Hospital in North India" is awarded Best Article for Vol 13 issue 16
A Study by Chandran Anand et al. entitled "A Prospective Study on Assessment of Quality of Life of Patients Receiving Sorafenib for Hepatocellular Carcinoma" is awarded Best article for Vol 13 issue 15
A Study by Rosa PS et al. entitled "Emotional State Due to the Covid – 19 Pandemic in People Residing in a Vulnerable Area in North Lima" is awarded Best Article for Vol 13 issue 14
A Study by Suvarna Sunder J et al. entitled "Endodontic Revascularization of Necrotic Permanent Anterior Tooth with Platelet Rich Fibrin, Platelet Rich Plasma, and Blood Clot - A Comparative Study" is awarded Best Article for Vol 13 issue 13
A Study by Mona Isam Eldin Osman et al. entitled "Psychological Impact and Risk Factors of Sexual Abuse on Sudanese Children in Khartoum State" is awarded Best Article for Vol 13 issue 12
A Study by Khaw Ming Sheng & Sathiapriya Ramiah entitled "Web Based Suicide Prevention Application for Patients Suffering from Depression" is awarded Best Article for Vol 13 issue 11
A Study by Purushottam S. G. et al. entitled "Development of Fenofibrate Solid Dispersions for the Plausible Aqueous Solubility Augmentation of this BCS Class-II Drug" is awarded Best article for Vol 13 issue 10
A Study by Kumar S. et al. entitled "A Study on Clinical Spectrum, Laboratory Profile, Complications and Outcome of Pediatric Scrub Typhus Patients Admitted to an Intensive Care Unit from a Tertiary Care Hospital from Eastern India" is awarded Best Article for Vol 13 issue 09
A Study by Mardhiah Kamaruddin et al. entitled "The Pattern of Creatinine Clearance in Gestational and Chronic Hypertension Women from the Third Trimester to 12 Weeks Postpartum" is awarded Best Article for Vol 13 issue 08
A Study by Sarmila G. B. et al. entitled "Study to Compare the Efficacy of Orally Administered Melatonin and Clonidine for Attenuation of Hemodynamic Response During Laryngoscopy and Endotracheal Intubation in Gastrointestinal Surgeries" is awarded Best Article for Vol 13 issue 07
A Study by M. Muthu Uma Maheswari et al. entitled "A Study on C-reactive Protein and Liver Function Tests in Laboratory RT-PCR Positive Covid-19 Patients in a Tertiary Care Centre – A Retrospective Study" is awarded Best Article of Vol 13 issue 06 Special issue Modern approaches for diagnosis of COVID-19 and current status of awareness
A Study by Gainneos PD et al. entitled "A Comparative Evaluation of the Levels of Salivary IgA in HIV Affected Children and the Children of the General Population within the Age Group of 9 – 12 Years – A Cross-Sectional Study" is awarded Best Article of Vol 13 issue 05 Special issue on Recent Advances in Dentistry for better Oral Health
A Study by Alkhansa Mahmoud et al. entitled "mRNA Expression of Somatostatin Receptors (1-5) in MCF7 and MDA-MB231 Breast Cancer Cells" is awarded Best Article of Vol 13 issue 06
A Study by Chen YY and Ghazali SRB entitled "Lifetime Trauma, posttraumatic stress disorder Symptoms and Early Adolescence Risk Factors for Poor Physical Health Outcome Among Malaysian Adolescents" is awarded Best Article of Vol 13 issue 04 Special issue on Current Updates in Plant Biology to Medicine to Healthcare Awareness in Malaysia
A Study by Kumari PM et al. entitled "Study to Evaluate the Adverse Drug Reactions in a Tertiary Care Teaching Hospital in Tamilnadu - A Cross-Sectional Study" is awarded Best Article for Vol 13 issue 05
A Study by Anu et al. entitled "Effectiveness of Cytological Scoring Systems for Evaluation of Breast Lesion Cytology with its Histopathological Correlation" is awarded Best Article of Vol 13 issue 04
A Study by Sharipov R. Kh. et al. entitled "Interaction of Correction of Lipid Peroxidation Disorders with Oxibral" is awarded Best Article of Vol 13 issue 03
A Study by Tarek Elwakil et al. entitled "Led Light Photobiomodulation Effect on Wound Healing Combined with Phenytoin in Mice Model" is awarded Best Article of Vol 13 issue 02
A Study by Mohita Ray et al. entitled "Accuracy of Intra-Operative Frozen Section Consultation of Gastrointestinal Biopsy Samples in Correlation with the Final Histopathological Diagnosis" is awarded Best Article for Vol 13 issue 01
A Study by Badritdinova MN et al. entitled "Peculiarities of a Pain in Patients with Ischemic Heart Disease in the Presence of Individual Combines of the Metabolic Syndrome" is awarded Best Article for Vol 12 issue 24
A Study by Sindhu Priya E S et al. entitled "Neuroprotective activity of Pyrazolone Derivatives Against Paraquat-induced Oxidative Stress and Locomotor Impairment in Drosophila melanogaster" is awarded Best Article for Vol 12 issue 23
A Study by Habiba Suhail et al. entitled "Effect of Majoon Murmakki in Dysmenorrhoea (Usre Tams): A Standard Controlled Clinical Study" is awarded Best Article for Vol 12 issue 22
A Study by Ghaffar UB et al. entitled "Correlation between Height and Foot Length in Saudi Population in Majmaah, Saudi Arabia" is awarded Best Article for Vol 12 issue 21
A Study by Siti Sarah Binti Maidin entitled "Sleep Well: Mobile Application to Address Sleeping Problems" is awarded Best Article for Vol 12 issue 20
A Study by Avijit Singh"Comparison of Post Operative Clinical Outcomes Between “Made in India” TTK Chitra Mechanical Heart Valve Versus St Jude Mechanical Heart Valve in Valve Replacement Surgery" is awarded Best Article for Vol 12 issue 19
A Study by Sonali Banerjee and Mary Mathews N. entitled "Exploring Quality of Life and Perceived Experiences Among Couples Undergoing Fertility Treatment in Western India: A Mixed Methodology" is awarded Best Article for Vol 12 issue 18
A Study by Jabbar Desai et al. entitled "Prevalence of Obstructive Airway Disease in Patients with Ischemic Heart Disease and Hypertension" is awarded Best Article for Vol 12 issue 17
A Study by Juna Byun et al. entitled "Study on Difference in Coronavirus-19 Related Anxiety between Face-to-face and Non-face-to-face Classes among University Students in South Korea" is awarded Best Article for Vol 12 issue 16
A Study by Sudha Ramachandra & Vinay Chavan entitled "Enhanced-Hybrid-Age Layered Population Structure (E-Hybrid-ALPS): A Genetic Algorithm with Adaptive Crossover for Molecular Docking Studies of Drug Discovery Process" is awarded Best article for Vol 12 issue 15
A Study by Varsha M. Shindhe et al. entitled "A Study on Effect of Smokeless Tobacco on Pulmonary Function Tests in Class IV Workers of USM-KLE (Universiti Sains Malaysia-Karnataka Lingayat Education Society) International Medical Programme, Belagavi" is awarded Best article of Vol 12 issue 14, July 2020
A study by Amruta Choudhary et al. entitled "Family Planning Knowledge, Attitude and Practice Among Women of Reproductive Age from Rural Area of Central India" is awarded Best Article for special issue "Modern Therapeutics Applications"
A study by Raunak Das entitled "Study of Cardiovascular Dysfunctions in Interstitial Lung Diseas epatients by Correlating the Levels of Serum NT PRO BNP and Microalbuminuria (Biomarkers of Cardiovascular Dysfunction) with Echocardiographic, Bronchoscopic and HighResolution Computed Tomography Findings of These ILD Patients" is awarded Best Article of Vol 12 issue 13 
A Study by Kannamani Ramasamy et al. entitled "COVID-19 Situation at Chennai City – Forecasting for the Better Pandemic Management" is awarded best article for  Vol 12 issue 12
A Study by Muhammet Lutfi SELCUK and Fatma entitled "Distinction of Gray and White Matter for Some Histological Staining Methods in New Zealand Rabbit's Brain" is awarded best article for  Vol 12 issue 11
A Study by Anamul Haq et al. entitled "Etiology of Abnormal Uterine Bleeding in Adolescents – Emphasis Upon Polycystic Ovarian Syndrome" is awarded best article for  Vol 12 issue 10
A Study by entitled "Estimation of Reference Interval of Serum Progesterone During Three Trimesters of Normal Pregnancy in a Tertiary Care Hospital of Kolkata" is awarded best article for  Vol 12 issue 09
A Study by Ilona Gracie De Souza & Pavan Kumar G. entitled "Effect of Releasing Myofascial Chain in Patients with Patellofemoral Pain Syndrome - A Randomized Clinical Trial" is awarded best article for  Vol 12 issue 08
A Study by Virendra Atam et. al. entitled "Clinical Profile and Short - Term Mortality Predictors in Acute Stroke with Emphasis on Stress Hyperglycemia and THRIVE Score : An Observational Study" is awarded best article for  Vol 12 issue 07
A Study by K. Krupashree et. al. entitled "Protective Effects of Picrorhizakurroa Against Fumonisin B1 Induced Hepatotoxicity in Mice" is awarded best article for issue Vol 10 issue 20
A study by Mithun K.P. et al "Larvicidal Activity of Crude Solanum Nigrum Leaf and Berries Extract Against Dengue Vector-Aedesaegypti" is awarded Best Article for Vol 10 issue 14 of IJCRR
A study by Asha Menon "Women in Child Care and Early Education: Truly Nontraditional Work" is awarded Best Article for Vol 10 issue 13
A study by Deep J. M. "Prevalence of Molar-Incisor Hypomineralization in 7-13 Years Old Children of Biratnagar, Nepal: A Cross Sectional Study" is awarded Best Article for Vol 10 issue 11 of IJCRR
A review by Chitra et al to analyse relation between Obesity and Type 2 diabetes is awarded 'Best Article' for Vol 10 issue 10 by IJCRR. 
A study by Karanpreet et al "Pregnancy Induced Hypertension: A Study on Its Multisystem Involvement" is given Best Paper Award for Vol 10 issue 09

List of Awardees

A Study by Ese Anibor et al. "Evaluation of Temporomandibular Joint Disorders Among Delta State University Students in Abraka, Nigeria" from Vol 13 issue 16 received Emerging Researcher Award


A Study by Alkhansa Mahmoud et al. entitled "mRNA Expression of Somatostatin Receptors (1-5) in MCF7 and MDA-MB231 Breast Cancer Cells" from Vol 13 issue 06 received Emerging Researcher Award


RSS feed

Indexed and Abstracted in


Antiplagiarism Policy: IJCRR strongly condemn and discourage practice of plagiarism. All received manuscripts have to pass through "Plagiarism Detection Software" test before Toto Macau forwarding for peer review. We consider "Plagiarism is a crime"

IJCRR Code of Conduct: To achieve a high standard of publication, we adopt Good Publishing Practices (updated in 2022) which are inspired by guidelines provided by Committee on Publication Ethics (COPE), Open Access Scholarly Publishers Association (OASPA) and International Committee of Medical Journal Editors (ICMJE)

Disclaimer: International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal.



ABOUT US

International Journal of Current Research and Review (IJCRR) provides platform for researchers to publish and discuss their original research and review work. IJCRR can not be held responsible for views, opinions and written statements of researchers published in this journal

Contact

148, IMSR Building, Ayurvedic Layout,
        Near NIT Complex, Sakkardara,
        Nagpur-24, Maharashtra State, India

editor@ijcrr.com

editor.ijcrr@gmail.com


Copyright © 2024 IJCRR. Specialized online journals by ubijournal .Website by Ubitech solutions